| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online November 22, 2006; 10.1104/pp.106.092759 Plant Physiology 143:540-551 (2007) © 2007 American Society of Plant Biologists Circadian Rhythms of Isoprene Biosynthesis in Grey Poplar Leaves1Forschungszentrum Karlsruhe GmbH, Institut für Meteorologie und Klimaforschung, Atmosphärische Umweltforschung, 82467 Garmisch-Partenkirchen, Germany
Isoprene (2-methyl-1,3-butadiene) emission varies diurnally in different species. In poplar (Populus spp.), it has recently been shown that the gene encoding the synthesizing enzyme for isoprene, isoprene synthase (ISPS), displays diurnal variation in expression. Working on shoot cultures of Grey poplar (Populus x canescens) placed under a different light regime in phytochambers, we showed that these variations in PcISPS gene expression, measured by quantitative real-time polymerase chain reaction, are not only due to day-night changes, but also are linked to an internal circadian clock. Measurement of additional selected isoprenoid genes revealed that phytoene synthase (carotenoid pathway) displays similar fluctuations, whereas 1-deoxy-D-xylulose 5-phosphate reductoisomerase, possibly the first committed enzyme of the 1-deoxy-D-xylulose 5-phosphate pathway, only shows light regulation. On the protein level, it appeared that PcISPS activity and protein content became reduced under constant darkness, whereas under constant light, activity and protein content of this enzyme were kept high. In contrast, isoprene emission rates under continuous irradiation displayed circadian changes as is the case for gene expression of PcISPS. Furthermore, binding assays with Arabidopsis (Arabidopsis thaliana) late elongated hypocotyl, a transcription factor of Arabidopsis involved in circadian regulation, clearly revealed the presence of circadian-determining regulatory elements in the promoter region of PcISPS.
Rhythms in tune with the day-night cycle of earth are observed in each organism, in metabolism, physiology, or even behavior. In plants, such rhythms have been detected at the physiological level for numerous processes, such as closing of flowers or leaves, chloroplast movements, photosynthetic capacity, stomatal conductance, cell division, and many others (for review, see Johnson, 2001  ). These events are not simple responses to the external environment and continue under constant conditions. Such phenomena with approximately 24-h periodicity are controlled by an endogenous oscillator, the circadian clock. It allows organisms to anticipate daily changes in the environment, providing them with an adaptive advantage.
Circadian clocks have often been divided into three major components: input (resetting the clock), the oscillator itself, and output (physiological phenomena; Somers, 1999
However, if these primary metabolic processes are relatively well characterized for rhythms, secondary metabolites still must be analyzed. Concerning terpenoids, reports on circadian biosynthetic rhythms are sparse and have been limited mainly to in planta chemical analysis and emission profiles (Helsper et al., 1998
Variations of isoprene emissions during the day can be explained by synthesis of isoprene synthase (ISPS) substrates, mainly originating from recently fixed CO2 (Schnitzler et al., 2004
Sparse information is present on the regulation of genes related to isoprene biosynthesis. There are indications that light and temperature stimulate gene expression of DOXP synthase (DXS), the starting enzyme of the DOXP pathway (Sprenger et al., 1997 In this work, we tried to answer the questions of (1) whether diurnal variations of isoprene emission and PcISPS expression are due to circadian regulation or simply related to light cycle-fluctuating day-night conditions and (2) whether other isoprenoid biosynthesis-related genes follow a similar expression pattern. Hence, we measured isoprene emission, ISPS activity, and protein content, as well as gene transcript levels of PcISPS, PcDXR, and phytoene synthase (PSY) in Grey poplar (Populus x canescens) shoot cultures under different light regimes. These activities were accompanied by isolation and analysis of the PcISPS promoter where two regions, which are targets for circadian regulatory proteins, were identified.
Expression of Isoprenoid Biosynthesis-Related Genes under Continuous Light and Darkness Transcript levels of the three genes were determined at different time points during the day over 3 d for shoot culture plants exposed to long-day (LD) conditions (Figs. 1A , 2A , and 3A for ISPS, DXR, and PSY, respectively) in the climate chamber. It is striking that all gene expressions fluctuate, being at low levels during the night and at higher levels during the day. Diurnal fluctuations were also detected under short-day conditions (8-light/16-h dark; data not shown). Each gene presents a distinct pattern.
PcISPS transcript levels appeared to be high in the morning (Fig. 1A). PcDXR expression (Fig. 2A) seems to peak later in the afternoon. The expression levels of PcPSY (Fig. 3A) tend to peak in the morning, go down at midday, and exhibit a second, less intense, peak in the evening. These 3-d experiments also showed the repeatability of these diurnal variations, underlined by the stable conditions within our climate chambers. Because all three studied genes showed diurnal variations in expression level, the hypothesis of a circadian element involved in their transcriptional regulation was tested by placing the poplar shoot cultures in either continuous light (LL) or continuous darkness (DD) and sampling over 3 d. A striking feature was the dramatic decrease of the level of expression when the plants were placed in DD (Figs. 1C, 2C, and 3C). No significant fluctuation was observed under these conditions. Under LL, two patterns of expression were revealed, namely, no significant variations in the level of transcription for PcDXR (Fig. 2B), but rhythmic fluctuations for both PcISPS (Fig. 1B) and PcPSY (Fig. 3B). For PcISPS (Fig. 1B), mean transcript levels were clearly higher (about twice) under LL than under LD light periods (Fig. 1A) for both experiments, confirming light as an enhancer of this gene expression. For PcPSY (Fig. 2, A and B), however, the expression level was equivalent under LD and LL conditions. Therefore, if light is essential to trigger the expression, it may not be the only regulating factor for PcPSY. The most obvious feature of PcISPS and PcPSY expression levels is their rhythmic fluctuation. To identify possible circadian rhythms, the values of expression were made relative (minimal value brought to 0, maximal value brought to 1), the mean of the six values of the two experiments was calculated, and these fluctuations were tested against a sinusoidal curve. The results obtained are represented in Figures 1D and 3D for PcISPS and PcPSY, respectively. Separately for each experiment, the correlation between the observed fluctuations and the calculated curve is also high for both PcISPS (adjusted R2 = 0.9416, P < 0.005 for experiment 1 and adjusted R2 = 0.9652, P < 0.05 for experiment 2; data not shown) and PcPSY (adjusted R2 = 0.9076, P < 0.001 for experiment 1 and adjusted R2 = 0.977, P < 0.05 for experiment 2; data not shown). This indicates that a defined period exists within the observed fluctuations. Interestingly, this period is about 24 h and therefore defines circadian fluctuations. It could be observed that these fluctuations are shifted in phase when compared to LD conditions. Under LL, the maximal values of PcPSY are reached at times corresponding to subjective evening and maximal values of PcISPS are reached at times corresponding to subjective night.
Transcript levels of
ISPS Protein Concentration and Activity and Isoprene Emission under Different Light Regimes
Because we observed circadian regulation of the level of transcript for PcISPS, we wanted to check whether these variations were also present at the level of PcISPS protein concentration, activity, and, finally, emission of isoprene, knowing that emission shows daily variations under day-night cycles (Mayrhofer et al., 2005 The results of protein concentration and enzyme activity measurements are presented in Figure 5 for the three light regimes tested (LD [A and B]; LL [C and D]; and DD [E and F]) for both experiments (A, C, and E and B, D, and F), respectively. It became evident that ISPS protein concentration as well as activity was lower under DD than LL, reaching a maximum of 6 ng mg–1 protein for the concentration and 0.45 µkat kg–1 protein for the activity in the dark, and being over 4 or 7 ng mg–1 protein and 0.6 or 0.4 µkat kg–1 protein in the light (values for both experiments, respectively). This difference between values under dark and light conditions was not as obvious under LD conditions. For one experiment (Fig. 5A), it seemed that during the late night both protein concentration and enzyme activity go down slightly. However, these variations are not significant and could not be observed in the second experiment (Fig. 5B). Globally, we observed a tendency for both activity and protein concentration to peak around midday, but no clear pattern could be statistically extracted. In addition, under LL conditions, enzyme activity and protein levels of ISPS seem to increase over time (Fig. 5, C and D).
Another interesting feature is the correlation between protein level and PcISPS activity when both experiments are analyzed separately, the activity-to-protein ratio indeed being lower in the second experiment (Fig. 5, B, D, and F) than in the first one (Fig. 5, A, C, and E). However, some exceptions to this correlation occur, particularly under LD conditions of the first experiment. Indeed, on the second day, protein levels stayed low (after a decrease during the night), whereas the level of activity appears as high as during the first day. At the third day, protein and activity were both at lower levels. These discrepancies between protein level and enzyme activity resulted in different turnover (Kcat) values ranging from 3.7 to 5.1 mmol isoprene mol–1 ISPS under both darkness and LD conditions and under LL, respectively. Emission of isoprene from the shoot cultures followed a clear diurnal pattern under LD conditions, as shown in Figure 6, A and B (first 48 h) for representative samples, being low overnight and high and stable over the course of the day. When shoots were placed in DD (Fig. 6B, after the first 48 h), isoprene emission dropped down very quickly after switching off the light and, subsequently, declined with a slower rate over the following 3 d. This is not surprising because gene expression, protein concentration, and enzyme activity are all switched down under such conditions. Remarkably, isoprene emission of shoot cultures does occur, even if at a low rate, under darkness. Under LL (Fig. 6A, after the first 48 h), we detected fluctuating isoprene emission rates with a 24-h period between two peaks, therefore defining circadian rhythm. Figure 6C shows the mean of relative values for three independent shoot cultures. Under LL conditions, isoprene emission displayed clear, daily changes on the third and fourth day after onset of LL. On these days, emission was at its strongest (at about 86 h), approximately 20% higher than emission at its lowest (at about 78 h) during the previous 24-h cycle and approximately 30% higher (at about 114 h) than the lowest (at about 100 h) emission in the last 24-h cycle. Relative values (minimal value brought to 0, maximal to 1) of fluctuation were tested against a sinusoidal curve, but, because of the decline in isoprene emission during the first 2 d, it was only possible to fit a curve on the data of the last 2 d. The fluctuation of isoprene emission during these days was highly significant (adjusted R2 = 0.9951, P < 0.0001; Fig. 6C), clearly testifying for circadian rhythm of isoprene emission. The highest rate of emission always occurred in the subjective afternoon, showing a switched circadian rhythm phase of isoprene emission under LL.
It is obvious that addition of water onto the agarose surface, even without touching the leaves and disturbing the gas flow, reduced the isoprene emission rate. Gas-exchange analysis of culture glasses after removal of the green tissue parts (stem and leaves) revealed that isoprene emission (background) was approximately 10% of the initial values.
To get more insight into the circadian regulation of PcISPS, we isolated the promoter region of this gene by gene walking and primers designed for putative sequences available in the poplar genome databank and other databases (Fig. 7 ). The isolated sequence (accession no. AJ294819) of 1,612 bases (1,434 in front of the ATG codon) was aligned with the putative sequence from Populus trichocarpa (obtained from the draft genome) and with the published sequence from Populus tremuloides (accession no. AY341431). This alignment explains the failure of some forward primers designed according to the P. trichocarpa sequence and extending on variable regions. In general, different sequences show a high degree of similarity (on the common parts), ranging from 90% between Grey poplar and P. trichocarpa to 94% between Grey poplar and P. tremuloides, respectively. However, some small regions are diverging because of gaps and/or insertions.
Regulatory elements were searched within the Grey poplar promoter sequence. Putative TATA and CAAT boxes are indications of the functionality of this sequence, TATA boxes being one type of core-promoter element essential for transcription initiation (Roeder, 1996 ). Using the databases plantCARE (Rombauts et al., 1999) and PLACE (Prestridge, 1991; Higo et al., 1999), many putative regulatory sequences were identified, particularly light, heat stress, and circadian-related ones. Moreover, two circadian elements (AAAAATCT) nearer to the start codon were found that are known to be recognized by late elongated hypocotyls (LHYs) and circadian clock-associated 1 (CCA1), two regulation factors enhancing morning expression of genes with such promoter elements (for review, see Devlin, 2002). In particular, this finding corresponds to the observation of the early expression of PcISPS in Figure 1A.
To prove the functionality of the cloned putative promoter, it was fused to the reporter genes coding for the enzyme For analyzing whether LHY may have a role in transcription of the PcISPS gene, fragment 1 and fragment 2 (Fig. 7) were amplified by PCR, each fragment carrying one putative binding box for this circadian regulatory protein. Heterologously expressed AtLHY protein was used to perform an electrophoretic mobility shift assay (EMSA) to test whether this factor binds to the identified circadian elements on the PcISPS promoter. As presented in Figure 8 , lines 2 and 5, AtLHY is indeed binding to the PcISPS promoter fragments. The 200-fold molar excess of unlabeled DNA used in the binding reactions loaded in lines 3 and 6 proved that the observed shift (due to the binding of AtLHY proteins onto PcISPS promoter fragments) is specific.
Gene expression of PcISPS, PcDXR, and PcPSY in Grey poplar leaves follows diurnal variations under day-night conditions, being indeed enhanced by light and reduced during night and under DD. This indicates a primary role of light as a trigger of the expression of these isoprenoid biosynthesis-related genes. Formation of the carbon-rich compounds, such as isoprenoids, requires carbon pools. Because carbon fixation occurs during daylight, the observed diurnal variations in isoprenoid biosynthesis-related genes appear logical. It had even been shown that 75% of the carbon used to produce isoprene in poplar leaves come directly from photosynthesis (Schnitzler et al., 2004 ).
The role of isoprene is still controversial, but, being either a valve to evacuate carbon or energy overflow (Rosenstiel et al., 2004
The presence of circadian regulatory elements and putative light elements in the promoter sequence of PcISPS could explain the observed regulation of this gene by the circadian clock and by light. The presence of two morning elements known to be recognized in Arabidopsis by the self clock-regulated factors LHY and CCA1 could be responsible for the early peak of expression of PcISPS. Recently, Wilkinson et al. (2006)
TUB is a common housekeeping gene used as an internal control for data normalization in real-time PCR measurements. However, a recent analysis of common housekeeping genes in poplar, over the development, showed that TUB may not be the most appropriate housekeeping gene in this species under the tested conditions (Brunner et al., 2004
Absence of a correlation between PcISPS gene expression level and PcISPS protein/activity detected at the daily level was also observed at the seasonal level (Mayrhofer et al., 2005
In field conditions, isoprene emission from poplars was known to present daily variations linked to temperature and light intensity (Mayrhofer et al., 2005
DOXP pathway genes are regulated by development (Kuzma and Fall, 1993
PSY is the first dedicated and regulating enzyme of the carotenoid pathway (Von Lintig et al., 1997
Gene expression of PcDXR and PcISPS is not synchronized, which raises the question of the pool of dimethylallyl diphosphate, a substrate of ISPS. Interestingly, dimethylallyl diphosphate pools have been shown to fluctuate diurnally in different species (Fisher et al., 2001
Plant Material, Growth, and Experimental Designs
Six to seven wild-type Grey poplar (Populus x canescens) shoots were grown on one-half-strength concentrated Murashige and Skoog (1962) All experiments were repeated twice. Each sample consisted of all the leaves of one shoot. Nine containers (3/d over 3 d) were necessary per condition (LD, DD, and LL) for the circadian experiment. For all experiments, plants were placed in tested conditions at 10 PM the day before the first sampling. For all experiments, samplings were done at 5 AM (1 h before the end of the standard night), 7 AM, 2 PM, 10 PM (just before start of the standard night), and midnight. For the darkness condition, containers were opened and samples were taken under red light. All samples, consisting of all leaves of one shoot, were immediately frozen in liquid nitrogen and stored at –80°C.
Cycle-sequencing dideoxy chain termination reactions with Big Dye terminators (PE Applied Biosystems) were performed for both DNA strands of all DNA segments investigated, using universal forward and backward primers (Invitrogen) or sequence-specific oligonucleotides. Sequences were analyzed by using an ABI PRISM system 310 (PE Applied Biosystems). To verify the specificity of primers on experimental cDNA, sequencing of purified products of real-time PCR was done by MWG Biotech AG using the same specific forward and backward primers as for quantitative reverse transcription (RT)-PCR.
Because the Grey poplar ISPS gene sequence (accession no. AJ294819) displays only 56 bases identified in front of the start codon, it was not possible to use it directly to find indications on the putative promoter sequence within the genome sequence of Populus trichocarpa (http://genome.jgi-psf.org/Poptr1/Poptr1.home.html). Therefore, the PcISPS sequence was BLASTed on the National Center for Biotechnology Information server to GenBank, revealing homologies with different terpene synthases, including two sequences of ISPS, one from Populus alba (accession no. AB198180) without a promoter part and one from Populus tremuloides (accession no. AY341431) displaying around 1 kb at the 5' end of the start codon. This sequence (5' end until the end of the first exon) was then used on the draft genome of P. trichocarpa. Sequences with the higher similarity were selected and aligned (using ClustalW; ClustalW WWW service at the European Bioinformatics Institute [http://www.ebi.ac.uk/clustalw]). The sequence with highest similarity to the P. tremuloides sequence was chosen and used for the second BLAST run on the genome. The same procedure was repeated three more times, until around 2.1 kb of the putative promoter region were identified. At different positions on the 5' end of this sequence, 10 forward primers were randomly designed, each used combined to a reverse primer annealing in the exon 1 of the PcISPS gene (2325R primer designed in the first exon: CGTAATTGGCAGAGCGTCTG) with the following PCR conditions on a Biometra thermocycler, using polymerase platinum Taq (Invitrogen): 3-min denaturation at 94°C, 35 cycles at 94°C for 15 s, 50°C for 30 s, 72°C for 2 min, and 72°C for 4 min. The largest fragment (around 1.5 kb) was obtained with the primer 711F (CAAATAAACCTTAACATACAAATCATATTG). Two clones of this fragment were sequenced in both directions twice (nested sequencing, also repeated twice on both clones, had to be performed with internal primers because of the length of the sequence). Alignment of the obtained sequences leads to one sequence (published under accession no. AM084344) as the putative promoter region for the PcISPS gene, displaying 1,434 bp in front of the start codon.
Total RNA from frozen poplar leaves was isolated with the Qiagen RNeasy mini kit (Qiagen) following the Qiagen standard protocol. Amount and purity of isolated RNA were determined with NanoDrop ND-1000, a full-spectrum spectrophotometer having very high accuracy. The absorbance ratio 260/280 nm testified for very pure RNA, the mean of the samples ±SD being 2.116 ± 0.037. For first-strand cDNA synthesis, 3 µg of total RNA were reverse transcribed using oligo(dT) primers and SuperScript II reverse transcriptase (Invitrogen) in a total volume of 20 µL according to the manufacturer's protocol. cDNA was stored at –20°C prior to analysis.
For quantitative PCR measurements of transcript levels, two to three primers pairs were designed for each gene of interest with PrimerExpress software (version 2.0.0; ABI-Prism). Their efficiency was tested by RT-PCR on the reference plasmid containing a sequenced fragment of the gene of interest and on experimental cDNA. The primer pairs used for further measurements were selected as being the most efficient ones, giving similar amplicons (checked on agarose gel) and dissociation curve patterns from plasmid and cDNA templates. Their sequences are as follows: for PcISPS, forward (5'-tttgcctactttgccgtggttcaaaac-3') and reverse (5'-tcctcagaaatgccttttgtacgcatg-3'); for PcDXR, forward (5'-gcatatgtcttttccagcttctattgc-3') and reverse (5'-ggaatagtaggttgcgcaggc-3'); for PcPSY, forward (5'-atgcatcacatatcacacccaaa-3') and reverse (5'-ctcctagcatcttctccaacatctc-3'); for PcTUB (accession no. AY353093), forward (5'-gatttgtccctcgcgctgt-3') and reverse (5'-tcggtataatgacccttggcc-3'). The resulting PCR segment lengths were 197 bp (PcISPS), 66 bp (PcDXR), 379 bp (PcPSY), and 151 bp (PcTUB), respectively. As a fluorescent marker for the increasing amount of double-stranded DNA, SYBR Green was used. The assays contained 12.5 µL 2x SYBR Green PCR master mix (Applied Biosystems), 300 nM of each primer, and 5 µL of total cDNA (diluted five times) in a final volume of 25 µL. After a hot start (10 min, 95°C), 45 PCR cycles were performed with a 15-s melting step at 95°C and a 1-min annealing/extension step at 60°C on a GeneAmp 5700 sequence detection system (Applied Biosystems). Transcript levels were related to the quantity of RNA used for RT. Transcript levels were calculated by the threshold cycle method with a standard curve under the GeneAmp 5700 sequence detection system software. To verify the amplification of the correct genes from poplar cDNA, all amplicons were purified from 0.8% agarose gels and sequenced.
ISPS activity was assayed as previously described by Mayrhofer et al. (2005)
Quantification of ISPS protein was performed according to Schnitzler et al. (2005)
Expression and purification of the recombinant Arabidopsis (Arabidopsis thaliana) LHY protein was performed using the AtLHY coding region fused to a C-terminal hexahistidine tag in pQE60 vector (Kim et al., 2003 The following PCR fragments of the PcISPS gene promoter region were used in the experiment: the 241-bp-long fragment 1 amplified using the forward primer (5'-TAGTCCACGTATTGATGATAACA-3') and the reverse primer (5'-AGGTGACAATTTCAGACGTC-3'), and the 259-bp long fragment 2 amplified using the forward primer (5'-CTGAACATTCCAGGTCTAATG-3') and the reverse primer (5'-CCTCTAGTAATGGAAACTGCA-3'). As determined by in silico analysis, each fragment contains one putative binding box for the LHY protein. Biotin end labeling of the DNA fragments was carried out using the biotin 3'-end DNA-labeling kit (Pierce). The LightShift Chemiluminescent EMSA kit (Pierce) was used to detect whether the AtLHY protein binds to the PcISPS promoter. Experimental procedures (binding reaction and revealing the biotin-labeled DNA on the membrane) were performed according to the manufacturer's instructions. In binding reactions, 10 ng of biotin-labeled PcISPS promoter fragment DNA (control) plus 2 ng of AtLHY protein (binding reaction), and, finally, about 2,000 ng of unlabeled PcISPS promoter fragment DNA (to check the binding specificity) were used. Samples were loaded on a 6% DNA retardation gel (Invitrogen). DNA and protein were then semidried and transferred after half an hour at 300 mA to a nylon membrane (Qiabrane nylon plus; Qiagen).
Measurements of isoprene emission from shoot culture containers were performed with an adapted head-space analysis system using online proton transfer reaction (PTR)-mass spectrometry (MS), a combination of a PTR reaction drift tube and quadrupole MS. The instrument allows fast detection of most VOCs in combination with low detection limits (10–100 pptv; for details, see Lindinger et al., 1998 The first 24 to 48 h of the experiments were used to flush excess isoprene previously accumulated in the containers during the development of the plants and to let the plants adapt to the constant gas stream. After the isoprene level appears stable, isoprene emission was measured over a LD day-night cycle. At 10 PM of the following day, one container was placed in LL and the other in DD (covered with aluminum foil) and emissions were measured during three virtual day-night cycles. For calibration of PTR-MS, a gas standard (Apel-Riemer) with a continuous flow (20 mL min–1) of a mixture of VOCs, including isoprene at 1.05 ppmv, was diluted into the gas stream of 500 mL min–1 and flushed through an empty container for one-half hour at the beginning and end of the experiments. Because the sensitivity of the PTR-MS went slightly down during the measuring period, the standard curve for isoprene through the experiment was corrected according to the declining signal of the primary ion (mass 21, deuterium isotope of H3O+). At the end of the experiments, isoprene emission from agar and roots (green material removed) was measured and these background values were subtracted from previously measured global isoprene emissions.
Statistical and correlational analysis was performed with SPSS for Windows NT (release 8.0.0) and SigmaPlot for Windows (version 9.0), both programs from SPSS. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number AM084344.
We gratefully acknowledge provision of a PcTUB fragment of poplar by Stanislav Kopriva (Norwich Research Park, UK) and the AtLHY-6x-His construct by Isabelle A. Carré (University of Warwick, UK). Received November 7, 2006; accepted November 15, 2006; published November 22, 2006.
1 This work was supported by the European Commission in the frame of the Marie-Curie Research Training Network ISONET (Ecological and physiological functions of biogenic isoprenoids and their impact on the environment) and the German Science Foundation within the German joint research group, Poplar—a model to address tree-specific questions (grant no. SCHN653/4). 
2 These authors contributed equally to the paper. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Sandrine Louis (sandrine.louis{at}imk.fzk.de). www.plantphysiol.org/cgi/doi/10.1104/pp.106.092759 * Corresponding author; e-mail sandrine.louis{at}imk.fzk.de; fax 49–8821–73573.
Affek HP, Yakir D (2002) Protection by isoprene against singlet oxygen in leaves. Plant Physiol 129: 269–277 Biesenthal TA, Wu Q, Shepson PB, Wiebe HA, Anlauf KG, MacKay GI (1997) A study of relationships between isoprene, its oxidation products, and ozone, in the lower Fraser valley, BC. Atmos Environ 31: 2049–2058[CrossRef] Brüggemann N, Schnitzler J-P (2002) Comparison of isoprene emission, intercellular isoprene concentration and photosynthetic performance in water-limited oak (Quercus pubescens wild and Quercus robur L) saplings. Plant Biol 4: 456–463[CrossRef] Brunner AM, Yakovlev IA, Strauss SH (2004) Validating internal controls for quantitative plant gene expression studies. BMC Plant Biol 4: 14[CrossRef][Medline] Carretero-Paulet L, Ahumada I, Cunillera N, Rodríguez-Concepcíon M, Ferrer A, Boronat A, Campos N (2002) Expression and molecular analysis of the Arabidopsis DXR gene encoding 1-deoxy-D-xylulose 5-phosphate reductoisomerase, the first committed enzyme of the 2-C-methyl-D-erythritol 4-phosphate pathway. Plant Physiol 129: 1581–1591 Derwent RG, Jenkin ME, Saunders SM, Pilling MJ (1998) Photochemical ozone creation potentials for organic compounds in northwest Europe calculated with a master chemical mechanism. Atmos Environ 32: 2429–2441[CrossRef] Devlin PF (2002) Signs of the time: environmental input to the circadian clock. J Exp Bot 53: 1535–1550 Dudareva N, Andersson S, Orlova I, Gatto N, Reichelt M, Rhodes D, Boland W, Gershenzon J (2005) The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers. Proc Natl Acad Sci USA 102: 933–938 Dudareva N, Martin D, Kish CM, Kolosova N, Gorestein N, Fäldt J, Miller B, Bohlmann J (2003) (E)- Eisenreich W, Rohdich F, Bacher A (2001) Deoxyxylulose phosphate pathway of terpenoids. Trends Plant Sci 6: 78–84[CrossRef][Web of Science][Medline] Estévez JM, Cantero A, Reindl A, Reichler S, Leon P (2001) 1-deoxy-D-xylulose-5-phosphate synthase, a limiting enzyme for plastidic isoprenoid biosynthesis in plants. J Biol Chem 276: 22901–22909 Fisher AJ, Rosenstiel TN, Shirk MC, Fall R (2001) Nonradioactive assay for cellular dimethylallyl diphosphate. Anal Biochem 292: 272–279[CrossRef][Web of Science][Medline] Guevara-Garcia A, San Roman C, Arroyo A, Cortes ME, de la Luz Gutierrez-Nava M, Leon P (2005) Characterization of the Arabidopsis clb6 mutant illustrates the importance of posttranscriptional regulation of the methyl-D-erythritol 4-phosphate pathway. Plant Cell 17: 628–643 Harmer SL, Hogenesch JB, Straume M, Chang HS, Han B, Zhu T, Wang X, Kreps JA, Kay SA (2000) Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. Science 290: 2110–2113 Heintzen C, Fischer R, Melzer S, Kappeler S, Apel K, Staiger D (1994) Circadian oscillations of a transcript encoding a germin-like protein that is associated with cell walls in young leaves of the long-day plant Sinapis alba L. Plant Physiol 106: 905–915[Abstract] Helsper JPFG, Davies JA, Bouwmeester HJ, Krol AF, Van Kampen MH (1998) Circadian rhythmicity in emission of volatile compounds by flowers of Rosa hybrida L cv Honesty. Planta 207: 88–95[CrossRef][Web of Science] Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database. Nucleic Acids Res 27: 297–300 Hsieh M-H, Goodman HM (2005) The Arabidopsis IspH homolog is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis. Plant Physiol 138: 641–653 Johnson CH (2001) Endogenous timekeepers in photosynthetic organisms. Annu Rev Plant Physiol Plant Mol Biol 63: 695–728 Johnson CH, Roeber J, Hastings JW (1984) Circadian changes in enzyme concentration account for rhythm of enzyme activity in Gonyaulax. Science 223: 1428–1430 Kesselmeier J, Staudt M (1999) Biogenic volatile organic compounds (VOC): an overview on emission, physiology and ecology. J Atmos Chem 33: 23–88[CrossRef] Kim JY, Song HR, Taylor BL, Carré IA (2003) Light-regulated translation mediates gated induction of the Arabidopsis clock protein LHY. EMBO J 22: 935–944[CrossRef][Web of Science][Medline] Kuzma J, Fall R (1993) Leaf isoprene emission rate is dependent on leaf development and the level of isoprene synthase. Plant Physiol 101: 435–440[Abstract] Leplé JC, Brasileiro ACM, Michel MF, Delmotte F, Jouanin L (1992) Transgenic poplars: expression of chimeric genes using four different constructs. Plant Cell Rep 11: 137–141[Web of Science] Lindinger W, Hansel A, Jordan A (1998) Proton-transfer-reaction mass spectrometry (PTR-MS): on-line monitoring of volatile organic compounds at pptv levels. Chem Soc Rev 27: 347–354[CrossRef] Lois LM, Rodríguez-Concepcíon M, Gallego F, Campos N, Boronat A (2000) Carotenoid biosynthesis during tomato fruit development: regulatory role of 1-deoxy-D-xylulose 5-phosphate synthase. Plant J 22: 503–513[CrossRef][Web of Science][Medline] Loreto F, Mannozzi M, Maris C, Nascetti P, Ferranti F, Pasqualini S (2001) Ozone quenching properties of isoprene and its antioxidant role in leaves. Plant Physiol 126: 993–1000 Loreto F, Velikova V (2001) Isoprene produced by leaves protects the photosynthetic apparatus against ozone damage, quenches ozone products, and reduces lipid peroxidation of cellular membranes. Plant Physiol 127: 1781–1787 Lu S, Xu R, Jia J-W, Pang J, Matsuda SPT, Chen X-Y (2002) Cloning and functional characterization of a Magel E, Mayrhofer S, Müller A, Zimmer I, Hampp R, Schnitzler J-P (2006) Photosynthesis and substrate supply for isoprene biosynthesis in poplar leaves. Atmos Environ 40: S138–S151[CrossRef] Mahmoud SS, Croteau RB (2001) Metabolic engineering of essential oil yield and composition in mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran synthase. Proc Natl Acad Sci USA 98: 8915–8920 Mayrhofer S, Teuber M, Zimmer I, Louis S, Fischbach RJ, Schnitzler J-P (2005) Diurnal and seasonal variation of isoprene biosynthesis-related genes in Grey poplar leaves. Plant Physiol 139: 474–484 McClung CR (2000) Circadian rhythms in plants: a millennial view. Physiol Plant 109: 359–371[CrossRef] McClung CR (2006) Plant circadian rhythms. Plant Cell 18: 792–803 Miller B, Oschinski C, Zimmer W (2001) First isolation of an isoprene synthase gene from poplar and successful expression of the gene in Escherichia coli. Planta 213: 483–487[CrossRef][Web of Science][Medline] Monson RK, Jaeger CH, Adams WW, Driggers EM, Silver GM, Fall R (1992) Relationship among isoprene emission rate, photosynthesis, and isoprene synthase activity as influenced by temperature. Plant Physiol 98: 1175–1180 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15: 473–497[CrossRef] Nozue K, Maloof JN (2006) Diurnal regulation of plant growth. Plant Cell Environ 29: 396–408[CrossRef][Medline] Piechulla B (1993) Circadian clock directs the expression of plant genes. Plant Mol Biol 22: 533–542[CrossRef][Web of Science][Medline] Piechulla B, Gruissem W (1987) Diurnal mRNA fluctuations of nuclear and plastid genes in developing tomato fruits. EMBO J 6: 3593–3599[Web of Science][Medline] Prestridge DS (1991) Signal scan: a computer program that scans DNA sequences for eukaryotic transcriptional elements. CABIOS 7: 203–206[Medline] Roeder RG (1996) The role of general initiation factors in transcription by RNA polymerase II. Trends Plant Sci 21: 327–335 Rodríguez-Concepcíon M, Ahumada I, Diez-Juez E, Sauret-Gueto S, Lois LM, Gallego F, Carretero-Paulet L, Campos N, Boronat A (2001) 1-Deoxy-D-xylulose 5-phosphate reductoisomerase and plastid isoprenoid biosynthesis during tomato fruit ripening. Plant J 27: 213–222[CrossRef][Web of Science][Medline] Rombauts S, Déhais P, Van Montagu M, Rouzé P (1999) PlantCARE, a cis-acting regulatory element database. Nucleic Acids Res 27: 295–296 Rosenstiel TN, Ebbets AL, Khatri WC, Fall R, Monson RK (2004) Induction of poplar leaf nitrate reductase: a test of extrachloroplastic control of isoprene emission rate. Plant Biol 6: 12–21[CrossRef][Medline] Sasaki K, Ohara K, Yazaki K (2005) Gene expression and characterization of isoprene synthase from Populus alba. FEBS Lett 579: 2514–2518[CrossRef][Web of Science][Medline] Schaffer R, Landgraf J, Accerbi M, Simon V, Larson M, Wisman E (2001) Microarray analysis of diurnal and circadian regulated genes in Arabidopsis. Plant Cell 13: 113–123 Schnitzler J-P, Graus M, Kreuzwieser J, Heizmann U, Rennenberg H, Wisthaler A, Hansel A (2004) Contribution of different carbon sources to isoprene biosynthesis in poplar leaves. Plant Physiol 135: 152–160 Schnitzler J-P, Zimmer I, Bachl A, Arend M, Fromm J, Fischbach RJ (2005) Biochemical properties of isoprene synthase from poplar (Populus x canescens). Planta 222: 777–786[CrossRef][Web of Science][Medline] Sharkey TD, Loreto F (1993) Water stress, temperature and light effects on the capacity for isoprene emission and photosynthesis of kudzu leaves. Oecologia 343: 1–6 Sharkey TD, Singsaas EL (1995) Why plants emit isoprene. Nature 374: 769 Sharkey TD, Yeh S (2001) Isoprene emission from plants. Annu Rev Plant Physiol Plant Mol Biol 52: 407–436[CrossRef][Web of Science][Medline] Simkin AJ, Underwood BA, Auldridge M, Loucas HM, Shibuya K, Schmelz E, Clark DG, Klee HJ (2004) Circadian regulation of the PhCCD1 carotenoids cleavage dioxygenase controls emission of Singsaas EL, Lerdau M, Winter K, Sharkey TD (1997) Isoprene increases thermotolerance of isoprene-emitting species. Plant Physiol 115: 1413–1420[Abstract] Somers DE (1999) The physiology and molecular bases of the plant circadian clock. Plant Physiol 121: 9–19 Sprenger GA, Schörken U, Wiegert T, Grolle S, De Graaf AA, Taylor SV, Begley TP, Bringer-Meyer S, Sahm H (1997) Identification of a thiamin-dependent synthase in Escherichia coli required for the formation of the 1-deoxy-D-xylulose 5-phosphate precursor to isoprenoids, thiamin, and pyridoxol. Proc Natl Acad Sci USA 94: 12857–12862 Takahashi S, Kuzyama T, Watanabe H, Seto H (1998) A 1-deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-erythritol 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis. Proc Natl Acad Sci USA 95: 9879–9884 Tholl D, Boland W, Hansel A, Loreto F, Rose US, Schnitzler J-P (2006) Practical approaches to plant volatile analysis. Plant J 45: 540–560[CrossRef][Web of Science][Medline] Thompson AM (1992) The oxidizing capacity of the Earth's atmosphere: probable past and future changes. Science 256: 1157–1165[CrossRef][Web of Science][Medline] Von Lintig J, Welsch R, Bonk M, Giuliano G, Batschauer A, Kleinig H (1997) Light-dependent regulation of carotenoid biosynthesis occurs at the level of phytoene synthase expression and is mediated by phytochrome in Sinapsis alba and Arabidopsis thaliana seedlings. Plant J 12: 625–634[CrossRef][Web of Science][Medline] Wang ZY, Tobin EM (1998) Constitutive expression of the circadian clock associated 1 (CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell 93: 1207–1217[CrossRef][Web of Science][Medline] Wilkinson MJ, Owen SM, Possell M, Hartwell J, Gould P, Hall A, Vickers C, Hewitt CN (2006) Circadian control of isoprene emissions from oil palm (Elaeis guineensis). Plant J 47: 960–968[CrossRef][Web of Science][Medline] Wolfertz M, Sharkey TD, Boland W, Kühnemann F, Yeh S, Weise E (2003) Biochemical regulation of isoprene emission. Plant Cell Environ 26: 1357–1363[CrossRef] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
-pinene synthase gene in leaves of Artemisia annua under continuous conditions; Simkin et al. (2004)
x/b + c]; with a = 0.3058; b = 23.8008; c = 1.3433; y0 = 0.3920) regression on relative data under LL conditions (mean of both experiments; adjusted R2 = 0.9690, P < 0.05). Darkness is represented as shaded areas. Transcript levels are related to RNA quantity.
) and enzyme activity (
; n = 3 ± SD). Darkness is represented as shaded areas.
