| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online January 5, 2007; 10.1104/pp.106.091454 Plant Physiology 143:720-731 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Abscisic Acid and Stress Signals Induce Viviparous1 Expression in Seed and Vegetative Tissues of Maize1,[OA]Department of Genetics, Development and Cell Biology, Iowa State University, Ames, Iowa 50011 (X.C., N.D., P.W.B.); Department of Plant Sciences, University of Oxford, Oxford OX1 3RB, United Kingdom (L.M.C., J.F.G.-M.); Biogemma, 63 170 Aubire, France (C.B.-P., B.K., P.P.); and Department of Horticultural Sciences, University of Florida, Gainesville, Florida 32611 (D.R.M.)
Viviparous1 (Vp1) encodes a B3 domain-containing transcription factor that is a key regulator of seed maturation in maize (Zea mays). However, the mechanisms of Vp1 regulation are not well understood. To examine physiological factors that may regulate Vp1 expression, transcript levels were monitored in maturing embryos placed in culture under different conditions. Expression of Vp1 decreased after culture in hormone-free medium, but was induced by salinity or osmotic stress. Application of exogenous abscisic acid (ABA) also induced transcript levels within 1 h in a dose-dependent manner. The Vp1 promoter fused to  -glucuronidase or green fluorescent protein reproduced the endogenous Vp1 expression patterns in transgenic maize plants and also revealed previously unknown expression domains of Vp1. The Vp1 promoter is active in the embryo and aleurone cells of developing seeds and, upon drought stress, was also found in phloem cells of vegetative tissues, including cobs, leaves, and stems. Sequence analysis of the Vp1 promoter identified a potential ABA-responsive complex, consisting of an ACGT-containing ABA response element (ABRE) and a coupling element 1-like motif. Electrophoretic mobility shift assay confirmed that the ABRE and putative coupling element 1 components specifically bound proteins in embryo nuclear protein extracts. Treatment of embryos in hormone-free Murashige and Skoog medium blocked the ABRE-protein interaction, whereas exogenous ABA or mannitol treatment restored this interaction. Our data support a model for a VP1-dependent positive feedback mechanism regulating Vp1 expression during seed maturation.
Angiosperm embryo development involves three overlapping phases (West and Harada, 1993  ). Embryo pattern formation occurs in the early morphogenesis phase. During the maturation phase, macromolecular reserves, such as storage proteins, lipids, and carbohydrates, are synthesized and accumulated. During the final stage, tissue growth and development is arrested and embryos acquire the ability to withstand desiccation and may enter dormancy. Mature embryos remain metabolically quiescent until favorable conditions trigger germination. Proper control of maturation and germination transition is crucial for plant survival in nature and is also of great agronomic importance because of its relationship to dormancy and preharvest sprouting (for review, see Gubler et al., 2005).
Plant hormones are central regulators of the dormancy-germination transition. Abscisic acid (ABA) is well known to promote seed dormancy and repress seed germination, whereas gibberellic acid functions antagonistically to trigger seed germination (Kucera et al., 2005
VIVIPAROUS1 (VP1) is a B3 domain-containing transcription factor that is central to the regulation of seed maturation in maize (Zea mays; McCarty et al., 1991
Studies of ABA induction of gene expression identified the ABA-responsive element (ABRE), a cis-acting promoter element with an ACGT core sequence, which is required for ABA induction of many plant genes (for review, see Yamaguchi-Shinozaki and Shinozaki, 2005
Although multiple copies of ABREs confer ABA inducibility to a heterologous promoter, a single-copy ABRE is not sufficient for expression. In many promoters, a second cis-acting element, called a coupling element (CE), is required to form an ABA-responsive complex (ABRC; Busk and Pages, 1998
VP1/ABI3 and ABA regulate the expression of overlapping sets of genes, including many that require both VP1/ABI3 and ABA (Suzuki et al., 2003
Whereas substantial work has been done on the mechanisms by which VP1 and ABA regulate seed maturation, regulation of Vp1 expression is largely unknown. In Arabidopsis, the LEAFY COTYLEDON1 (LEC1), LEC2, and FUSCA3 (FUS3) genes have pleiotropic effects on embryo development and maturation and promote ABI3 expression (Kagaya et al., 2005
ABA, Salt, and Osmotica Induce Vp1 Expression in Cultured Embryos
VP1 is expressed in mid- to late-phase embryos and in aleurone cells of maturing maize seeds (McCarty et al., 1989
Because VP1 functions in ABA-regulated processes, we checked whether Vp1 expression was regulated by ABA. Whereas Vp1 transcript levels decreased substantially after 24 h in hormone-free culture, the Vp1 expression level in embryos cultured with 10 or 100 µM of ABA was nearly as high as in freshly isolated embryos, indicating that exogenous ABA maintained Vp1 expression (Fig. 1B). As 10 µM ABA was sufficient to maintain Vp1 expression in embryos, this concentration was used in subsequent experiments. It was possible that ABA could maintain, but not induce, Vp1 expression. In a similar experiment in barley, the decline in HvVp1 expression was attributed to an indirect effect of embryo germination in hormone-free medium (Hollung et al., 1997 ). To test this possibility, embryos were cultured in hormone-free medium for 24 h to decrease Vp1 expression levels, after which ABA was added to the medium for various incubation times. After 1 h of treatment with ABA, Vp1 expression returned to levels nearly as high as those of freshly harvested embryos, demonstrating that ABA can induce de novo Vp1 expression (Fig. 1C). We next examined the dose response of Vp1 expression to ABA. Vp1 expression was slightly induced by 0.1 µM ABA and increased to a plateau at 10 to 50 µM (Fig. 1D). These data indicate that physiological concentrations of ABA can induce and maintain Vp1 transcript levels in maturation-phase maize embryos. To address whether the ABA induction of Vp1 expression requires de novo protein synthesis, 20-DAP maize embryos were cultured without hormones for 24 h, then 20 µM cycloheximide was added to the medium to inhibit protein synthesis. After 20 min of cycloheximide treatment, 10 µM ABA was added and embryos were further cultured for 1 h. The cycloheximide treatment did not inhibit the induction of Vp1 expression by ABA (Fig. 1E), indicating that ABA induction of Vp1 expression in cultured embryos does not require de novo protein synthesis. During the seed maturation phase, embryos accumulate storage reserves and develop desiccation tolerance. As such, embryos are subjected to a milieu of high concentrations of sugars, metabolites, and osmotica. We hypothesized that Vp1 expression might be regulated by these physiological factors and so examined the effects of Suc, mannitol, and salt on Vp1 expression. As shown in Figure 1B, Vp1 expression was maintained or induced in embryos cultured with 500 mM NaCl, 20% Suc, or 20% mannitol. Vp1 expression was also maintained or induced with 200 mM NaCl, 7% Suc, and/or 7% mannitol (data not shown). Thus, salt and osmotic stress can maintain or induce Vp1 expression in maturation-phase embryos. We also checked the effects of other hormones known to be involved in seed development by applying exogenous GA3, indole acetic acid, and 1-aminocyclopropane-1-carboxylic acid (ACC; a precursor for ethylene synthesis). No effects on Vp1 expression were detected with these treatments and no interaction was observed between ABA and indole acetic acid or ACC (data not shown).
To further study the regulation of Vp1 expression, 958 bp of the Vp1 5' sequence was obtained by sequencing a genomic clone from the W22 inbred line (GenBank accession no. DQ886030). Like sorghum, the maize Vp1 promoter lacks a canonical TATA box (Carrari et al., 2001
Rice Osvp1 and sorghum Sbvp1 promoter sequences were obtained from the National Center for Biotechnology Information and, along with maize Vp1, subjected to phylogenetic footprinting to predict conserved cis-regulatory elements (Sandelin et al., 2004
To confirm that the 958 bp of the genomic Vp1 promoter sequence contained all the regulatory elements necessary for normal transcriptional regulation, the promoter was fused to GUS or green fluorescent protein (GFP) and stably introduced into transgenic maize lines. Endogenous Vp1 is expressed by 10 DAP in maturing embryos and aleurone (McCarty et al., 1989
Vp1 Expression Is Induced in Vegetative Tissues by Stress Because Vp1 expression is inducible in embryos by ABA and stress, we examined Vp1::GUS-carrying plants to test whether transgene expression could be observed in stressed vegetative tissues. Under normal growth conditions, GUS activity was hardly detectable in transverse sections of Vp1::GUS transgenic stems (Fig. 3A ). However, GUS activity was readily detected in the vascular tissues of stem and leaf segments that had been desiccated by 6 h of air drying (Fig. 3B) or treated with 0.6 M Suc (Fig. 3C). We then examined transgene expression in different tissues and found that, upon desiccation or drought stress, GUS activity was detected in the vascular tissues of all aerial stems, including ear pedicels (Fig. 3D). Stress-induced Vp1 expression in vascular tissues was restricted to phloem companion cells (Fig. 3, D–G). Expression of Vp1 in phloem cells was further confirmed by in situ hybridization of endogenous Vp1 mRNA in transverse sections of mature stems (Fig. 3, F and G). Vp1::GUS expression was also detected in germinating seeds, but, in established plants, no expression was observed in roots, shoot apical meristems, or floral organs (data not shown).
Nuclear Proteins Interact with Elements of the Vp1 Promoter Containing ABRC1 Sequence analysis showed that the Vp1 promoter contains a conserved 8-bp element with the sequence GCCACGTG, which is predicted to be an ABRE. To test whether this fragment is a nuclear protein-binding site, a 29-bp oligonucleotide containing the putative ABRE was synthesized as a probe for an electrophoretic mobility shift assay (EMSA) experiment. A major slowly migrating band was observed using nuclear protein extract from 20-DAP embryos, indicating that the oligonucleotide had bound nuclear proteins (Fig. 4A ). An unlabeled fragment outcompeted the retarded band, whereas an unrelated DNA fragment (VPO4) or poly(dI-dC) could not, indicating that binding was specific (Fig. 4A; data not shown). To determine which bases are important for binding to the nuclear proteins, serial mutations were synthesized (M1–M7) and used as competitors in an EMSA experiment. The mutations in GTCGCCACGTGTG, which includes the ABRE, impaired the ability to compete with the wild-type probe. The CGT to AAG mutation in M3 completely abolished the competition capacity (Fig. 4, C and D), and radioactively labeled M3 did not produce a shifted band (data not shown). Thus, the putative 8-bp ABRE appears necessary for in vitro binding to nuclear proteins from developing embryos.
Because Vp1 is expressed in aleurone cells (McCarty et al., 1989 ), the ABRE fragment was also tested for binding to nuclear proteins extracted from 20-DAP aleurone cells. As shown in Figure 4B, EMSA produced two distinct shifted bands of comparable intensity, indicating that this element could bind to nuclear proteins from aleurone. This result differs from that obtained in embryos, where only one major shifted band was observed. This suggests that aleurone cells might contain different, or additional, ABRE-binding factors than embryos.
In natural promoter contexts, ABREs usually function in multiple copies or form ABRCs with CEs (Shen et al., 1993
A previous study showed that maize ZmABI4 bound to CE1 from a number of ABA-related genes (Niu et al., 2002 ). An A to T substitution in CCACC completely abolished the binding by ZmABI4. To determine the critical binding sites of the CE1 in maize Vp1, scanning mutagenesis was conducted and substituted versions of CE1 (CE1M1–CE1M8) were used as competitors in an EMSA. Surprisingly, a similar A to T (data not shown) or A to C substitution (CE1M4) competed with the probe, indicating that the oligo was still capable of protein binding, although the reduced competition compared to wild type suggests that protein binding was impaired (Fig. 5, B and C). Similarly, CE1M3, which mutates the first two bases of the CCACC core, partially competed with the probe. Thus, it appears that the CCACC motif is not essential for CE1 binding to nuclear proteins. Rather, because other substitutions of CE1 failed to outcompete the probe, it appears that nucleotides outside this motif are more important for protein binding. Taken together, the CE1-like element of maize Vp1 does not appear to have the same binding activity as other previously described CE1s.
To further explore the possible basis for ABA or osmotic stress regulation of Vp1 expression, an EMSA experiment was performed using an ABRE probe on nuclear protein extracts from treated or untreated 20-DAP embryos. As shown in Figure 6 , 20 h of culture in hormone-free medium greatly reduced the binding capacity of the extract, compared with extract from freshly harvested embryos. Applying 100 µM ABA or 20% mannitol in the medium restored the binding capacity comparable to extract of embryos from intact seeds. This result is consistent with the ABRE contributing to the regulation of Vp1 expression by ABA or osmotic stress. A similar EMSA experiment was performed on CE1, but no difference in binding was observed among the treatments (data not shown).
Feedback Regulation of Vp1 Expression
VP1 functions as a transcriptional activator required for the response of many ABA-inducible genes (Suzuki et al., 2003
During late stages of seed development, plant embryos undergo maturation, acquire desiccation tolerance, and achieve quiescence. VP1, along with ABA and other factors, is required for the regulation of these processes in maize. Maize Vp1 is expressed from before 10 DAP to very late in seed development (McCarty et al., 1989 ; Niu et al., 2002). In developing rice embryos, Osvp1 and Osem expression is positively correlated as early as 6 DAP (Miyoshi et al., 2002). Under our growth conditions, maximal Vp1 transcript accumulation was observed around 20 DAP (data not shown). This coincides with the peak in ABA accumulation, although ABA levels subsequently decline while Vp1 transcript levels remain relatively high (McCarty et al., 1989; White et al., 2000; Niu et al., 2002). We placed 20-DAP embryos in culture to examine the physiological regulation of Vp1 expression. Vp1 transcript levels declined by 8 h of hormone-free culture, becoming barely detectable by 48 h. The cultured embryos showed visible signs of germination within 24 h. This inverse correlation between Vp1 expression and germination transition is consistent with the function of VP1 to promote seed dormancy and repress germination (McCarty, 1995). The decrease in Vp1 expression was reversed by exogenous ABA, which also arrests germination. Thus, VP1 mediates and activates ABA induction of maturation-associated gene expression and is itself positively regulated by ABA. A similar result in barley was interpreted as an indirect consequence of germination in hormone-free culture and it was concluded that barley Vp1 was not significantly modulated by ABA (Hollung et al., 1997). However, we showed that application of ABA after 24 h of culture in hormone-free medium rapidly induced Vp1 transcript levels to levels observed with continuous culture in ABA-containing medium. ABA induced Vp1 transcript accumulation at concentrations as low as 0.1 µM, which is considered to be within physiological levels (Walton and Li, 1995). Induction occurred within 1 h and did not require de novo protein synthesis because cycloheximide did not block inducibility by ABA. Cycloheximide alone caused a slight increase in Vp1 expression similar to what has been observed in the barley HVA22 gene, where ABA and cycloheximide have a synergistic effect on expression (Shen et al., 1993). Taken together, these data unambiguously demonstrate that the maize Vp1 transcript is induced by ABA in cultured embryos. The accumulation of Vp1 transcript was also induced in embryos by NaCl, Suc, and mannitol. Whereas it remains possible that Suc might regulate Vp1 expression through either sugar or osmotic signaling, the effect of mannitol on Vp1 expression clearly indicates that an osmotic stimulus is capable of inducing Vp1 expression. Given the normal environment of developing embryos, it is not surprising that osmotic or sugar stimuli could induce a maturation-associated gene.
At this point, it appears likely that regulation of Vp1 by ABA might occur at both the transcriptional and posttranscriptional levels. Endogenous Vp1 transcript levels were clearly and consistently induced by ABA, whereas GUS expression was not induced in embryos carrying the Vp1::GUS transgene. In transient assays, we observed only modest reporter induction by ABA and whether induction was observed was inconsistent from experiment to experiment (data not shown), suggesting that perhaps additional, as yet undefined, factors influence transcriptional regulation. Posttranscriptional and posttranslational regulation has been reported for ABI3 (Zhang et al., 2005
Although ABA and osmoticum are able to induce or maintain Vp1 expression levels, transcript abundance is nonetheless somewhat higher in embryos freshly harvested from intact seeds. This suggests that additional extraembryonic seed factors are involved in promoting Vp1 expression in maize kernels. In tomato (Lycopersicon esculentum), signaling from extraembryonic seed tissues was also reported to regulate LeABI3 transcript levels because expression in isolated embryonic axes was lower than in intact seeds (Bassel et al., 2006
Like sorghum, the maize Vp1 promoter lacks a canonical TATA box (Carrari et al., 2001
In the Arabidopsis ABI3 promoter, there are three open reading frames (ORFs) in the 5' UTR, which negatively regulate ABI3 expression. Removing these ORFs dramatically increased promoter activity and expanded the expression domain to roots (Ng et al., 2004
Because ABREs are present in many ABA-inducible genes, it is not surprising that a predicted ABRE was identified in the Vp1 promoter. EMSA and mutagenesis experiments supported the prediction and further determined that the canonical ABRE core (CCACGTGT) was essential for binding nuclear proteins. Culture in hormone-free medium greatly reduced the binding capacity of the embryo nuclear extract to the ABRE. In contrast, ABA and osmotic stress restored ABRE protein interaction. A similar result was also reported in barley, where ABA, salt, and mannitol increased the protein-binding capacity to an ABRE-containing fragment of Lea B19.1 (Hollung et al., 1997
In natural promoter contexts, ABREs are often associated with CEs to form ABRC complexes, which confer ABA responsiveness (Shen and Ho, 1995
A distance with multiple of 10 bp between CE1 and the ABRE appears to be important for ABRC1 function (Shen et al., 2004
The Vp1::GUS transgenic lines revealed a new expression domain of VP1 upon drought stress because reporter gene expression was detected in vascular cells of vegetative tissues, including stem, leaf, and cob. Reporter expression was localized to phloem companion cells and was verified by in situ hybridization of endogenous Vp1 mRNA. VP1 was believed to have no function in the plant because vp1 mutant plants are not wilty and have normal transpiration rates and ability to retain water in excised leaves (Neill et al., 1987
ABI3 and Vp1 expression have previously been reported in nonseed tissues. Vp1 is expressed in rice suspension-cultured cells (Nakagawa et al., 1996
In barley aleurone, HvVP1 and HvABI5 were necessary to transactivate HvABI5 expression and together regulated ABA-inducible gene expression (Casaretto and Ho, 2003
Plant Materials The B73/W22 hybrid plants used in Vp1 expression studies and transient expression assays were grown in a greenhouse at 28°C under 16-h light, with light supplemented by sodium halide lamps, and 8-h dark. The aleurone cells used in EMSA were collected from field-grown thick* mutants, which contain multiple aleurone layers (P. Becraft and D. McCarty, unpublished data). Pericarp layers of 20-DAP thick* mutant kernels were removed, following by peeling the aleurone cell layers, which were frozen in liquid nitrogen. The embryos used in EMSA were collected from B73/W22 hybrids grown in the field and stored frozen.
Embryos collected from B73/W22 hybrids at 20 DAP were cultured in 50-mm petri dishes with 30-mL liquid Murashige and Skoog medium containing 1% Suc under continuous gentle shaking in the dark. Total RNA was isolated by grinding tissues in liquid nitrogen followed by extraction with TRIzol reagent (Invitrogen) and purified with the RNeasy mini kit (Qiagen) according to the manufacturer's instructions. First-strand cDNA was synthesized using 3 µg total RNA. RT was performed using the SuperScript II first-strand synthesis system for RT-PCR (Invitrogen) with 50 pmol oligo(dT) and 10 pmol gene-specific primer for the maize (Zea mays) 18S ribosomal RNA gene (ZMU42796). PCR was performed using Taq DNA polymerase (Promega) with gene-specific primers: Vp1, CAAGAGCAAGGCAGTGGTTCCAG (forward) and CAAATTTAGCGTCACACAGCGGGTAG (reverse); 18S rRNA, AGCAGCCGCGGTAATTCCAGCTC (forward) and CTGGTGGTGCCCTTCCGTCAATTC (reverse). For Vp1, amplification conditions were 94°C for 2 min followed by 25 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min. For 18S rRNA, amplification conditions were 94°C for 2 min followed by 22 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min. PCR products were run in a 0.8% agarose gel, blotted to Duralon-UV membrane (Stratagene), hybridized with the corresponding gene-specific probes, and autoradiographed.
Total RNA was isolated from 2 g of B73/W22 hybrid embryos at 20 DAP using a hot phenol method (Schmitt et al., 1990
The maize Vp1 promoter sequence was obtained by sequencing a genomic
Transcriptional fusions comprised 958 bp of the Vp1 promoter fused to the maize sh1 intron, GUS, or GFP, with a Nos terminator. Stably transformed maize plants were generated according to Gutierrez-Marcos et al. (2004)
Visualization of GFP reporter gene expression in thin-cut hand sections of maize seeds was achieved using a Zeiss LSM510 META confocal laser-scanning microscope with a 405-nm argon laser. GUS detection in developing seeds was performed as described in Costa et al. (2003)
Nuclear protein extracts were prepared from 20-DAP embryos or aleurone by isolation of nuclei using a glycerol-based method (Dorweiler et al., 2000 The protein-DNA-binding reactions were performed in 25 µL containing 20 ng/100 bp PCR-labeled probes or 0.8 pmol oligonucleotides, 1 µg sonicated pBlueScript II SK (Stratagene), and 10 µg nuclear proteins in 1x binding buffer (10 mM Tris-HCl, pH 7.4, 50 mM NaCl, 2 mM EDTA, 2.5 mM dithiothreitol, 1.25 µg bovine serum albumin, 0.05% [v/v] NP-40, 10% glycerol). The binding reactions were incubated at room temperature for 20 min and separated on a nondenaturing 4.5% polyacrylamide gel. Electrophoresis was carried out at 70 V of constant voltage for 4 h with 0.5x 45 mM Tris-borate, 0.5 mM EDTA, pH 8.0 buffer in a 4°C cold room. Gels were vacuum dried and autoradiographed. In competition assays, nuclear protein extract was incubated with unlabeled oligonucleotides in 1x binding buffer on ice for 10 min prior to adding the radioactive probe and continuing with incubation for a further 20 min at room temperature.
Homozygous vp1 mutant plants were obtained by rescuing vp1 mutant kernels in the greenhouse. A Vp1::GUS transgenic line, heterozygous for the vp1 mutant allele, was crossed to homozygous vp1 mutants to generate ears segregating 1:1 for vp1 mutant kernels. Kernels carrying the Vp1::GUS transgene were identified by staining the crown region of each kernel for GUS activity in the aleurone. The crown was excised and incubated in GUS-staining solution (50 mM sodium phosphate [pH 7.0], 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 10 mM EDTA, 0.05% [v/v] Triton X-100, 0.35 mg mL–1 5-bromo-4-chloro-3-indolyl-
Individual embryos of GUS-positive kernels were homogenized in 250 µL 1x cell culture lysis reagent (Promega) and centrifuged for 10 min at 10,000g at 4°C. Protein concentration was determined using the Bio-Rad protein assay system (Bio-Rad). Fluorometric MUG assays were carried out essentially as described (Kosugi et al., 1990 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number DQ886030.
We thank Becraft lab members and Andrea Eveland for critical reading of the manuscript. Received October 18, 2006; accepted December 19, 2006; published January 5, 2007.
1 This work was supported by the National Research Initiative of the U.S. Department of Agriculture Cooperative State Research, Education and Extension Service (grant no. 2006–01163) and by the National Science Foundation (grant no. 0077676). 
2 These authors contributed equally to the paper. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Philip W. Becraft (becraft{at}iastate.edu).
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.091454 * Corresponding author; e-mail becraft{at}iastate.edu; fax 515–294–6755.
Achard P, Lagrange T, El-Zanaty A-F, Mache R (2003) Architecture and transcriptional activity of the initiator element of the TATA-less RPL21 gene. Plant J 35: 743–752[CrossRef][Web of Science][Medline] Bassel GW, Mullen RT, Bewley JD (2006) ABI3 expression ceases following, but not during, germination of tomato and Arabidopsis seeds. J Exp Bot 57: 1291–1297 Bobb AJ, Eiben HG, Bustos MM (1995) PvAlf, an embryo-specific acidic transcriptional activator enhances gene expression from phaseolin and phytohemagglutinin promoters. Plant J 8: 331–343[CrossRef][Web of Science][Medline] Busk PK, Jensen AB, Pages M (1997) Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize. Plant J 11: 1285–1295[CrossRef][Web of Science][Medline] Busk PK, Pages M (1997) Protein binding to the abscisic acid-responsive element is independent of VIVIPAROUS1 in vivo. Plant Cell 9: 2261–2270[Abstract] Busk PK, Pages M (1998) Regulation of abscisic acid-induced transcription. Plant Mol Biol 37: 425–435[CrossRef][Web of Science][Medline] Carrari F, Frankel N, Lijavetzky D, Benech-Arnold R, Sanchez R, Iusem ND (2001) The TATA-less promoter of VP1, a plant gene controlling seed germination. DNA Seq 12: 107–114[Web of Science][Medline] Casaretto J, Ho TD (2003) The transcription factors HvABI5 and HvVP1 are required for the abscisic acid induction of gene expression in barley aleurone cells. Plant Cell 15: 271–284 Casaretto JA, Ho TD (2005) Transcriptional regulation by abscisic acid in barley (Hordeum vulgare L.) seeds involves autoregulation of the transcription factor HvABI5. Plant Mol Biol 57: 21–34[CrossRef][Web of Science][Medline] Chow G, Knudson W (2005) Characterization of promoter elements of the human HYAL-2 gene. J Biol Chem 280: 26904–26912 Costa LM, Gutierrez-Marcos JF, Brutnell TP, Greenland AJ, Dickinson HG (2003) The globby1-1 (glo1-1) mutation disrupts nuclear and cell division in the developing maize seed causing alterations in endosperm cell fate and tissue differentiation. Development 130: 5009–5017 Dorweiler JE, Carey CC, Kubo KM, Hollick JB, Kermicle JL, Chandler VL (2000) mediator of paramutation1 is required for establishment and maintenance of paramutation at multiple maize loci. Plant Cell 12: 2101–2118 Escobar C, Aristizábal F, Navas A, Campo FFD, Fenoll C (2001) Isolation of active DNA-binding nuclear proteins from tomato galls induced by root-knot nematodes. Plant Mol Biol Rep 19: 375a–375h Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell 14: S15–S45 Finkelstein RR, Lynch TJ (2000) The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 12: 599–609 Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM (1992) Isolation of the Arabidopsis ABI3 gene by positional cloning. Plant Cell 4: 1251–1261 Guan LM, Scandalios JG (2000) Catalase transcript accumulation in response to dehydration and osmotic stress in leaves of maize viviparous mutants. Redox Rep 5: 377–383[CrossRef][Web of Science][Medline] Gubler F, Millar AA, Jacobsen JV (2005) Dormancy release, ABA and pre-harvest sprouting. Curr Opin Plant Biol 8: 183–187[CrossRef][Web of Science][Medline] Guiltinan MJ, Marcotte WR Jr, Quatrano RS (1990) A plant leucine zipper protein that recognizes an abscisic acid response element. Science 250: 267–271 Gutierrez-Marcos JF, Costa LM, Biderre-Petit C, Khbaya B, O'Sullivan DM, Wormald M, Perez P, Dickinson HG (2004) maternally expressed gene1 is a novel maize endosperm transfer cell-specific gene with a maternal parent-of-origin pattern of expression. Plant Cell 16: 1288–1301 Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res 27: 297–300 Hobo T, Asada M, Kowyama Y, Hattori T (1999a) ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent. Plant J 19: 679–689[CrossRef][Web of Science][Medline] Hobo T, Kowyama Y, Hattori T (1999b) A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic acid-induced transcription. Proc Natl Acad Sci USA 96: 15348–15353 Hoecker U, Vasil IK, McCarty DR (1995) Integrated control of seed maturation and germination programs by activator and repressor functions of Viviparous-1 of maize. Genes Dev 9: 2459–2469 Hoecker U, Vasil IK, McCarty DR (1999) Signaling from the embryo conditions Vp1-mediated repression of alpha-amylase genes in the aleurone of developing maize seeds. Plant J 19: 371–377[CrossRef][Web of Science][Medline] Hollung K, Espelund M, Schou K, Jakobsen KS (1997) Developmental, stress and ABA modulation of mRNA levels for bZip transcription factors and Vp1 in barley embryos and embryo-derived suspension cultures. Plant Mol Biol 35: 561–571[CrossRef][Web of Science][Medline] Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj T, Parcy F (2002) bZIP transcription factors in Arabidopsis. Trends Plant Sci 7: 106–111[CrossRef][Web of Science][Medline] Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 3901–3907[Web of Science][Medline] Kagaya Y, Hobo T, Murata M, Ban A, Hattori T (2002) Abscisic acid-induced transcription is mediated by phosphorylation of an abscisic acid response element binding factor, TRAB1. Plant Cell 14: 3177–3189 Kagaya Y, Toyoshima R, Okuda R, Usui H, Yamamoto A, Hattori T (2005) LEAFY COTYLEDON1 controls seed storage protein genes through its regulation of FUSCA3 and ABSCISIC ACID INSENSITIVE3. Plant Cell Physiol 46: 399–406 Kosugi S, Ohashi Y, Nakajima K, Arai Y (1990) An improved assay for Kucera B, Cohn MA, Leubner-Metzger G (2005) Plant hormone interactions during seed dormancy release and germination. Seed Sci Res 15: 281–307[CrossRef] Lopez-Molina L, Mongrand S, Chua NH (2001) A postgermination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in Arabidopsis. Proc Natl Acad Sci USA 98: 4782–4787 Mantovani R (1998) A survey of 178 NF-Y binding CCAAT boxes. Nucleic Acids Res 26: 1135–1143 Marcotte WR Jr, Russell SH, Quatrano RS (1989) Abscisic acid-responsive sequences from the em gene of wheat. Plant Cell 1: 969–976 McCarty DR (1995) Genetic control and integration of maturation and germination pathways in seed development. Annu Rev Plant Physiol Plant Mol Biol 46: 71–93[CrossRef][Web of Science] McCarty DR, Carson CB, Stinard PS, Robertson DS (1989) Molecular analysis of viviparous-1: an abscisic acid-insensitive mutant of maize. Plant Cell 1: 523–532 McCarty DR, Hattori T, Carson CB, Vasil V, Lazar M, Vasil IK (1991) The Viviparous-1 developmental gene of maize encodes a novel transcriptional activator. Cell 66: 895–905[CrossRef][Web of Science][Medline] Miyoshi K, Kagaya Y, Ogawa Y, Nagato Y, Hattori T (2002) Temporal and spatial expression pattern of the OSVP1 and OSEM genes during seed development in rice. Plant Cell Physiol 43: 307–313 Nakagawa H, Ohkura E, Ohmiya K, Hattori T (1996) The seed-specific transcription factor VP1 (OSVP1) is expressed in rice suspension-cultured cells. Plant Cell Physiol 37: 355–362 Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis. Plant Mol Biol 60: 51–68[CrossRef][Web of Science][Medline] Neill SJ, Horgan R, Rees AF (1987) Seed development and vivipary in Zea mays L. Planta 171: 358–364[CrossRef][Web of Science] Ng DW, Chandrasekharan MB, Hall TC (2004) The 5' UTR negatively regulates quantitative and spatial expression from the ABI3 promoter. Plant Mol Biol 54: 25–38[CrossRef][Web of Science][Medline] Nieva C, Busk P, Domínguez-Puigjaner E, Lumbreras V, Testillano P, Risueño M-C, Pagès M (2005) Isolation and functional characterisation of two new bZIP maize regulators of the ABA responsive gene rab28. Plant Mol Biol 58: 899–914[CrossRef][Web of Science][Medline] Niu X, Helentjaris T, Bate NJ (2002) Maize ABI4 binds coupling element1 in abscisic acid and sugar response genes. Plant Cell 14: 2565–2575 Rohde A, Prinsen E, De Rycke R, Engler G, Van Montagu M, Boerjan W (2002) PtABI3 impinges on the growth and differentiation of embryonic leaves during bud set in poplar. Plant Cell 14: 1885–1901 Rohde A, Van Montagu M, Boerjan W (1999) The ABSCISIC ACID-INSENSITIVE 3 (ABI3) gene is expressed during vegetative quiescence processes in Arabidopsis. Plant Cell Environ 22: 261–270[CrossRef] Rojas A, Almoguera C, Jordano J (1999) Transcriptional activation of a heat shock gene promoter in sunflower embryos: synergism between ABI3 and heat shock factors. Plant J 20: 601–610[CrossRef][Web of Science][Medline] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sandelin A, Wasserman WW, Lenhard B (2004) ConSite: web-based prediction of regulatory elements using cross-species comparison. Nucleic Acids Res 32: W249–W252 Schmitt ME, Brown TA, Trumpower BL (1990) A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res 18: 3091–3092 Shen Q, Ho TH (1995) Functional dissection of an abscisic acid (ABA)-inducible gene reveals two independent ABA-responsive complexes each containing a G-box and a novel cis-acting element. Plant Cell 7: 295–307[Abstract] Shen Q, Uknes SJ, Ho TH (1993) Hormone response complex in a novel abscisic acid and cycloheximide-inducible barley gene. J Biol Chem 268: 23652–23660 Shen Q, Zhang P, Ho THD (1996) Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley. Plant Cell 8: 1107–1119[Abstract] Shen QJ, Casaretto JA, Zhang P, Ho T-HD (2004) Functional definition of ABA-response complexes: the promoter units necessary and sufficient for ABA induction of gene expression in barley (Hordeum vulgare L.). Plant Mol Biol 54: 111–124[CrossRef][Web of Science][Medline] Singh KB (1998) Transcriptional regulation in plants: the importance of combinatorial control. Plant Physiol 118: 1111–1120 Söderman EM, Brocard IM, Lynch TJ, Finkelstein RR (2000) Regulation and function of the Arabidopsis ABA-insensitive4 gene in seed and abscisic acid response signaling networks. Plant Physiol 124: 1752–1765 Spence J (2001) Plant histology. In C Hawes, B Satiat-Jeunemaitre, eds, Plant Cell Biology: A Practical Approach. Oxford University Press, Oxford, pp 189–206 Suzuki M, Kao CY, Cocciolone S, McCarty DR (2001) Maize VP1 complements Arabidopsis abi3 and confers a novel ABA/auxin interaction in roots. Plant J 28: 409–418[CrossRef][Web of Science][Medline] Suzuki M, Kao CY, McCarty DR (1997) The conserved B3 domain of VIVIPAROUS1 has a cooperative DNA binding activity. Plant Cell 9: 799–807[Abstract] Suzuki M, Ketterling MG, Li Q-B, McCarty DR (2003) Viviparous1 alters global gene expression patterns through regulation of abscisic acid signaling. Plant Physiol 132: 1664–1677 To A, Valon C, Savino G, Guilleminot J, Devic M, Giraudat J, Parcy F (2006) A network of local and redundant gene regulation governs Arabidopsis seed maturation. Plant Cell 18: 1642–1651 Vasil V, Marcotte WR Jr, Rosenkrans L, Cocciolone SM, Vasil IK, Quatrano RS, McCarty DR (1995) Overlap of Viviparous1 (VP1) and abscisic acid response elements in the Em promoter: G-box elements are sufficient but not necessary for VP1 transactivation. Plant Cell 7: 1511–1518[Abstract] Walton DC, Li Y (1995) Abscisic acid biosynthesis and metabolism. In PJ Davies, ed, Plant Hormones: Physiology, Biochemistry and Molecular Biology, Ed 2. Kluwer, Norwell, MA, pp 140–157 West M, Harada JJ (1993) Embryogenesis in higher plants: an overview. Plant Cell 5: 1361–1369 White CN, Proebsting WM, Hedden P, Rivin CJ (2000) Gibberellins and seed development in maize. I. Evidence that gibberellin/abscisic acid balance governs germination versus maturation pathways. Plant Physiol 122: 1081–1088 Yamaguchi-Shinozaki K, Shinozaki K (2005) Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters. Trends Plant Sci 10: 88–94[CrossRef][Web of Science][Medline] Zhang X, Garreton V, Chua N-H (2005) The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes Dev 19: 1532–1543 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
-amylase expression in aleurone cells. Further, this repression was independent of the amino-terminal acidic activation domain, indicating that VP1 also functions as a transcriptional repressor (Hoecker et al., 1995
clone from the W22 inbred line. Osvp1 and Sbvp1 (Carrari et al., 2001
