| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online October 27, 2006; 10.1104/pp.106.089508 Plant Physiology 142:1739-1750 (2006) © 2006 American Society of Plant Biologists
Lotus japonicus Nodulation Requires Two GRAS Domain Regulators, One of Which Is Functionally Conserved in a Non-Legume1,[C],[W]Department of Molecular Microbiology (A.B.H., F.L., H.M., J.A.D.), Department of Metabolic Biology (J.A.P., T.L.W.), and Department of Cell and Developmental Biology (S.B.), John Innes Centre, Norwich NR4 7UH, United Kingdom; and Sainsbury Laboratory, Norwich, NR4 7UH United Kingdom (M.P.)
A new nodulation-defective mutant of Lotus japonicus does not initiate nodule cortical cell division in response to Mesorhizobium loti, but induces root hair deformation, Nod factor-induced calcium spiking, and mycorrhization. This phenotype, together with mapping data, suggested that the mutation could be in the ortholog of the Medicago truncatula NSP1 gene (MtNSP1). The sequence of the orthologous gene (LjNSP1) in the L. japonicus mutant (Ljnsp1-1) revealed a mutation causing a premature stop resulting in loss of the C-terminal 23 amino acids. We also sequenced the NSP2 gene from L. japonicus (LjNSP2). A mutant (Ljnsp2-3) with a premature stop codon was identified by TILLING showing a similar phenotype to Ljnsp1-1. Both LjNSP1 and LjNSP2 are predicted GRAS (GAI, RGA, SCR) domain transcriptional regulators. Transcript steady-state levels of LjNSP1 and LjNSP2 initially decreased and then increased following infection by M. loti. In hairy root transformations, LjNSP1 and MtNSP1 complemented both Mtnsp1-1 and Ljnsp1-1 mutants, demonstrating that these orthologous proteins have a conserved biochemical function. A Nicotiana benthamiana NSP1-like gene (NbNSP1) was shown to restore nodule formation in both Ljnsp1-1 and Mtnsp1-1 mutants, indicating that NSP1 regulators from legumes and non-legumes can propagate the Nod factor-induced signal, activating appropriate downstream targets. The L. japonicus nodules complemented with NbNSP1 contained some cells with abnormal bacteroids and could fix nitrogen. However, the NbNSP1-complemented M. truncatula nodules did not fix nitrogen and contained very few bacteria released from infection threads. These observations suggest that NSP1 is also involved in infection, bacterial release, and normal bacteroid formation in nodule cells.
Legumes produce root nodules in response to Nod factors secreted by rhizobia. These Nod factor signals are essential for root hair deformation, induction of early nodulation genes, formation of nodule primordia, and infection by rhizobia. The earliest plant responses to Nod factors include an influx of calcium, plasma-membrane depolarizations, and then induction of cytosolic calcium spiking around the nucleus of epidermal root cells (Oldroyd and Downie, 2004  ). Purified Nod factors are sufficient to cause a range of early responses involved in the host developmental program (Hirsch and Fang, 1994; Schultze and Kondorosi, 1998; Downie and Walker, 1999). The Nod factors are the principle determinants by which legumes can be nodulated by specific rhizobia; the basis for this host specificity is the structure of the Nod factor, suggesting that highly specific plant receptors perceive Nod factor signals, thereby initiating the plant developmental response.
Nod factor-induced root hair deformation is associated with reorganization of actin filaments in preparation for infection (Cardenas et al., 1998
Several legume genes required for nodule morphogenesis have been placed on a pathway based on the phenotypes of the mutants (Oldroyd and Downie, 2004
In M. truncatula, two additional genes required for nodule morphogenesis have been described as acting downstream of MtDMI3 encoding CCaMK (Levy et al., 2004
The GRAS domain protein family is exclusive to plants, with homologs in many higher plants, such as barley (Hordeum vulgare), rice (Oryza sativa), Arabidopsis (Arabidopsis thaliana), tomato (Lycopersicon esculentum), petunia (Petunia hybrida), and lily (Lilium longiflorum; Bolle, 2004 In this study, we report the identification of the L. japonicus GRAS-type LjNSP1 (NSP1 gene from L. japonicus) and LjNSP2 genes, which are important for nodulation. We have investigated the potential conservation of function of a related NSP1-like gene from Nicotiana benthamiana and have shown that it is able to restore nodulation to nsp1 mutants of M. truncatula and L. japonicus although infection and formation of normal bacteroids were not fully complemented.
Identification of a Novel Mutation in L. japonicus Affecting Early Stages of Nodulation
Approximately 45,600 ethyl methanesulfonate-mutagenized M2 L. japonicus Gifu B-129 plants from 3,843 families were screened for absence of nodules (Nod–) or presence of small white nodules (Perry et al., 2003 A mutant, SL1795-4, was identified that lacked nodules and M. loti-induced cortical cell division but retained root hair deformation. The mutant lacked infection threads and infection pockets, although very occasionally infection pockets were observed (about 1% of wild-type levels; Fig. 1F ). However, the mutant did have normal infection by the arbuscular mycorrhizal fungus Glomus intraradices (Fig. 1, D and E), Nod factor (10 nM) from M. loti-induced root hair deformation (Fig. 1, A and B), and normal cytosolic calcium spiking, as well as a calcium influx (Fig. 1C). No nodules were observed on SL1795-4 roots after 4 weeks growth on agar, whereas the wild type typically formed five to 20 nodules under these conditions. The mutant showed clear signs of nitrogen limitation (yellowing of leaves and stunted growth) but grew normally if the agar was supplemented with nitrate.
After growth in nitrogen-limited soil for 2 months, the SL1795-4 mutant usually formed a few nodules. Of 26 plants tested, 17 formed nodules producing an overall average of 1.7 ± 0.4 nodules, whereas equivalent wild-type plants had an average of 35 ± 5.5 nodules per plant. Light microscopy showed that the nodules formed on the mutant were infected similarly to wild-type (Fig. 2, A and B ), but electron microscopy revealed that in some nodule sections, the number of bacteroids (3–25) contained within the symbiosome membrane of the mutant (Fig. 2D) was much higher than that seen in the wild type (a maximum of four; Fig. 2C). This phenotype was only observed in the central region of the nodule, whereas the symbiosomes in the surrounding cells looked normal. This unusual symbiosome structure was observed in about one-half of the SL1795-4 nodules investigated and is similar to that seen in the Fix– mutant Ljsym105 (Hossain et al., 2006 ). To measure the nitrogen-fixation potential of these nodules, measurements of acetylene reduction were made using individual nodules from both wild type and mutant. Nodules were matched for size, and acetylene reduction assays with SL1795-4 produced 4.7 ± 1.8 nmol ethylene h–1 compared with wild-type levels of 6.3 ± 3.0 nmol ethylene h–1. The nodulation and infection phenotype defects scored in the original mutant were indistinguishable from those observed in symbiotically defective seedlings from backcrossed progeny (one backcross).
Mapping of the Nodulation Mutation in SL1795-4 SL1795-4 was crossed to its parent and to the wild-type ecotype Miyakojima (MG-20). The segregation ratios observed in the F2 progeny from both crosses indicated recessive monogenic inheritance (Table I ). Bulked segregants using two groups of 12 mutant F2 progeny from the cross with MG-20 were used initially to map the mutation. Using microsatellite markers representing all chromosomes, only TM0049 at 56.7 cM on chromosome 3 cosegregated. Further mapping with 111 non-nodulating individuals from 462 F2 plants localized the mutation between the flanking markers TM0416 (55.5 cM) and TM0049 (56.7 cM). No recombination events were seen with the marker TM0115 (56.3 cM; Fig. 3A ).
Four mutations affecting the nodule symbiosis have been mapped on the lower part of chromosome 3, namely, HAR1, srh1, vrh1, and ccamk (Solaiman et al., 2000 ; Krusell et al., 2002; Nishimura et al., 2002; Karas et al., 2005; Sandal et al., 2006; Tirichine et al., 2006). However, the locations of these mutations (Sandal et al., 2006) and the phenotypes of the HAR1, srh1, and vrh1 mutants are different from the SL1795-4 mutant. The phenotype of the Ljccamk mutant is similar, but LjCCaMK maps between TM0110 and TM0005 (Tirichine et al., 2006), approximately 20 cM from the nodulation mutation in SL1795-4. We noted that MtNSP1 is located approximately 20 cM from DMI3 encoding the CCaMK in M. truncatula (Ané et al., 2002; Smit et al., 2005). The Mtnsp1 mutant has normal root hair deformation and calcium spiking in response to Nod factor, but lacks cortical cell division and is colonized normally by mycorrhizal fungi (Catoira et al., 2000) and thus appears phenotypically similar to the L. japonicus SL1795-4 mutant. The possible synteny between M. truncatula and L. japonicus indicated that the gene mutated in SL1795-4 could be an ortholog of M. truncatula NSP1 (Fig. 3A).
No expressed sequence tag (EST) sequences homologous to MtNSP1 could be found in the L. japonicus database. DNA hybridization using the MtNSP1 GRAS-encoding domain as probe indicated that a single band was present in L. japonicus. NSP1 was amplified from L. japonicus genomic DNA using several different primers spanning the whole MtNSP1 region. Some of the primer combinations produced several bands and/or smears, and in these cases nested PCR was used to produce single bands that could be used for DNA sequencing. The 3' and 5' ends were obtained by 3' RACE and using GenomeWalker. The assembled LjNSP1 DNA sequence of 1,632 bp showed 75% identity to the M. truncatula gene at the nucleotide level. PCR-based amplification of LjNSP1 and DNA sequencing from wild type was carried out on both genomic DNA and cDNA using a primer set spanning the whole coding region. The sequence obtained confirmed the assembled sequence and revealed the lack of any introns.
LjNSP1 encodes a predicted protein of 542 amino acids belonging to the GRAS domain proteins. The GRAS protein family contains five recognizable GRAS motifs, which are identifiable in the region from amino acids 151 to 542 of LjNSP1 (Fig. 3B). Several amino acids are relatively invariant in most members of the GRAS protein family. These include the domain containing the PFYRE motif, designated after the respective amino acids (Pysh et al., 1999 Alignment of LjNSP1 and MtNSP1 revealed high overall identity/similarity (77%/83%; Fig. 3B). The overall identity of the GRAS domain was 81%, whereas the identity in the N-terminal third of the proteins was 68%. The N-terminal 40 residues in LjNSP1 and MtNSP1 showed higher identity/similarity (85%/88%) compared to the N-terminal region overall (68%/75%), particularly over residues 9 to 33 (SDHILDWLEGSVSFFPSFLDDPYN), suggesting a functionally conserved domain (Fig. 3C). A putative nuclear localization site present in MtNSP1 (PKKR) was also found in an exact match in the LjNSP1 protein starting at position 93 (consensus position 103 on Supplemental Fig. S1).
Sequencing of LjNSP1 from SL1795-4 revealed a G to A nucleotide substitution at position 1,560, changing Trp 520 (TGG) to a stop codon (TGA; consensus position 547 on Supplemental Fig. S1). This resulted in a predicted protein lacking the C-terminal 23 amino acids, which include the residues [W(x)10W] that are part of the SAW domain (Fig. 3B; Supplemental Fig. S1). This indicates that the SAW motif is very important for the function of the NSP1 protein.
We verified that the Ljnsp1-1 mutation in SL1795-4 caused the nodulation defect by Agrobacterium rhizogenes hairy root transformation (Table II
). LjNSP1 inserted into p-KGW-RR under control of the M. truncatula NSP1 promoter (pMtNSP1) restored nodulation in transformed hairy roots inoculated with M. loti (Fig. 4, B and C
), whereas no nodules were observed with the vector lacking LjNSP1. The LjNSP1 construct also complemented the M. truncatula Mtnsp1-1 mutant (Table II). Conversely, MtNSP1 under the control of its own promoter (Smit et al., 2005
TILLING for Mutations in nsp2 The L. japonicus NSP2 gene was amplified from genomic and cDNA using primers from the M. truncatula NSP2 gene sequence and no introns were present. LjNSP2 encodes a predicted protein of 499 amino acids showing 73% identity to M. truncatula NSP2 at the nucleotide level. The LjNSP1 and LjNSP2 proteins show low similarity (20% identity/33% similarity), although some domains showed higher similarity (Fig. 3B).
A mutant, SL781-3, carrying an allele of LjNSP2 found by TILLING (Perry et al., 2003
Expression of LjNSP1 during the early stages of symbiosis was investigated by semiquantitative reverse transcription (RT)-PCR. A slight reduction of expression occurred in the first 2 d; such a reduction in expression has also been observed for CASTOR and POLLUX, which function earlier in the pathway (Imaizumi-Anraku et al., 2005
Even though there were no obvious defects in growth and development under nonsymbiotic conditions, we investigated whether LjNSP1 and LjNSP2 were expressed in leaf tissue as was described for both MtNSP1 (Smit et al., 2005
The GRAS domain proteins can be divided into eight subfamilies based on similarities of their N-terminal regions (Bolle, 2004
Comparisons revealed a very clear separation between the NSP1 and NSP2 families (Fig. 5). LjNSP2 is very similar to MtNSP2 and Pisum sativa SYM7; the closest Arabidopsis homolog is AtSCL26 (Fig. 5). A predicted protein from rice (OsNSP2) also groups with the NSP2 branch. Phylogenetic analysis of the NSP1 protein group, containing the MtNSP1, LjNSP1, PtHNO1, PtHNO2, AtSCL29, and rice OsHNO, showed a weak relationship with the Arabidopsis SHR transcription factor (see Supplemental Fig. S2). The NSP2 protein group, containing the MtNSP2, LjNSP2, PsSYM7, AtSCL26, and OsNSP2, had a weak relationship with the Arabidopsis SCL4/7 and HAM branches (see Supplemental Fig. S2).
Incomplete sequences similar to LjNSP1 were found in translated EST libraries from lettuce (Lactuca sativa), potato (Solanum tuberosum), and N. benthamiana. Sequence EST fragments from lettuce (BQ857799, 52% identity/69% similarity) and potato (CK861723, 67% identity/82% similarity) were found covering 221 residues of the midregion and 150 residues of the GRAS domain, respectively. Due to the incomplete sequences their precise position in the phylogenetic tree cannot be defined unambiguously and so they were not included in Figure 5. Two predicted protein sequences from N. benthamiana covered the N terminus (48% identity/60% similarity) and GRAS domain (64% identity/79% similarity). Using cDNA and PCR primers, we confirmed that the two EST sequences found in N. benthamiana spanned a single gene, expected not to have any introns. When compared to LjNSP1, the N. benthamiana NSP1-like sequence we generated seemed to be complete. The sequence encodes a predicted protein with 56% identity/70% similarity to both LjNSP1 and MtNSP1, clearly placing it in the same phylogenetic grouping (Fig. 5). The highest similarity was in the LHRI, PFYRE, and SAW motifs, whereas the N-terminal region showed only 46% similarity (Fig. 3B). Again, as observed for the other NSP1-like proteins, NbNSP1 showed higher similarity in the first 40 amino acids (Fig. 3C). We decided to determine if NbNSP1 was functionally equivalent to LjNSP1 and MtNSP1 by complementation. We chose the N. benthamiana gene because it belongs to the asterid clade and is therefore outside the rosid clade, which contains all known nodulating plants (Doyle, 1994 The N. benthamiana NSP1-like gene was cloned such that the open reading frame was inserted into the p-KGW-RR vector under the control of the pMtNSP1 promoter. The resulting plasmid in A. rhizogenes was used to produce transformed hairy roots of both the Ljnsp1-1 (SL1795-4) and the Mtnsp1-1 (B85) mutants. In transformed roots of both species, nodule-like structures could be observed 2 weeks after inoculation. No nodule-like structures were observed in hairy root transformations with the vector containing the MtNSP1 promoter but lacking the inserted gene. To test for nitrogenase activity, acetylene reduction was assayed using individual nodules on hairy roots of the L. japonicus (SL1795-4) and M. truncatula (B85) nsp1 mutants complemented for nodulation with the NbNSP1 transgene. Acetylene reduction was observed with the complemented L. japonicus nodules (4.0 ± 2.2 nmol ethylene h–1 compared to 6.3 ± 1.7 nmol ethylene h–1 with matched wild-type nodules). In contrast, no acetylene reduction was observed with any of the 20 tested nodules of the M. truncatula nsp1-1 mutant (B85) complemented with NbNSP1, whereas wild-type nodules produced 2.8 ± 0.7 nmol ethylene h–1. To measure infection in the nodules formed on the NbNSP1-transformed hairy roots of the M. truncatula nsp1-1 mutant, we inoculated with S. meliloti carrying a constitutively expressed lacZ reporter gene and stained the nodules for LacZ activity (Fig. 6A ). Several of the nodules stained at the tips, suggesting that bacteria were at the tips of nodules where the infection zone is found. Light and electron microscopy of similar nodules revealed that there were infection threads present in these M. truncatula nodules, but very few bacteria were present within the cells (Fig. 6I). Some bacteria were present within cells, but these were seldom surrounded by a peribacteroid membrane, and in those few cases where bacteria appeared to have a peribacteroid membrane, there seemed to be degradation of the bacteria. These data suggest that NbNSP1 complementation allowed infection thread growth, but the release of the bacteria into nodule cells and/or possibly symbiosome function was not fully restored.
To determine if infection was normal in the nodules formed on the NbNSP1-transformed hairy roots of the L. japonicus nsp1-1 mutant, we initially cut nodules in half and stained them with Syto13, which can be used to visualize bacteria within plants (Haynes et al., 2004 ). This revealed that there were many bacteria within most of the nodules (Fig. 6, B and C). Light and electron microscopy of similar nodules revealed that about half of the cells in the L. japonicus nodules were infected (Fig. 6, E and F). Electron microscopy revealed the presence of many bacteria within peribacteroid membranes, although many of these bacteroids appeared to be at a lower population density and were clearly misshapen (Fig. 6F) compared with wild-type controls (Fig. 2C). Therefore, although the NbNSP1 gene can restore nodulation, it cannot restore normal release of rhizobia to a M. truncatula nsp1-1 mutant. Although the release of bacteria can be restored, albeit relatively inefficiently, in complemented nodules of the L. japonicus nsp1-1 mutant, the bacteroid shape appeared abnormal, indicating a possible role in the formation of normal symbiosomes.
The L. japonicus LjNSP1 and LjNSP2 genes identified here encode two very divergent GRAS domain regulators orthologous to those encoded by the M. truncatula MtNSP1 and MtNSP2 genes described previously (Kalo et al., 2005 ; Smit et al., 2005). In both legumes, mutations in the genes affect the induction of cortical cell divisions associated with nodule morphogenesis and also block the formation of infection threads required for the root infection that occurs concomitantly with nodule morphogenesis during legume nodulation (Catoira et al., 2000; Oldroyd and Long, 2003; Mitra et al., 2004b). The Ljnsp2-3 mutation causes a more severe phenotype than the Ljnsp1-1 mutation.
Based on different lines of evidence, it is clear that the NSP1 and NSP2 gene products act downstream of the calcium-calmodulin-dependent kinase that is thought to be activated by Nod factor-induced calcium spiking (Oldroyd and Downie, 2004
It has been proposed (Pysh et al., 1999
A GRAS protein from lily, designated LiSCL (L. longiflorum Scarecrow-like), is expressed specifically at the premeiotic phase within anthers. The protein has two highly basic regions, and transient expression analyses of dissected GFP-LiSCL fusion proteins show that both basic regions are important for the nuclear localization (Morohashi et al., 2003
At this stage, it is not clear how activation of NSP1 and NSP2 occurs. One theoretical possibility is phosphorylation by the CCaMK, which is nuclear located and acts upstream of the NSP proteins. However, such a direct interaction seems unlikely because the CCaMK is presumably activated by mycorrhizal signaling, but this does not lead to induction of many of the genes whose expression requires NSP1 and NSP2. It is likely that the NSP proteins fulfill similar but nonredundant roles, as nsp1 and nsp2 mutants have very similar phenotypes (Catoira et al., 2000
The identification of ESTs with sequence similarity to GRAS proteins found in bryophytes indicates that this family of proteins arose before the emergence of land plants over 400 million years ago (Nishiyama et al., 2003
The data presented here and elsewhere (Kalo et al., 2005
Plant Growth and Bacterial Strains Lotus japonicus genotype gifu B-129 was used as wild-type control for phenotypic and genotypic analysis. For nodulation studies in compost, seeds were scarified for 16 min in sulfuric acid. Plants were grown in the greenhouse where seeds were planted into small plastic pots in Scotts Levington F1 compost or terragreen sand. For growth on FP agar medium, the scarified seeds were sterilized with 10% bleach for 15 min. Filter paper (grade 0860; Schleicher and Schull) was placed between the agar and the roots to prevent the roots growing into the agar. The roots were then covered by another filter paper to keep the roots moist. The plants were grown in a vertical position in a growth chamber (day/night cycles of 18 h/6 h; temperature 20°C/15°C). Mesorhizobium loti strain R7A (pXLG4) carrying lacZ was used for screening purposes. Inoculation of plants in the greenhouse was done using a wild-type strain (R7A) of M. loti. Nodule numbers were scored on at least 10 plants, and data on nodulation and acetylene reduction tests are shown with SEs. Medicago truncatula nsp1-1 (B85) seeds were kindly provided by Giles Oldroyd.
Oregon Green-dextran Mr 10,000 (Molecular Probes) was dissolved in sterile water and Texas Red-dextran Mr 10,000 (Molecular Probes) was used as a reference. Nod factors were purified and analyzed by reverse-phase chromatography (Miwa et al., 2006
Scarified seeds were sown into sand containing Glomus intraradices arbuscular mycorrhiza-infected chives and grown for approximately 1 month. The staining protocol used was as described by Vierheilig et al. (1998)
A mapping population was obtained by crossing the L. japonicus SL1795-4 (B-129) to L. japonicus MG-20. The mutant and F1 seeds were grown for seeds. The F2 seeds were planted into compost, and mutant plants were identified on absence of nodules and cortical cell division. DNA was prepared using plant leaf material (one to three young leaves) harvested on ice in collection tubes (Qiagen) containing a tungsten carbide bead (Qiagen). A total of 400 µL of extraction buffer (200 mM Tris-HCl, pH 7.5; 250 mM NaCl; 25 mM EDTA; 0.5% v/v SDS) preheated to 65°C was added to each tube. Samples were homogenized on a mixer mill (Retsch MM300) for 2 min at 30 oscillations/s, and incubated at 65°C for 30 min to 1 h. Samples were centrifuged at 6,500 rpm for 10 min, and 300 µL of supernatant was transferred into fresh collection tubes and purified with approximately 0.8 volumes of phenol:chloroform:isoamyalcohol (25:24:1), pH 8.0. DNA was precipitated at –20°C for 1 h with 1/10 volume 3 M NaAc and 1 volume isopropanol. DNA was pelleted by centrifuging at 5,600 rpm for 45 min. DNA was washed overnight in 70% ethanol before air drying and resuspending in 50 to 100 µL distilled water. A 10-fold dilution of this suspension was used for all further work. Microsatellite markers were used to map the SL1795-4 allele using a population of 111 homozygous mutants to a genetic position on linkage group 3, between the two markers TM0416 and TM0049. For molecular markers, primers were ordered from Sigma Genosys. Oligonucleotides for TM molecular markers (microsatellite) were designed at Kazusa DNA Research Institute (KDRI, www.kazusa.or.jp).
Transgenic hairy roots and nodulation tests were done as previously described (Stougaard, 1995
The L. japonicus NSP1 sequence was amplified using M. truncatula NSP1-specific primers (see Supplemental Materials and Methods S1). These were used in all possible combinations (39 cycles: 94°C for 15 s, 45°C for 30 s, 72°C for 90 s). A partial sequence was obtained from genomic DNA corresponding to roughly 690 bp of the N-terminal region. Additional sequence was obtained by designing primers specific for the LjNSP1 sequence (see Supplemental Materials and Methods S1) in each end of the obtained fragments and running these in combination with the MtNSP1 primers. The missing 3' and 5' ends were amplified by 3'RACE system for RACE (Invitrogen) using oligo(dT) primer and BD GenomeWalker Universal kit (BD Bioscience CLONTECH), respectively, following the manufacturer's instructions. This resulted in the identification of the full-length wild-type sequence and 475 bp of the promoter region. The DNA sequence was obtained, and both wild-type and mutant plants were sequenced in the search for any single basepair changes. An additional mutant was found by TILLING as described in Perry et al. (2003) The L. japonicus NSP2 sequence was amplified using M. truncatula NSP2-specific primers (see Supplemental Materials and Methods S1). The missing 3' and 5' ends were amplified by 3'RACE system for RACE (Invitrogen) using oligo(dT) primer. Following the identification of the full sequence, TILLING was performed as described above, using the primer pair NSP2-TILL Forw2 (IRD700-ACTCAACTCAACAACCTCAGGCATGGA) and NSP2-TILL Rev3 (IRD800-GTCCAAAGGGATGCAGAAAGCAAACAC). The Nicotiana benthamiana NSP1-like gene was cloned by making primers using the two GenBank EST sequences, CK281685 and CK281684. The forward primer started at nucleotide 75 in CK281685 and the reverse primer started at nucleotide 7 in CK281684 (for primer information, see Supplemental Materials and Methods S1). The primers, containing added SnaBI restriction sites, were used to amplify the full-length cDNA, and this was cloned using SnaBI into p-KGW-NSP1.
BLAST searches were performed using the National Center for Biotechnology Information database (http://www.ncbi.nlm.nih.gov/blast/) and the Institute for Genomic Research Gene Indices database (http://tigrblast.tigr.org/tgi/). The DNA sequence was translated using the EXPASY tools (http://www.expasy.org/cgi-bin/pi_tool). The deduced amino acid sequences were aligned using the ClustalX program with standard parameters, and a phylogenetic bootstrapped tree was generated in TreeView using the neighbor-joining method.
Total RNA from uninoculated roots and M. loti inoculated roots (1, 2, 4, 6, 8, and 10 dpi) was extracted using an RNeasy kit (Qiagen). Isolated total RNA (2.5 µg) was treated with DNaseI, reverse transcribed using oligo(dT) by Superscript II reverse transcriptase (Life Technologies), and subjected to semiquantitative RT-PCR. PCR cycle numbers were defined for each primer set, resulting in amplification within the linear phase. Amplification was exponential up to 27 cycles. Samples lacking the RT treatment were used as control for genomic DNA contamination (data not shown).
For the amplification of the NSP1 gene, the primers NSP1 fwd2 CGAGCACTGACACACCACTT and NSP1 rev3 CTGCAAACCCTGCTTCTTTC were used (24 cycles of 94°C for 15 s, 59°C for 30 s, and 72°C for 50 s). For the amplification of the NSP2 gene, the primers NSP2 3RACE3 (AGTTGCTTCGTTTCTAACTGCGGCCAAG) and NSP1 rev2 (CAAGTCCAAAGGGAAGCAGAAAGCA) were used (24 cycles of 94°C for 15 s, 59°C for 30 s, and 72°C for 50 s). To compare cDNA concentrations in the different samples, the amount of fragments was compared with polyubiquitin and leghemoglobin as controls for RNA concentrations and inoculation (22 cycles of 94°C for 15 s, 59°C for 30 s, and 72°C for 50 s). For primer information, see Stracke et al. (2002) Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession numbers LjNSP1, EF012819; Ljnsp1-1, EF017372; LjNSP2, DQ665943; Ljnsp2-3, EF053276; and NbNSP1, EF032736.
The following materials are available in the online version of this article.
We thank Patrick Smit and Renee Guerts for information prior to publication and for supplying pKGW-NSP1-RR. We also thank Wladimir Tameling and David Baulcombe for N. benthamiana cDNA and advice on virus-induced gene silencing. Moreover, we thank Peter Kalo, Anne Edwards, John Marsh, and Giles Oldroyd for primers, sequence information, and very helpful discussions. Received September 5, 2006; accepted October 19, 2006; published October 27, 2006.
1 This work was supported by the European Union (Marie Curie Ph.D. fellowship RTN–CT–2003–505227 to A.B.H.) via the INTEGRAL network, by the Biotechnology and Biological Sciences Research Council, by the Gatsby Charitable Foundation (to the Sainsbury Laboratory), by the John Innes Foundation, and by the Universities UK Overseas Research Students Awards Scheme (H.M.). 
2 Present address: Biotechnology Research Centre, University of Tokyo, Yayoi 1-1-1 Bunkyo-ku, Tokyo 113–8657, Japan.
3 Present address: University of Munich, Department of Biology, Genetics, Marie-Ward-Str. 1a, D–80638 Munich, Germany. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: J. Allan Downie (allan.downie{at}bbsrc.ac.uk).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[W] The online version of this article contains Web-only data. www.plantphysiol.org/cgi/doi/10.1104/pp.106.089508 * Corresponding author; e-mail allan.downie{at}bbsrc.ac.uk; fax 44(0)1603–450045.
Andersson CR, Jensen EO, Llewellyn DJ, Dennis ES, Peacock WJ (1996) A new hemoglobin gene from soybean: a role for hemoglobin in all plants. Proc Natl Acad Sci USA 93: 5682–5687 Ané JM, Levy J, Thoquet P, Kulikova O, de Billy F, Penmetsa V, Kim DJ, Debelle F, Rosenberg C, Cook DR, et al (2002) Genetic and cytogenetic mapping of DMI1, DMI2, and DMI3 genes of Medicago truncatula involved in nod factor transduction, nodulation, and mycorrhization. Mol Plant Microbe Interact 15: 1108–1118[Web of Science][Medline] Ben Amor B, Shaw SL, Oldroyd GED, Maillet F, Penmetsa RV, Cook D, Long SR, Denarie J, Gough C (2003) The NFP locus of Medicago truncatula controls an early step of Nod factor signal transduction upstream of a rapid calcium flux and root hair deformation. Plant J 34: 495–506[CrossRef][Web of Science][Medline] Bolle C (2004) The role of GRAS proteins in plant signal transduction and development. Planta 218: 683–692[CrossRef][Web of Science][Medline] Brewin NJ (2004) Plant cell wall remodeling in the rhizobium-legume symbiosis. CRC Crit Rev Plant Sci 23: 293–316[CrossRef] Cardenas L, Vidali L, Dominguez J, Perez H, Sanchez F, Hepler PK, Quinto C (1998) Rearrangement of actin microfilaments in plant root hairs responding to Rhizobium etli nodulation signals. Plant Physiol 116: 871–877 Catoira R, Galera C, de Billy F, Penmetsa RV, Journet EP, Maillet F, Rosenberg C, Cook D, Gough C, Denarie J (2000) Four genes of Medicago truncatula controlling components of a nod factor transduction pathway. Plant Cell 12: 1647–1665 Choi HK, Mun JH, Kim DJ, Zhu HY, Baek JM, Mudge J, Roe B, Ellis N, Doyle J, Kiss GB, et al (2004) Estimating genome conservation between crop and model legume species. Proc Natl Acad Sci USA 101: 15289–15294 Downie JA, Walker SA (1999) Plant responses to nodulation factors. Curr Opin Plant Biol 2: 483–489[CrossRef][Web of Science][Medline] Doyle JJ (1994) Phylogeny of the legume family: an approach to understanding the origins of nodulation. Annu Rev Ecol Syst 25: 325–349[CrossRef][Web of Science] Gleason C, Chaudhuri S, Yang TB, Munoz A, Poovaiah BW, Oldroyd GED (2006) Nodulation independent of rhizobia induced by a calcium-activated kinase lacking autoinhibition. Nature 441: 1149–1152[CrossRef][Medline] Harris JM, Wais R, Long SR (2003) Rhizobium-induced calcium spiking in Lotus japonicus. Mol Plant Microbe Interact 16: 335–341[Web of Science][Medline] Haynes JG, Czymmek KJ, Carlson CA, Veereshlingam H, Dickstein R, Sherrier DJ (2004) Rapid analysis of legume root nodule development using confocal microscopy. New Phytol 163: 661–668[CrossRef] Hirsch AM, Fang YW (1994) Plant hormones and nodulation: what's the connection. Plant Mol Biol 26: 5–9[CrossRef][Web of Science][Medline] Hossain MS, Umehara Y, Kouchi H (2006) A novel Fix(-) symbiotic mutant of Lotus japonicus, Ljsym105, shows impaired development and premature deterioration of nodule infected cells and symbiosomes. Mol Plant Microbe Interact 19: 780–788[Web of Science][Medline] Ikeda A, Ueguchi-Tanaka M, Sonoda Y, Kitano H, Koshioka M, Futsuhara Y, Matsuoka M, Yamaguchi J (2001) slender rice, a constitutive gibberellin response mutant, is caused by a null mutation of the SLR1 gene, an ortholog of the height-regulating gene GAI/RGA/RHT/D8. Plant Cell 13: 999–1010 Imaizumi-Anraku H, Takeda N, Charpentier M, Perry J, Miwa H, Umehara Y, Kouchi H, Murakami Y, Mulder L, Vickers K, et al (2005) Plastid proteins crucial for symbiotic fungal and bacterial entry into plant roots. Nature 433: 527–531[CrossRef][Medline] Itoh H, Sasaki A, Ueguchi-Tanaka M, Ishiyama K, Kobayashi M, Hasegawa Y, Minami E, Ashikari M, Matsuoka M (2005) Dissection of the phosphorylation of rice DELLA protein, SLENDER RICE1. Plant Cell Physiol 46: 1392–1399 Itoh H, Ueguchi-Tanaka M, Sato Y, Ashikari M, Matsuoka M (2002) The gibberellin signaling pathway is regulated by the appearance and disappearance of SLENDER RICE1 in nuclei. Plant Cell 14: 57–70 Kalo P, Gleason C, Edwards A, Marsh J, Mitra RM, Hirsch S, Jakab J, Sims S, Long SR, Rogers J, et al (2005) Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators. Science 308: 1786–1789 Kanamori N, Madsen LH, Radutoiu S, Frantescu M, Quistgaard EMH, Miwa H, Downie JA, James EK, Felle HH, Haaning LL, et al (2006) A nucleoporin is required for induction of Ca2+ spiking in legume nodule development and essential for rhizobial and fungal symbiosis. Proc Natl Acad Sci USA 103: 359–364 Karas B, Murray J, Gorzelak M, Smith A, Sato S, Tabata S, Szczyglowski K (2005) Invasion of Lotus japonicus root hairless 1 by Mesorhizobium loti involves the nodulation factor-dependent induction of root hairs. Plant Physiol 137: 1331–1344 Kistner C, Parniske M (2002) Evolution of signal transduction in intracellular symbiosis. Trends Plant Sci 7: 511–518[CrossRef][Web of Science][Medline] Kistner C, Winzer T, Pitzschke A, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J, Webb KJ, et al (2005) Seven Lotus japonicus genes required for transcriptional reprogramming of the root during fungal and bacterial symbiosis. Plant Cell 17: 2217–2229 Krusell L, Madsen LH, Sato S, Aubert G, Genua A, Szczyglowski K, Duc G, Kaneko T, Tabata S, de Bruijn F, et al (2002) Shoot control of root development and nodulation is mediated by a receptor-like kinase. Nature 420: 422–426[CrossRef][Medline] Levy J, Bres C, Geurts R, Chalhoub B, Kulikova O, Duc G, Journet EP, Ane JM, Lauber E, Bisseling T, et al (2004) A putative Ca2+ and calmodulin-dependent protein kinase required for bacterial and fungal symbioses. Science 303: 1361–1364 Lombardo F, Heckmann AB, Miwa H, Perry J, Yano K, Parniske M, Wang T, Hayashi M, Downie JA (2006) Identification of symbiotically defective mutants of Lotus japonicus affected for infection thread growth. Mol Plant Microbe Interact (in press) Madsen EB, Madsen LH, Radutoiu S, Olbryt M, Rakwalska M, Szczyglowski K, Sato S, Kaneko T, Tabata S, Sandal N, et al (2003) A receptor kinase gene of the LysM type is involved in legume perception of rhizobial signals. Nature 425: 637–640[CrossRef][Medline] Mitra RM, Gleason CA, Edwards A, Hadfield J, Downie JA, Oldroyd GED, Long SR (2004a) A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: gene identification by transcript-based cloning. Proc Natl Acad Sci USA 101: 4701–4705 Mitra RM, Shaw SL, Long SR (2004b) Six nonnodulating plant mutants defective for Nod factor-induced transcriptional changes associated with the legume-rhizobia symbiosis. Proc Natl Acad Sci USA 101: 10217–10222 Miwa H, Sun J, Oldroyd GED, Downie JA (2006) Analysis of nod-factor-induced calcium signaling in root hairs of symbiotically defective mutants of Lotus japonicus. Mol Plant Microbe Interact 19: 914–923[Web of Science][Medline] Morohashi K, Minami M, Takase H, Hotta Y, Hiratsuka K (2003) Isolation and characterization of a novel GRAS gene that regulates meiosis-associated gene expression. J Biol Chem 278: 20865–20873 Nishimura R, Hayashi M, Wu GJ, Kouchi H, Imaizumi-Anraku H, Murakami Y, Kawasaki S, Akao S, Ohmori M, Nagasawa M, et al (2002) HAR1 mediates systemic regulation of symbiotic organ development. Nature 420: 426–429[CrossRef][Medline] Nishiyama T, Fujita T, Shin-I T, Seki M, Nishide H, Uchiyama I, Kamiya A, Carninci P, Hayashizaki Y, Shinozaki K, et al (2003) Comparative genomics of Physcomitrella patens gametophytic transcriptome and Arabidopsis thaliana: implication for land plant evolution. Proc Natl Acad Sci USA 100: 8007–8012 Oldroyd GED, Downie JA (2004) Calcium, kinases and nodulation signalling in legumes. Nat Rev Mol Cell Biol 5: 566–576[CrossRef][Web of Science][Medline] Oldroyd GED, Long SR (2003) Identification and characterization of nodulation-signaling pathway 2, a gene of Medicago truncatula involved in Nod factor signaling. Plant Physiol 131: 1027–1032 Perry JA, Wang TL, Welham TJ, Gardner S, Pike JM, Yoshida S, Parniske M (2003) A TILLING reverse genetics tool and a web-accessible collection of mutants of the legume Lotus japonicus. Plant Physiol 131: 866–871 Pysh LD, Wysocka-Diller JW, Camilleri C, Bouchez D, Benfey PN (1999) The GRAS gene family in Arabidopsis: sequence characterization and basic expression analysis of the SCARECROW-LIKE genes. Plant J 18: 111–119[CrossRef][Web of Science][Medline] Radutoiu S, Madsen LH, Madsen EB, Felle HH, Umehara Y, Gronlund M, Sato S, Nakamura Y, Tabata S, Sandal N, et al (2003) Plant recognition of symbiotic bacteria requires two LysM receptor-like kinases. Nature 425: 585–592[CrossRef][Medline] Ratcliff F, Martin-Hernandez AM, Baulcombe DC (2001) Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant J 25: 237–245[CrossRef][Web of Science][Medline] Sandal N, Petersen TR, Murray J, Umehara Y, Karas B, Yano K, Kumagai H, Yoshikawa M, Saito K, Hayashi M, et al (2006) Genetics of symbiosis in Lotus japonicus: recombinant inbred lines, comparative genetic maps, and map position of 35 symbiotic loci. Mol Plant Microbe Interact 19: 80–91[Web of Science][Medline] Schauser L, Handberg K, Sandal N, Stiller J, Thykjaer T, Pajuelo E, Nielsen A, Stougaard J (1998) Symbiotic mutants deficient in nodule establishment identified after T-DNA transformation of Lotus japonicus. Mol Gen Genet 259: 414–423[CrossRef][Web of Science][Medline] Schultze M, Kondorosi A (1998) Regulation of symbiotic root nodule development. Annu Rev Genet 32: 33–57[CrossRef][Web of Science][Medline] Shaw SL, Long SR (2003) Nod factor elicits two separable calcium responses in Medicago truncatula root hair cells. Plant Physiol 131: 976–984 Sieberer BJ, Ketelaar T, Esseling JJ, Emons AMC (2005) Microtubules guide root hair tip growth. New Phytol 167: 711–719[CrossRef][Web of Science][Medline] Silverstone AL, Ciampaglio CN, Sun TP (1998) The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway. Plant Cell 10: 155–169 Smit P, Raedts J, Portyanko V, Debelle F, Gough C, Bisseling T, Geurts R (2005) NSP1 of the GRAS protein family is essential for rhizobial Nod factor-induced transcription. Science 308: 1789–1791 Solaiman MZ, Senoo K, Kawaguchi M, Imaizumi-Anraku H, Akao S, Tanaka A, Obata H (2000) Characterization of mycorrhizas formed by Glomus sp on roots of hypernodulating mutants of Lotus japonicus. J Plant Res 113: 443–448[CrossRef] Stougaard J (1995) Agrobacterium rhizogenes as a vector for transforming higher plants. Methods Mol Biol 49: 46–61 Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J, Szczyglowski K, et al (2002) A plant receptor-like kinase required for both bacterial and fungal symbiosis. Nature 417: 959–962[CrossRef][Medline] Tian CG, Wan P, Sun SH, Li JY, Chen MS (2004) Genome-wide analysis of the GRAS gene family in rice and Arabidopsis. Plant Mol Biol 54: 519–532[CrossRef][Web of Science][Medline] Tirichine L, James EK, Sandal N, Stougaard J (2006) Spontaneous root-nodule formation in the model legume Lotus japonicus: a novel class of mutants nodulates in the absence of rhizobia. Mol Plant Microbe Interact 19: 373–382[Web of Science][Medline] Vierheilig H, Coughlan AP, Wyss U, Piche Y (1998) Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl Environ Microbiol 64: 5004–5007 Wais RJ, Galera C, Oldroyd G, Catoira R, Penmetsa RV, Cook D, Gough C, Denarie J, Long SR (2000) Genetic analysis of calcium spiking responses in nodulation mutants of Medicago truncatula. Proc Natl Acad Sci USA 97: 13407–13412 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
-32P]-labeled probe. Signals were quantified using a Typhoon 8600 variable mode imager and ImageQuanTL (Amersham Bioscience). 
