|
|
||||||||
|
First published online October 13, 2006; 10.1104/pp.106.087700 Plant Physiology 142:1353-1363 (2006) © 2006 American Society of Plant Biologists OPEN ACCESS ARTICLE
Interactions between MUR10/CesA7-Dependent Secondary Cellulose Biosynthesis and Primary Cell Wall Structure1,[OA]John Innes Centre, Norwich NR4 7UH, United Kingdom (S.B., K.R., G.J.S.); Institute of Food Research, Norwich Research Park, Colney, Norwich NR4 7UA, United Kingdom (P.R.); Department of Biochemistry, University of Cambridge, Cambridge CB2 1QW, United Kingdom (C.J.B.); Centre for Novel Agricultural Products, Department of Biology, University of York, York YO10 5DD, United Kingdom (N.G.T.); and Max-Planck Institute for Molecular Plant Physiology, 14476 Golm, Germany (L.N., M.P.)
Primary cell walls are deposited and remodeled during cell division and expansion. Secondary cell walls are deposited in specialized cells after the expansion phase. It is presently unknown whether and how these processes are interrelated. The Arabidopsis (Arabidopsis thaliana) MUR10 gene is required for normal primary cell wall carbohydrate composition in mature leaves as well as for normal plant growth, hypocotyl strength, and fertility. The overall sugar composition of young mur10 seedlings is not significantly altered; however, the relative proportion of pectin side chains is shifted toward an increase in 1 5- -arabinan relative to 1 4- -galactan. mur10 seedlings display reduced fucogalactosylation of tightly cell wall-bound xyloglucan. Expression levels of genes encoding either nucleotide sugar interconversion enzymes or glycosyl transferases, known to be involved in primary and secondary cell wall biosynthesis, are generally unaffected; however, the CesA7 transcript is specifically suppressed in the mur10-1 allele. The MUR10 locus is identical with the CesA7 gene, which encodes a cellulose catalytic subunit previously thought to be specifically involved in secondary cell wall formation. The xylem vessels in young mur10 hypocotyls are collapsed and their birefringence is lost. Moreover, a fucogalactosylated xyloglucan epitope is reduced and a 1 5- -arabinan epitope increased in every cell type in mur10 hypocotyls, including cells that do not deposit secondary walls. mur10 also displays altered distribution of an arabinogalactan-protein epitope previously associated with xylem differentiation and secondary wall thickening. This work indicates the existence of a mechanism that senses secondary cell wall integrity and controls biosynthesis or structural remodeling of primary cell walls and cellular differentiation.
Cell walls are crucial for most aspects of plant life. Primary cell walls form the first intercellular boundary between newly divided cells. During cell expansion, walls have to locally yield to expansive turgor forces and continue to grow by the deposition of new wall material. After a cell has ceased to expand, it differentiates into a mature, specialized cell type. Usually this involves modifications to the cell wall, the most dramatic of which is the deposition of secondary cell wall material resulting in mechanical reinforcement. Several genes involved in primary and secondary cell wall carbohydrate biosynthesis have been identified, initially using forward genetic (Scheible and Pauly, 2004
Morphological, Mechanical, and Biochemical Defects in mur10 Seedlings
mur10 plants display a phenotype early during development that is visible on petri dishes in 10-d-old seedlings (Fig. 1
). Compared to the wild type, mur10 seedlings show a reduction in growth and dark-green coloration of the aerial parts. Once plants are transferred to soil, the clear differences between mutant and wild-type phenotype are maintained. Both alleles are smaller and darker than the wild type (Fig. 1). As reported previously, mutations in MUR10 cause a dramatic reduction in fertility, typically with fewer than 10 seeds per plant (Reiter et al., 1997
Subtle and Complex Alterations of mur10 Primary Cell Walls
Despite the clear morphological phenotype, cell wall neutral sugar composition does not consistently differ between 10-d-old Columbia (Col-0) and mur10 seedlings. Mutants show a reduction in Fuc, Xyl, Ara, and Man in both alleles (not statistically significant), whereas Rha and Gal differ between alleles (data not shown). Pectin composition of 10-d-old seedlings obtained by polysaccharide analysis using carbohydrate gel electrophoresis (PACE; Barton et al., 2006
Normal Expression of Genes Involved in Cell Wall Biosynthesis The complex alterations in both structure and amount of different wall polysaccharides prompted us to analyze the transcript levels of genes encoding nucleotide sugar interconversion enzymes involved in the synthesis of Fuc and Xyl and the glycosyl transferase genes involved in primary cell wall polysaccharides, xyloglucan, and pectin. However, neither the transcript levels of genes encoding nucleotide sugar interconversion enzymes (data not shown) nor the glycosyl transferases specifically involved in cell wall matrix polymer biosynthesis (Fig. 3 ) are affected in mur10 mutants. Genes encoding cellulose synthase catalytic subunits are also unaffected (Fig. 3). The only exception is the CesA7 transcript, which is less abundant in the mur10-1 mutant compared to wild type and the mur10-2 mutant (Fig. 3).
Identification of MUR10
The morphological phenotype segregating in an F2 population mur10-2 (Col-0) x Landsberg erecta (Ler) was mapped to the corresponding genetic locus. Initial linkage analysis, involving 24 mutant plants, locates MUR10 to the top of chromosome V between the simple sequence length polymorphic markers nga106 and nga139. These markers are located at 33.35 and 50.48 cM, respectively, on the recombinant inbred map for Arabidopsis chromosome V (Lister and Dean, 1993
Altered Secondary Cell Walls in mur10
The IRX3 locus was identified in a screen for irregular xylem morphology. The irx mutants show collapse of xylem vessel cells and an almost complete absence of secondary wall cellulose (Turner and Somerville, 1997
The CesA7 Promoter Is Active in Secondary Cell Wall-Forming Tissue
Previous data suggest that IRX3/FRA5/MUR10 expression is strictly associated with secondary cell wall formation (Brown et al., 2005
Cell Wall Alterations in mur10 Xylem and Nonxylem Cells
A series of antibodies directed against primary and secondary cell wall polysaccharide epitopes decorate wild-type and mur10 hypocotyl sections (Fig. 7
). Labeling reveals subtle differences between sections of mur10 and wild type in their cross-reactivity with CCRC-M1 and LM6 antibodies, which bind to components of primary cell wall, fucogalactosylated xyloglucan (Freshour et al., 1996
MUR10 and IRX3/FRA5 Are Identical In this study, we show that the MUR10 gene, which has previously been shown to be required for wild-type neutral sugar composition in primary cell walls, is identical to the IRX3/FRA5 locus that is necessary for cellulose deposition in secondary walls. This is supported by mapping of the morphological mur10 phenotype to the IRX3/FRA5 region, identification of single-base-pair substitutions in both independent mur10 alleles, observation that T-DNA insertions in IRX3/FRA5 in the Col-0 background display the mur10 morphological phenotype, and, by a similar, but less pronounced, neutral sugar phenotype in the irx3-1 mutant.
Both mur10 mutations occur between two different highly conserved regions important for substrate binding and catalysis (Fig. 4B) and probably represent complete or near-complete loss-of-function alleles. Whereas the missense mur10-2 mutation affects a His residue located between a conserved Asp residue and a conserved QxxRW motif, which is conserved among all CesA genes from various organisms but is not totally conserved in the CesA/Csl superfamily (Fig. 4C), the mur10-1 mutation causes a premature termination of translation in place of the residue Trp-444. Although there might be some residual function in mur10-2, the growth phenotype and all other phenotypic aspects were very similar to mur10-1, which presumably represents a full loss-of-function allele. This is probably also the case with the irx3-1 allele that results in premature termination of translation at amino acid residue Trp-859 (Taylor et al., 1999
Comparative reverse transcription-PCR analysis of transcript levels of CesA genes in wild type and two mur10 alleles indicates a specific reduction of the CesA7 transcript in mur10-1, whereas all other CesA genes have equal relative abundance in both mutant alleles and wild type. A reduction in CesA7 transcript abundance in mur10-1 might be related to the nature of the mutation in the CesA7 gene because premature stop codons are known to reduce transcript abundance (Carol et al., 2005
We started our initial characterization of mur10 based on previously published information that suggested a role for MUR10 in primary cell wall composition or structure. The previously observed increase in Ara and decrease in Xyl and Fuc indicated complex changes in pectin and xyloglucan. In fact, it has previously been demonstrated that less xyloglucan is solubilized from mur10 compared to wild type (Lerouxel et al., 2002
We also observe that immunoreactivity with the monoclonal antibody JIM13, which binds to a specific subset of AGP, is subtly altered between wild type and mur10. Whereas the wild type is labeled in its xylem, the mutant is not and, instead, has strongly labeled cells at the periphery of the collapsed xylem. JIM13 has recently been associated with xylem differentiation in roots (Dolan et al., 1995
We find a small, but significant, decrease in the tensile strength of 4-d-old dark-grown hypocotyls in mur10. In much more mature stem tissue, which contains a higher proportion of secondary cell walls, the bending modulus and maximal bending stress of wild type increased between 34- and 42-d-old plants, but were much lower and failed to increase with age in irx3 stems (Turner and Somerville, 1997
It has become clear that the cell wall is an extremely complex reservoir of chemical and mechanical information (Somerville et al., 2004
In summary, we have demonstrated that mur10 mutants show complex alterations in their primary cell wall structure that are most likely the consequence of altered cell wall remodeling triggered by the disruption of secondary cell wall structure caused by a defect in the CesA7 locus. Because primary and secondary cell wall formation are temporally and spatially separated, this suggests the involvement of a systemic signaling mechanism that transports information about the integrity of the secondary cell wall in specific cells to the machinery that makes and remodels the primary cell wall throughout the plant.
Mutant Lines, Growth Conditions, and Mapping The mutant Col-0 lines mur10-1 and mur10-2 were kindly provided by Wolf-Dieter Reiter. Seeds were surface sterilized in 10% sodium hypochlorite for 10 min and rinsed three times in sterile deionized water. Seeds were then plated on Murashige and Skoog medium (pH 5.8; Duchefa), supplemented with 1% Suc, and 0.5% Phytagel. Seeds were placed at 4°C for 48 h in darkness and then grown in continuous light (80 µmol m2 s1) at 25°C in vertically oriented petri dishes. For drought stress induction, seedlings were transferred to new petri dishes with filter paper instead of Murashige and Skoog medium. Filter paper was watered with 1 mL water and afterward filter paper was watered every 2 d, reducing the amount of water from 1 mL to 250 µL. This treatment resulted in gradual leaf darkening and inhibition of growth. Prolonged exposure led to complete dehydration of the plants.
The mur10 locus was mapped using plants with a mutant phenotype as described below in the F2 from a cross between mur10-2 (Col-0) and Ler. Initial mapping was performed using simple sequence length polymorphic markers from The Arabidopsis Information Resource (http://www.arabidopsis.org). Additional markers for fine mapping were generated based on the information available by CEREON (Jander et al., 2002
RNA was isolated from 10-d-old seedlings using an RNeasy plant mini kit (Qiagen). First-strand cDNA was synthesized from 10 µL of total RNA using oligo(dT)12 (Invitrogen) and 200 units reverse transcriptase (Invitrogen) and incubated in the following program, 42°C for 60 min, 50°C for 20 min, and 92°C for 2 min. cDNA was diluted with water. For comparative PCR, different cDNAs were normalized using eukaryotic translation initiation factor 4E (eIF4E, AT4g18040) and actin 8 (At1g49240) specific primers. Glycosyl transferase genes analyzed were MUR2, At2g03220; MUR3, At2g20370; QUA1, At3g25140; Arad1, At2g35100, Arad2, At4g44930; GUT1, At5g61840; GUT2, At1g27440; CesA1, At4g32410; CesA3, At5g05170; CesA6, At5g64740; CesA4, At5g44030; CesA7, At5g17420; CesA8, At4g18780.
Primers CAGAATTCAAGTAGCTGCCCA and GCGTCGACAGGGACGGCCGGAGATTAGCT were used with Pfu DNA polymerase (Promega) to amplify an 849-bp IRX3 promoter fragment from cosmid L6 (Taylor et al., 1999
Reflection microscopy of silver-enhanced immunogold-labeled resin-embedded tissue sections and electron microscopy was performed as previously described (Bush and McCann, 1999
Xyloglucan oligosaccharides were analyzed on cell wall material of seedlings using the protocol described by Lerouxel et al. (2002)
Fresh 10-d-old seedlings were harvested and transferred to 2-mL screw-cap microtubes. Samples were frozen in liquid nitrogen and freeze dried to keep them at room temperature. Cell wall was extracted using a modification of the protocol described by Barton et al. (2006)
Tensile strength was determined in basal regions of 4-d-old dark-grown hypocotyls grown on horizontally oriented petri dishes as previously described (Ryden et al., 2003
We gratefully acknowledge the technical help of David Rico Arcos for the neutral sugar composition analysis and the provision of infrastructure for PACE by Paul Dupree. Kim Findlay and Sue Bunnewell helped with histological preparations. We are grateful for general technical help by Chris Barber. Michael Hahn and Paul Knox provided monoclonal antibodies and Wolf-Dieter Reiter provided mur10 seeds. The Arabidopsis Biological Resource Center provided T-DNA lines. S.B. identified the MUR10 locus, performed most experiments, and cowrote the manuscript; L.N. and M.P. planned and performed OLIMP and neutral sugar analyses; C.J.B. performed pectin PACE. P.R. provided mechanical analyses; N.G.T. analyzed IRX3:GUS expression; and G.J.S. initiated and supervised the project in the K.R. lab and cowrote the manuscript. Received August 1, 2006; accepted October 5, 2006; published October 20, 2006.
1 This work was supported by a Marie Curie student grant (grant no. MESTCT2004504273 to S.B.), by the Biotechnology and Biological Science Research Council (grant no. 208/D10332 to G.J.S.) and the European Union (grant no. QLK5CT200100443 [EDEN] to G.J.S.), by a Royal Society University Research fellowship (to N.G.T.), and by the Biotechnology and Biological Science Research Council (grants to C.J.B. and P.R.).
2 Present address: Universität Freiburg, Institut für Biologie III, Schaenzlestrasse 1, 79104 Freiburg, Germany.
3 Present address: University of Natural Resources and Applied Life Sciences, Department of Applied Plant Sciences and Plant Biotechnology, Institute of Plant Protection, Peter Jordanstr. 82, A1190 Vienna, Austria. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Georg J. Seifert (georg.seifert{at}boku.ac.at).
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.087700 * Corresponding author; e-mail georg.seifert{at}boku.ac.at; fax 00431476543359.
Acosta-Garcia G, Vielle-Calzada JP (2004) A classical arabinogalactan protein is essential for the initiation of female gametogenesis in Arabidopsis. Plant Cell 16: 26142628 Ahn JW, Verma R, Kim M, Lee JY, Kim YK, Bang JW, Reiter WD, Pai HS (2006) Depletion of UDP-D-apiose/UDP-D-xylose synthases results in rhamnogalacturonan-II deficiency, cell wall thickening, and cell death in higher plants. J Biol Chem 281: 1370813716 Barton CJ, Tailford LE, Welchman H, Zhang Z, Gilbert HJ, Dupree P, Goubet F (2006) Enzymatic fingerprinting of Arabidopsis pectic polysaccharides using polysaccharide analysis by carbohydrate gel electrophoresis (PACE). Planta 224: 163174[CrossRef][Web of Science][Medline] Baskin TI, Betzner AS, Hoggart R, Cork A, Williamson RE (1992) Root morphology mutants in Arabidopsis thaliana. Austr J Plant Physiol 19: 427437[Web of Science] Baumberger N, Ringli C, Keller B (2001) The chimeric leucine-rich repeat/extensin cell wall protein LRX1 is required for root hair morphogenesis in Arabidopsis thaliana. Genes Dev 15: 11281139 Bell CJ, Ecker JR (1994) Assignment of 30 microsatellite loci to the linkage map of Arabidopsis. Genomics 19: 137144[CrossRef][Web of Science][Medline] Benfey PN, Linstead PJ, Roberts K, Schiefelbein JW, Hauser MT, Aeschbacher RA (1993) Root development in Arabidopsis: four mutants with dramatically altered root morphogenesis. Development 119: 5770[Abstract] Bonin CP, Potter I, Vanzin GF, Reiter WD (1997) The MUR1 gene of Arabidopsis thaliana encodes an isoform of GDP-D-mannose-4,6-dehydratase, catalyzing the first step in the de novo synthesis of GDP-L-fucose. Proc Natl Acad Sci USA 94: 20852090 Brown DM, Zeef LA, Ellis J, Goodacre R, Turner SR (2005) Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics. Plant Cell 17: 22812295 Bush MS, McCann MC (1999) Pectic epitopes are differentially distributed in the cell walls of potato (Solanum tuberosum) tubers. Physiol Plant 107: 201213[CrossRef] Cano-Delgado A, Penfield S, Smith C, Catley M, Bevan M (2003) Reduced cellulose synthesis invokes lignification and defense responses in Arabidopsis thaliana. Plant J 34: 351362[CrossRef][Web of Science][Medline] Cano-Delgado AI, Metzlaff K, Bevan MW (2000) The eli1 mutation reveals a link between cell expansion and secondary cell wall formation in Arabidopsis thaliana. Development 127: 33953405[Abstract] Carol RJ, Takeda S, Linstead P, Durrant MC, Kakesova H, Derbyshire P, Drea S, Zarsky V, Dolan L (2005) A RhoGDP dissociation inhibitor spatially regulates growth in root hair cells. Nature 438: 10131016[CrossRef][Medline] Clausen MH, Willats WG, Knox JP (2003) Synthetic methyl hexagalacturonate hapten inhibitors of anti-homogalacturonan monoclonal antibodies LM7, JIM5 and JIM7. Carbohydr Res 338: 17971800[CrossRef][Web of Science][Medline] Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline] Dhugga KS, Barreiro R, Whitten B, Stecca K, Hazebroek J, Randhawa GS, Dolan M, Kinney AJ, Tomes D, Nichols S, et al (2004) Guar seed beta-mannan synthase is a member of the cellulose synthase super gene family. Science 303: 363366 Dolan L, Linstead P, Roberts K (1995) An AGP epitope distinguishes a central metaxylem initial from other vascular initials in the Arabidopsis root. Protoplasma 189: 149155[CrossRef] Duval I, Brochu V, Simard M, Beaulieu C, Beaudoin N (2005) Thaxtomin A induces programmed cell death in Arabidopsis thaliana suspension-cultured cells. Planta 222: 820831[CrossRef][Web of Science][Medline] Ellis C, Karafyllidis I, Wasternack C, Turner JG (2002) The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses. Plant Cell 14: 15571566 Ellis C, Turner JG (2001) The Arabidopsis mutant cev1 has constitutively active jasmonate and ethylene signal pathways and enhanced resistance to pathogens. Plant Cell 13: 10251033 Fagard M, Desnos T, Desprez T, Goubet F, Refregier G, Mouille G, McCann M, Rayon C, Vernhettes S, Hofte H (2000) PROCUSTE1 encodes a cellulose synthase required for normal cell elongation specifically in roots and dark-grown hypocotyls of Arabidopsis. Plant Cell 12: 24092424 Favery B, Ryan E, Foreman J, Linstead P, Boudonck K, Steer M, Shaw P, Dolan L (2001) KOJAK encodes a cellulose synthase-like protein required for root hair cell morphogenesis in Arabidopsis. Genes Dev 15: 7989 Freshour G, Clay RP, Fuller MS, Albersheim P, Darvill AG, Hahn MG (1996) Developmental and tissue-specific structural alterations of the cell-wall polysaccharides of Arabidopsis thaliana roots. Plant Physiol 110: 14131429[Abstract] Fry SC, York WS, Albersheim P, Darvill A, Hayashi T, Joseleau J-P, Kato Y, Lorences EP, Maclachlan GA, McNeil M, et al (1993) An unambiguous nomenclature for xyloglucan-derived oligosaccharides. Physiol Plant 89: 13[CrossRef] Guan Y, Nothnagel EA (2004) Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. Plant Physiol 135: 13461366 Ha MA, MacKinnon IM, Sturcova A, Apperley DC, McCann MC, Turner SR, Jarvis MC (2002) Structure of cellulose-deficient secondary cell walls from the irx3 mutant of Arabidopsis thaliana. Phytochemistry 61: 714[CrossRef][Web of Science][Medline] Hauser MT, Morikami A, Benfey PN (1995) Conditional root expansion mutants of Arabidopsis. Development 121: 12371252[Abstract] Jander G, Norris SR, Rounsley SD, Bush DF, Levin IM, Last RL (2002) Arabidopsis map-based cloning in the post-genome era. Plant Physiol 129: 440450 Ko JH, Kim JH, Jayanty SS, Howe GA, Han KH (2006) Loss of function of COBRA, a determinant of oriented cell expansion, invokes cellular defence responses in Arabidopsis thaliana. J Exp Bot 57: 29232936 Lerouxel O, Choo TS, Seveno M, Usadel B, Faye L, Lerouge P, Pauly M (2002) Rapid structural phenotyping of plant cell wall mutants by enzymatic oligosaccharide fingerprinting. Plant Physiol 130: 17541763 Lister C, Dean C (1993) Recombinant inbred lines for mapping rflp and phenotypic markers in Arabidopsis thaliana. Plant J 4: 745750[CrossRef][Web of Science] Lukowitz W, Nickle TC, Meinke DW, Last RL, Conklin PL, Somerville CR (2001) Arabidopsis cyt1 mutants are deficient in a mannose-1-phosphate guanylyltransferase and point to a requirement of N-linked glycosylation for cellulose biosynthesis. Proc Natl Acad Sci USA 98: 22622267 Madson M, Dunand C, Li X, Verma R, Vanzin GF, Caplan J, Shoue DA, Carpita NC, Reiter WD (2003) The MUR3 gene of Arabidopsis encodes a xyloglucan galactosyltransferase that is evolutionarily related to animal exostosins. Plant Cell 15: 16621670 Matsui A, Yokoyama R, Seki M, Ito T, Shinozaki K, Takahashi T, Komeda Y, Nishitani K (2005) AtXTH27 plays an essential role in cell wall modification during the development of tracheary elements. Plant J 42: 525534[CrossRef][Web of Science][Medline] McCartney L, Marcus SE, Knox JP (2005) Monoclonal antibodies to plant cell wall xylans and arabinoxylans. J Histochem Cytochem 53: 543546 Molhoj M, Verma R, Reiter WD (2004) The biosynthesis of D-galacturonate in plants: functional cloning and characterization of a membrane-anchored UDP-D-glucuronate 4-epimerase from Arabidopsis. Plant Physiol 135: 12211230 Motose H, Sugiyama M, Fukuda H (2004) A proteoglycan mediates inductive interaction during plant vascular development. Nature 429: 873878[CrossRef][Medline] Nicol F, His I, Jauneau A, Vernhettes S, Canut H, Hofte H (1998) A plasma membrane-bound putative endo-1,4-beta-D-glucanase is required for normal wall assembly and cell elongation in Arabidopsis. EMBO J 17: 55635576[CrossRef][Web of Science][Medline] Nishimura MT, Stein M, Hou BH, Vogel JP, Edwards H, Somerville SC (2003) Loss of a callose synthase results in salicylic acid-dependent disease resistance. Science 301: 969972 Pagant S, Bichet A, Sugimoto K, Lerouxel O, Desprez T, McCann M, Lerouge P, Vernhettes S, Hofte H (2002) KOBITO1 encodes a novel plasma membrane protein necessary for normal synthesis of cellulose during cell expansion in Arabidopsis. Plant Cell 14: 20012013 Pauly M, Albersheim P, Darvill A, York WS (1999) Molecular domains of the cellulose/xyloglucan network in the cell walls of higher plants. Plant J 20: 629639[CrossRef][Web of Science][Medline] Persson S, Wei H, Milne J, Page GP, Somerville CR (2005) Identification of genes required for cellulose synthesis by regression analysis of public microarray data sets. Proc Natl Acad Sci USA 102: 86338638 Pilling E, Hofte H (2003) Feedback from the wall. Curr Opin Plant Biol 6: 16[Medline] Reiter WD, Chapple C, Somerville CR (1997) Mutants of Arabidopsis thaliana with altered cell wall polysaccharide composition. Plant J 12: 335345[CrossRef][Web of Science][Medline] Rose JK, Saladie M, Catala C (2004) The plot thickens: new perspectives of primary cell wall modification. Curr Opin Plant Biol 7: 296301[CrossRef][Web of Science][Medline] Roudier F, Fernandez AG, Fujita M, Himmelspach R, Borner GH, Schindelman G, Song S, Baskin TI, Dupree P, Wasteneys GO, et al (2005) COBRA, an Arabidopsis extracellular glycosyl-phosphatidyl inositol-anchored protein, specifically controls highly anisotropic expansion through its involvement in cellulose microfibril orientation. Plant Cell 17: 17491763 Ryden P, Sugimoto-Shirasu K, Smith AC, Findlay K, Reiter WD, McCann MC (2003) Tensile properties of Arabidopsis cell walls depend on both a xyloglucan cross-linked microfibrillar network and rhamnogalacturonan II-borate complexes. Plant Physiol 132: 10331040 Scheible WR, Pauly M (2004) Glycosyltransferases and cell wall biosynthesis: novel players and insights. Curr Opin Plant Biol 7: 285295[CrossRef][Web of Science][Medline] Schiefelbein JW, Somerville C (1990) Genetic control of root hair development in Arabidopsis thaliana. Plant Cell 2: 235243 Schindelman G, Morikami A, Jung J, Baskin TI, Carpita NC, Derbyshire P, McCann MC, Benfey PN (2001) COBRA encodes a putative GPI-anchored protein, which is polarly localized and necessary for oriented cell expansion in Arabidopsis. Genes Dev 15: 11151127 Schulze-Lefert P (2004) Knocking on heaven's wall: pathogenesis of and resistance to biotrophic fungi at the cell wall. Curr Opin Plant Biol 7: 377383[CrossRef][Web of Science][Medline] Seifert GJ (2004) Nucleotide sugar interconversions and cell wall biosynthesis: how to bring the inside to the outside. Curr Opin Plant Biol 7: 277284[CrossRef][Web of Science][Medline] Shi H, Kim Y, Guo Y, Stevenson B, Zhu JK (2003) The Arabidopsis SOS5 locus encodes a putative cell surface adhesion protein and is required for normal cell expansion. Plant Cell 15: 1932 Somerville C, Bauer S, Brininstool G, Facette M, Hamann T, Milne J, Osborne E, Paredez A, Persson S, Raab T, et al (2004) Toward a systems approach to understanding plant cell walls. Science 306: 22062211 Taylor NG, Scheible WR, Cutler S, Somerville CR, Turner SR (1999) The irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for secondary cell wall synthesis. Plant Cell 11: 769780 Turner SR, Somerville CR (1997) Collapsed xylem phenotype of Arabidopsis identifies mutants deficient in cellulose deposition in the secondary cell wall. Plant Cell 9: 689701[Abstract] Vanzin GF, Madson M, Carpita NC, Raikhel NV, Keegstra K, Reiter WD (2002) The mur2 mutant of Arabidopsis thaliana lacks fucosylated xyloglucan because of a lesion in fucosyltransferase AtFUT1. Proc Natl Acad Sci USA 99: 33403345 Vogel JP, Raab TK, Schiff C, Somerville SC (2002) PMR6, a pectate lyase-like gene required for powdery mildew susceptibility in Arabidopsis. Plant Cell 14: 20952106 Vorwerk S, Somerville S, Somerville C (2004) The role of plant cell wall polysaccharide composition in disease resistance. Trends Plant Sci 9: 203209[CrossRef][Web of Science][Medline] Willats WG, Marcus SE, Knox JP (1998) Generation of monoclonal antibody specific to (1 Yates EA, Valdor JF, Haslam SM, Morris HR, Dell A, Mackie W, Knox JP (1996) Characterization of carbohydrate structural features recognized by anti-arabinogalactan-protein monoclonal antibodies. Glycobiology 6: 131139 Zhong R, Morrison III WH, Freshour GD, Hahn MG, Ye ZH (2003) Expression of a mutant form of cellulose synthase AtCesA7 causes dominant negative effect on cellulose biosynthesis. Plant Physiol 132: 786795 Zhong R, Taylor JJ, Ye ZH (1997) Disruption of interfascicular fiber differentiation in an Arabidopsis mutant. Plant Cell 9: 21592170[Abstract]
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|