First published online December 15, 2006; 10.1104/pp.106.093237
Plant Physiology 143:732-744 (2007)
© 2007 American Society of Plant Biologists
OPEN ACCESS ARTICLE
ENVIRONMENTAL STRESS AND ADAPTATION TO STRESS
Nitrogen-Dependent Posttranscriptional Regulation of the Ammonium Transporter AtAMT1;11,[W],[OA]
Lixing Yuan,
Dominique Loqué,
Fanghua Ye,
Wolf B. Frommer and
Nicolaus von Wirén*
Molecular Plant Nutrition, Institute of Plant Nutrition, University of Hohenheim, D70593 Stuttgart, Germany (L.Y., D.L., F.Y., N.v.W.); and Carnegie Institution, Department of Plant Biology, Stanford, California 94305 (D.L., W.B.F.)
 |
ABSTRACT
|
|---|
Ammonium transporter (AMT) proteins of the AMT family mediate the transport of ammonium across plasma membranes. To investigate whether AMTs are regulated at the posttranscriptional level, a gene construct consisting of the cauliflower mosaic virus 35S promoter driving the Arabidopsis (Arabidopsis thaliana) AMT1;1 gene was introduced into tobacco (Nicotiana tabacum). Ectopic expression of AtAMT1;1 in transgenic tobacco lines led to high transcript levels and protein levels at the plasma membrane and translated into an approximately 30% increase in root uptake capacity for 15N-labeled ammonium in hydroponically grown transgenic plants. When ammonium was supplied as the major nitrogen (N) form but at limiting amounts to soil-grown plants, transgenic lines overexpressing AtAMT1;1 did not show enhanced growth or N acquisition relative to wild-type plants. Surprisingly, steady-state transcript levels of AtAMT1;1 accumulated to higher levels in N-deficient roots and shoots of transgenic tobacco plants in spite of expression being controlled by the constitutive 35S promoter. Moreover, steady-state transcript levels were decreased after addition of ammonium or nitrate in N-deficient roots, suggesting a role for N availability in regulating AtAMT1;1 transcript abundance. Nitrogen deficiency-dependent accumulation of AtAMT1;1 mRNA was also observed in 35S:AtAMT1;1-transformed Arabidopsis shoots but not in roots. Evidence for a regulatory role of the 3'-untranslated region of AtAMT1;1 alone in N-dependent transcript accumulation was not found. However, transcript levels of AtAMT1;3 did not accumulate in a N-dependent manner, even though the same T-DNA insertion line atamt1;1-1 was used for 35S:AtAMT1;3 expression. These results show that the accumulation of AtAMT1;1 transcripts is regulated in a N- and organ-dependent manner and suggest mRNA turnover as an additional mechanism for the regulation of AtAMT1;1 in response to the N nutritional status of plants.
Membrane proteins of the AMT1 and AMT2 subfamilies are believed to represent the major pathways for high-affinity ammonium transport in plants (Loqué and von Wirén, 2004 ). When expressed in yeast (Saccharomyces cerevisiae), plant AMT proteins mediate uptake of ammonium and the substrate analog methylammonium (MeA; Gazzarrini et al., 1999 ; Shelden et al., 2001 ). When expressed in oocytes, AMT1 proteins mediate electrogenic uniport of both substrates in the ionic form (Ludewig et al., 2002 , 2003 ; Mayer et al., 2006 ). Because all AMT proteins analyzed so far are located to the plasma membrane (Sohlenkamp et al., 2002 ; Ludewig et al., 2003 ; Simon-Rosin et al., 2003 ; Loqué et al., 2006 ), the AMT transporters are supposed to be responsible for cellular ammonium acquisition as well as for ammonium retrieval, which is required due to passive leakage of ammonia across the membrane (Husted and Schjoerring, 1996 ; Britto et al., 2001 ; Loqué et al., 2005 ). Ammonium influx studies on a T-DNA insertion line in AMT1;1 of Arabidopsis (Arabidopsis thaliana) revealed that in nitrogen (N)-deficient roots, AtAMT1;1 confers approximately 30% of the total ammonium uptake capacity (Kaiser et al., 2002 ; Loqué et al., 2006 ). Another 30% of root ammonium influx could be assigned to AtAMT1;3, and analysis of a double T-DNA insertion line showed that both transporters act in an additive manner under N deficiency (Loqué et al., 2006 ). AMT proteins thus serve as the major transporters for high-affinity ammonium uptake in Arabidopsis roots.
Studies correlating transcript or protein levels with ammonium influx or employing promoter-reporter gene analyses indicated that transcriptional control in response to the N and carbon nutritional status is a major regulatory mechanism for AMTs in plants (Gazzarrini et al., 1999 ; Lejay et al., 2003 ; Loqué et al., 2006 ). However, when N-deficient Arabidopsis plants were resupplied with ammonium, ammonium influx into roots showed a faster time-dependent repression relative to AtAMT1;1 mRNA levels in roots (Rawat et al., 1999 ). In addition to increased ammonium efflux (Kronzucker et al., 2001 ), such a rapid decrease of ammonium uptake capacities in roots might be required to avoid cellular ammonium toxicity (Britto and Kronzucker, 2002 ). Whether this rapid decrease in ammonium uptake capacity is brought about by posttranscriptional or posttranslational control remains an open question.
So far, only a few studies investigated posttranscriptional control of plant nutrient transporters by the substrate or a downstream metabolite. For example, posttranscriptional regulation at the protein level was indicated by analysis of 35S:IRT1 transgenic plants that constitutively expressed IRT1 mRNA but accumulated IRT1 protein only in iron-deficient roots (Connolly et al., 2002 ). In this case, it could even be shown that not only iron itself but also other substrates that are recognized by the transporter trigger a decrease of the IRT1 protein. More recently, it was shown that constitutively expressed green fluorescent protein (GFP)-tagged BOR1 transporter proteins in Arabidopsis roots were degraded upon resupply of boron to plants by a mechanism that involved endocytosis from the plasma membrane and subsequent degradation of the transporter protein (Takano et al., 2005 ).
To analyze whether the AtAMT1;1 ammonium transporter is subject to posttranscriptional control, we uncoupled transcriptional control by ectopically expressing the AtAMT1;1 gene under control of a cauliflower mosaic virus (CaMV) 35S promoter in transgenic tobacco (Nicotiana tabacum) plants. Despite the constitutive expression, AtAMT1;1 transcripts accumulated in a N-dependent manner, indicating posttranscriptional regulation. The same type of mRNA regulation was also observed in shoots of transgenic Arabidopsis lines but not in roots, irrespective of whether a full-length AtAMT1;1 cDNA or its 3'-untranslated region (UTR)-deleted version was expressed. We then investigated mRNA accumulation of AtAMT1;3 in 35S:AtAMT1;3-transformed Arabidopsis lines but found no influence of the N nutritional status on mRNA accumulation. This study thus provides solid evidence that posttranscriptional regulation of AtAMT1 mRNA levels is regulated in dependence of the plant organ, the AMT1 homolog, and the N nutritional status of the plants.
 |
RESULTS
|
|---|
Generation of Transgenic Tobacco Ectopically Expressing AtAMT1;1
Axenically grown tobacco seedlings were used for Agrobacterium tumefaciens-mediated transformation with a construct containing the Arabidopsis ammonium transporter AtAMT1;1 cDNA (Ninnemann et al., 1994 ) cloned in 5'- to 3'-orientation between a CaMV 35S promoter sequence and an OCS terminator sequence (Höfgen and Willmitzer, 1990 ). The cDNA contained 20 bp upstream and 174 bp downstream untranslated sequences with a 44-bp poly(A) tail and conferred ammonium uptake in yeast (Ninnemann et al., 1994 ; Gazzarrini et al., 1999 ). Transgenic plants were selected on medium containing kanamycin, allowed to self-pollinate, and independent, homozygous T2 lines were selected for further analysis. To select for lines with high levels of AtAMT1;1 gene expression, transgenic tobacco seeds were sterilized, germinated on agar, precultured on 2 mM ammonium nitrate, and harvested after culture on N-deficient nutrient solution for 3 d. A DNA fragment of AtAMT1;1 open reading frame (ORF; Loqué et al., 2006 ) not cross-hybridizing with the endogenous tobacco AMTs was used as a probe. Three independent lines (lines 18, 19, and 21) were selected that express AtAMT1;1 mRNA in both roots and shoots (Fig. 1A
). Interestingly, two different AtAMT1;1 mRNAs with an approximate length of 1,700 and 1,900 nucleotides (nt) were detected. Probes specific for the 3'-UTR of AtAMT1;1 and the OCS terminator (3'-OCS) differentiated between the two transcripts, identifying the 1,700-nt transcript as AtAMT1;1 and the 1,900-nt transcript as a read-through AtAMT1;1 mRNA species containing OCS terminator sequences (Supplemental Fig. S1). The high AtAMT1;1 transcript levels in the two transgenic lines 18 and 19 led to accumulation of large amounts of AtAMT1;1 protein, as determined by protein gel-blot analysis using a rabbit antibody targeted against 15 amino acid residues from the loop between the transmembrane-spanning helices 2 and 3 of AtAMT1;1 (Fig. 1B). This serum was specific for the AtAMT1;1 protein and did not detect endogenous tobacco AMTs. Because mRNA and protein levels were lower in line 21, this line was not further considered.

View larger version (57K):
[in this window]
[in a new window]
[as a PowerPoint slide]
|
Figure 1. Ectopic expression of Arabidopsis AtAMT1;1 in transgenic tobacco plants. A, RNA gel-blot analysis of root and shoot RNA from wild-type (WT) and transgenic tobacco plants (lines 18, 19, and 21) using the ORF of AtAMT1;1 as a probe. Detected bands had an apparent length of 1,700 and 1,900 nt. Ethidium bromide-stained rRNA served as loading control. Tobacco plants were precultured for 6 weeks on nutrient solution containing 2 mM ammonium nitrate and harvested after 3 d of growth in the absence of N. B, Protein gel-blot analysis of microsomal membrane fractions from roots and shoots of the same lines as in A using an antibody directed against 15 amino acid residues in the loop between TM2 and TM3 of the AtAMT1;1 protein. The detected protein had an apparent size of approximately 40 kD. Protein levels of DET3 served as loading control.
|
|
To verify proper protein synthesis, protein complex formation, and plasma membrane targeting of the heterologously overexpressed AtAMT1;1 in tobacco, protein gel-blot analysis was conducted employing root microsomal membrane fractions from hydroponically grown plants of the wild type and the line 18. Incubation of protein extracts prior to SDS-PAGE with -mercaptoethanol ( -ME) at 37°C led to detection of a polypeptide with an apparent molecular mass of approximately 40 kD, corresponding to the expected size of the monomer (Fig. 2A
). Although the calculated mass is 53.5 kD, it has been shown previously that AMTs, similar to most other polytopic membrane proteins, show a reduced apparent molecular mass, probably due to incorporation of more SDS compared to soluble proteins (Sauer and Stadler, 1993 ). In nonreducing sample buffer, only a high molecular mass form of AtAMT1;1 was detected at >120 kD, which is in agreement with the formation of an oligomer, as observed for LeAMT1;1 in tomato (Ludewig et al., 2003 ). In a parallel blot, low- and high-Mr protein bands of AtAMT1;1 from microsomal membrane fractions of roots of Arabidopsis wild-type plants appeared at the same positions as in the membrane fractions from tobacco. The absence of a cross-reacting polypeptide in an atamt1;1-1 T-DNA insertion line confirmed that both the monomer and oligomer forms correspond to AtAMT1;1 and thus indicated proper oligomerization also of the overexpressed protein.
To verify plasma membrane localization, root and shoot microsomal membrane fractions (M) of N-deficient plants of line 18 were separated by two-phase partitioning into a plasma membrane-enriched upper fraction (U) and a lower fraction (L) enriched in endosomal membranes (Fig. 2B). Purity of the two fractions was assessed by protein gel-blot analysis using an antibody against the plasma membrane-localized H+-ATPase AtAHA2 (DeWitt et al., 1996 ), vacuolar pyrophosphatase (V-PPase; Takasu et al., 1997 ), or DET3, a subunit of the vacuolar ATPase (Schumacher et al., 1999 ). In agreement with the localization of AtAMT1;1 to the plasma membrane in Arabidopsis (Loqué et al., 2006 ), AtAMT1;1 protein in tobacco was enriched in the plasma membrane fraction of roots and shoots, confirming proper targeting of a large majority of the protein also when expression was driven by the CaMV 35S promoter.
Ectopic Expression of AtAMT1;1 Increases MeA Sensitivity and High-Affinity Ammonium Uptake in Tobacco
To test functionality of the heterologously expressed AtAMT1;1 in tobacco, wild-type plants and the two transgenic lines 18 and 19 were cultured on agar medium supplemented with 2 mM nitrate in the presence of increasing concentrations of MeA. AMTs are known to permeate also the substrate analog MeA, which is toxic to yeast and plants (Gazzarrini et al., 1999 ; Ludewig et al., 2002 , 2003 ; Mayer et al., 2006 ). Both transgenic lines showed enhanced sensitivity to MeA, detectable by increasing chlorosis and growth depression with increasing supply of MeA (Fig. 3A
). Accordingly, shoot dry weight in these lines was 20% to 30% lower compared to wild-type plants when assayed in a range of 5 to 50 mM MeA (Fig. 3B). Shoot biomass production did not differ between the two transgenic lines and the wild type in the absence of MeA.

View larger version (23K):
[in this window]
[in a new window]
[as a PowerPoint slide]
|
Figure 3. Enhanced sensitivity to MeA and increased ammonium uptake capacity in AtAMT1;1-expressing tobacco plants. A, Growth of transgenic tobacco plants (lines 18 and 19) and their corresponding wild type (WT) on agar containing 0 or 20 mM MeA in the presence of 2 mM nitrate. Plants were 32 d old and precultured on half-strength Murashige and Skoog medium for 16 d. B, Shoot dry weights of the same plants as in A grown on agar containing 0, 5, 20, or 50 mM MeA in the presence of 2 mM nitrate. Bars indicate means ± SD (n = 3), and significant differences to the wild type at P < 0.01 are indicated by an asterisk. C, Influx of 15N-labeleled ammonium into roots of wild-type (WT) or transgenic tobacco plants (line 18 and 19). The plants were precultured for 6 weeks on nutrient solution containing 2 mM ammonium nitrate and assayed after 3 d of growth in the presence (+N) or absence (N) of 10 mM ammonium nitrate. 15N-labeled ammonium was supplied at 200 µM. Bars indicated means ± SD (n = 8), and significant differences to the wild type at P < 0.01 are indicated by an asterisk.
|
|
To study potential effects on the uptake capacity, short-term influx studies were conducted using 15N-labeled ammonium and subsequent mass spectrometry. In plants precultured with 10 mM ammonium nitrate, the uptake capacity for ammonium at 200 µM external supply was 27% higher in transgenic tobacco compared to the wild type (Fig. 3C). When plants were precultured under N deficiency for 3 d prior to influx analysis, both wild-type and transgenic plants showed only a small increase in ammonium influx, suggesting that control plants might have experienced latent N deficiency due to the high N demand required to sustain the rapid growth of tobacco plants. Again, both transgenic lines showed approximately 36% higher ammonium uptake capacity. Thus, overexpression of AtAMT1;1 under control of a constitutive CaMV 35S promoter resulted in an enhanced capacity for high-affinity ammonium uptake.
Ectopic Expression of AtAMT1;1 Did Not Increase Ammonium Uptake Efficiency in Soil-Grown Tobacco Plants
The enhanced ammonium uptake capacity of AtAMT1;1-overexpressing tobacco lines as observed in hydroponic culture promised that these lines might also perform better in soil culture when ammonium is supplied at low concentrations and represents the major N source. We therefore chose a silty loam soil (luvisol) low in organic matter, which was supplemented with ammonium sulfate at four fertilization levels. When ammonium concentrations in the soil solution were monitored throughout the whole vegetation period of 56 d, concentrations ranged between 120 and 150 µM at 40 mg g1 and between 1.2 and 4.1 mM at 320 mg g1 ammonium fertilization (data not shown). To avoid nitrification of the ammonium source, the nitrification inhibitor 3,4-dimethylpyrazole phosphate (DMPP) was first mixed with the soil and later added every 2 weeks. Despite this measure, nitrate concentrations in the soil solution ranged from 0.5 to 1 mM during the course of the experiment (data not shown). A comparison of tobacco shoot dry weights from wild-type plants, however, confirmed that, under these experimental conditions, ammonium supply was the major growth-determining factor because shoot dry weights increased from approximately 1 to 4 g plant1 by increasing ammonium supplementation from 40 to 160 mg kg1 but decreased at highest ammonium fertilization (Fig. 4A
). As expected, N deficiency in plants grown under low ammonium supply also expressed in lower chlorophyll and total N concentrations of shoots (Fig. 4, B and C). In contrast, plants grown under 320 mg kg1 ammonium accumulated more N but suffered from growth depression (Fig. 4, A and C), which is highly indicative for ammonium toxicity (Britto and Kronzucker, 2002 ). Most importantly, neither biomass production nor chlorophyll and N concentrations differed between wild-type plants and the transgenic lines 18 and 19. This comparison indicated that overexpression of AtAMT1;1 did not confer any growth advantage under the chosen conditions. An analysis of AtAMT1;1 gene expression in the shoots of the transgenic plants showed that transcript levels were still high but appeared to decrease in plants that were cultured under the highest ammonium fertilization level (Fig. 4D).

View larger version (25K):
[in this window]
[in a new window]
[as a PowerPoint slide]
|
Figure 4. Phenotypic analysis of AtAMT1;1-expressing tobacco plants grown in soil with supply of different ammonium concentrations. A to C, Shoot dry weights (A), chlorophyll concentrations (B), and total N concentrations (C) in 56-d-old transgenic tobacco plants (lines 18 and 19) and their corresponding wild type (WT) grown in a silty loam soil supplemented with 40, 80, 160, or 320 mg kg1 . Bars indicate means ± SD (n = 4), and significant differences at P < 0.001 are indicated by different letters. D, RNA gel-blot analysis of shoot RNA from the same plants as in A, B, or C using the ORF of AtAMT1;1 as a probe. Ethidium bromide-stained rRNA served as loading control.
|
|
Nitrogen-Dependent Regulation of AtAMT1;1 mRNA and Protein Levels in Transgenic Tobacco
As elevated ammonium supply provokes toxicity symptoms in most plants (Britto and Kronzucker, 2002 ), it is expected that AMTs are subject to tight control. To test for posttranscriptional regulation, root and shoot mRNA and protein levels of AtAMT1;1 were compared between N-sufficient and N-deficient tobacco plants from hydroponic culture. While AtAMT1;1 mRNA accumulated to high levels in N-deficient roots of both transgenic lines, mRNA levels were much lower under adequate N supply (Fig. 5A
). A similar dependency of AtAMT1;1 mRNA levels on N supply was also observed in shoots (Fig. 5B), thus confirming the decrease of AtAMT1;1 mRNA as observed in shoots of soil-grown plants (Fig. 4D). A subsequent protein gel-blot analysis of microsomal membrane fractions from the same plants revealed that protein levels showed the same pattern in response to N supply, indicating that the detected mRNA was proportionally translated (Fig. 5).

View larger version (47K):
[in this window]
[in a new window]
[as a PowerPoint slide]
|
Figure 5. Nitrogen-dependent regulation of AtAMT1;1 mRNA and protein levels in transgenic tobacco plants. A, RNA gel-blot analysis of root RNA (top) and protein gel-blot analysis of root microsomal membrane fractions (bottom) from wild-type and transgenic tobacco plants (lines 18 and 19) using the ORF of AtAMT1;1 as a probe and an anti-AtAMT1;1 antibody. Ethidium bromide-stained rRNA and protein levels of DET3 served as loading controls. The plants were precultured for 6 weeks on nutrient solution with 2 mM ammonium nitrate and harvested after 3 d of growth in the presence (+N) or absence (N) of 2 mM ammonium nitrate. B, RNA gel-blot analysis of shoot RNA (top) and protein gel-blot analysis of shoot microsomal membrane fractions (bottom) from the same lines as in A.
|
|
Previous experiments had shown that short-term supply of ammonium or nitrate to N-limited roots can differentially influence transcript levels of individual AMT genes in roots (Lauter et al., 1996 ; Rawat et al., 1999 ). To test whether nitrate or ammonium affect the steady-state mRNA levels, hydroponically grown, N-deficient plants of line 18 were resupplied with 4 mM ammonium or nitrate (Fig. 6
). In response to ammonium AtAMT1;1, mRNA levels responded with a transient increase after 3 h before leveling off (Fig. 6A). In case of nitrate, a steady decline of transcript levels was observed (Fig. 6B). AtAMT1;1 protein levels reflected a repressive effect of either resupplied N form, even though with less consistency over time. A slightly different response to the two N forms at later time points was most likely due to the different translocation and assimilation rates of the two N forms and thus a different time-dependent alleviation of the N nutritional status (Bloom et al., 2002 ; Escobar et al., 2006 ). Taken together, AtAMT1;1 regulation under N resupply was most prominent at the mRNA level, and not only observed during a N-deficiency response lasting over a few days but also at a much shorter time scale in response to ammonium or nitrate resupply.

View larger version (62K):
[in this window]
[in a new window]
[as a PowerPoint slide]
|
Figure 6. Time-dependent regulation of AtAMT1:1 mRNA and protein levels in transgenic tobacco plants following resupply of ammonium or nitrate. A, RNA gel-blot analysis of root RNA (top) and protein gel-blot analysis of root microsomal membrane fractions (bottom) from transgenic tobacco plants (line 18) using the ORF of AtAMT1;1 as a probe and an anti-AtAMT1;1 antibody. Ethidium bromide-stained rRNA and protein levels of DET3 served as loading controls. The plants were precultured for 6 weeks on nutrient solution with 2 mM ammonium nitrate and then deprived of N for 3 d (N) before resupply of 4 mM ammonium or 4 mM nitrate (B) for 3, 6, 9, 12, or 24 h.
|
|
Organ- and Nitrogen-Dependent Regulation of AtAMT1;1 mRNA and Protein Levels in Transgenic Arabidopsis
To determine whether posttranscriptional regulation of AtAMT1;1 was the result of heterologous expression in tobacco or presents a general feature of this gene, we investigated the regulation of AtAMT1;1 in Arabidopsis. The Arabidopsis T-DNA insertion line atamt1;1-1 (Loqué et al., 2006 ), lacking expression of AtAMT1;1, was used for transformation with the AtAMT1;1 cDNA under control of the CaMV 35S promoter, as used for the tobacco transformation (Fig. 1). The atamt1;1-1 insertion line, rather than wild-type Arabidopsis, was used for transformation to circumvent an interaction of endogenously and ectopically expressed AtAMT1;1 mRNA species and thus to provide a more reliable basis for comparison of AtAMT1;1 expression between the two plant species. Two homozygous T2 lines (lines 1b and 2h) overexpressing AtAMT1;1 were selected by segregation analysis on hygromycin and further used for a comparative analysis of gene expression and ammonium influx under varying N supply. While in shoots of N-sufficient wild-type plants AtAMT1;1 was not detected, expression was detected in the two overexpression lines (Fig. 7A
), consistent with the use of a 35S promoter. Under N deficiency, AtAMT1;1 transcript levels remained low in wild-type plants but were further enhanced in both overexpression lines. AtAMT1;1 protein levels of plants followed the same changes as mRNA levels in response to varying N supply. Thus, the regulatory pattern of AtAMT1;1 in Arabidopsis shoots closely resembled that in roots and shoots of transgenic tobacco plants that were transformed with the same AtAMT1;1 cDNA (Fig. 5).

View larger version (25K):
[in this window]
[in a new window]
[as a PowerPoint slide]
|
Figure 7. Nitrogen- and organ-dependent regulation of AtAMT1;1 mRNA and protein levels in transgenic Arabidopsis plants overexpressing AtAMT1;1. A, RNA gel-blot analysis of shoot RNA (top) and protein gel-blot analysis of shoot microsomal membrane fractions (bottom) from the atamt1;1-1 insertion line, its corresponding wild-type Col-glabra (Col-gl), and transgenic Arabidopsis plants (lines 1b and 2h) overexpressing the AtAMT1;1 cDNA in the atamt1;1-1 background. The ORF of AtAMT1;1 served as a probe and the anti-AtAMT1;1 antibody for protein detection. Ethidium bromide-stained rRNA and protein levels of DET3 served as loading controls. The plants were precultured for 6 weeks on nutrient solution with 2 mM ammonium nitrate and harvested after 4 d of growth in the presence (+N) or absence (N) of 2 mM ammonium nitrate. B, RNA gel-blot analysis of root RNA (top) and protein gel-blot analysis of root microsomal membrane fractions (bottom) from the same lines as in A. C, Influx of 15N-labeleled ammonium into roots of the same lines as in A. 15N-labeled ammonium was supplied at 200 µM. Bars indicated means ± SD (n = 810).
|
|
In Arabidopsis roots of both overexpression lines, however, accumulation of AtAMT1;1 transcript levels in response to N differed from that in shoots. Although both transgenic lines had higher mRNA levels compared to wild-type plants when grown under adequate N supply, the mRNA was apparently not proportionally translated into AtAMT1;1 protein because protein levels were lower (Fig. 7B). Under N deficiency, AtAMT1;1 mRNA and protein levels increased in wild-type plants, whereas AtAMT1;1 mRNA levels in the two overexpression lines appeared as diffuse bands of lower size than in wild-type roots. However, more repetitions of this gene expression study showed that AtAMT1;1 mRNA levels in roots varied and could also exceed those in N-deficient wild-type plants (Supplemental Fig. S2). However, in all gel blots from root RNA, AtAMT1;1 transcripts were either detectable as multiple bands of lower size or as diffuse bands, suggesting an enhanced degradation of AtAMT1;1 mRNA under these conditions. Similar as in tobacco, AtAMT1;1 mRNA from Arabidopsis shoot tissue appeared as a double band of the expected size (Fig. 7A; Supplemental Fig. S2). Root AtAMT1;1 protein always accumulated at rather low levels, indicating that AtAMT1;1 transcripts were not proportionally translated into protein (Fig. 7B). A subsequent influx analysis of 15N-labeled ammonium in the same lines indicated no significant contribution of the ectopically expressed protein to overall root ammonium transport capacity under N-deficient but a slight contribution under N-sufficient growth conditions (Fig. 7C). This differential regulation between roots and shoots of AtAMT1;1 mRNA levels in response to N deficiency indicates the existence of an organ- or tissue-specific mechanism for the regulation of AtAMT1;1 transcript levels in Arabidopsis.
The 3'-UTR of AtAMT1;1 Alone Does Not Confer Nitrogen-Dependent Regulation of Transcript Levels
Because recent investigations indicated a role of the 3'-UTR in metabolite control of transcript levels (Chan and Yu, 1998 ; Ortega et al., 2006 ), we deleted the majority of the 3'-UTR of AtAMT1;1, leaving only 23 bp downstream of the stop codon, and assessed N-dependent regulation in two transgenic homozygous Arabidopsis lines (lines 8i and 16k). In shoots of the two transgenic lines, AtAMT1;1 mRNA was abundant under N-sufficient growth conditions and was further enhanced under N deficiency (Fig. 8A
). Protein levels closely reflected N-dependent changes in gene expression. Although these transcript and protein levels were somewhat higher than those in plants overexpressing AtAMT1;1, including its original 3'-UTR (Fig. 7A), a similar N-dependent regulation of AtAMT1;1 was observed. In contrast, mRNA levels in roots of the lines 8i und 16k were low or did not allow following a consistent expression pattern (Fig. 8B). Moreover, root protein levels in the same lines were quite low and did not confer any contribution to ammonium uptake in a 15N-labeled ammonium influx study (data not shown).

View larger version (48K):
[in this window]
[in a new window]
[as a PowerPoint slide]
|
Figure 8. Regulation of AtAMT1;1 mRNA and protein levels in transgenic Arabidopsis plants overexpressing a 3'-UTR-deleted version of AtAMT1;1. A, RNA gel-blot analysis of shoot RNA (top) and protein gel-blot analysis of shoot microsomal membrane fractions (bottom) from the atamt1;1-1 insertion line, its corresponding wild-type Col-gl, and transgenic Arabidopsis plants (lines 8i and 16k) overexpressing AtAMT1;1 cDNA with a 3'-UTR deletion in the atamt1;1-1 background. The ORF of AtAMT1;1 served as a probe and the anti-AtAMT1;1 antibody for protein detection. Ethidium bromide-stained rRNA and protein levels of DET3 served as loading controls. The plants were precultured for 6 weeks on nutrient solution with 2 mM ammonium nitrate and harvested after 4 d of growth in the presence (+N) or absence (N) of 2 mM ammonium nitrate. B, RNA gel-blot analysis of root RNA (top) and protein gel-blot analysis of root microsomal membrane fractions (bottom) from the same lines as in A.
|
|
As an alternative approach to assess a possible regulatory function of the 3'-UTR, we expressed the reporter gene EGFP with or without fusion to the 3'-UTR of AtAMT1;1 (1 kb downstream of the stop codon) under control of the CaMV 35S promoter in transgenic Arabidopsis plants and compared EGFP mRNA levels in response to N deficiency. EGFP transcript levels in roots of 35S:EGFP control lines showed no response to N starvation (Supplemental Fig. S3A); they also did not respond when assessed in shoots (data not shown). This observation confirmed that the 35S promoter construct used in this study was not subject to regulation by the plant N nutritional status. Monitoring EGFP mRNA levels in two 35S:EGFP:3'-UTR-transformed lines confirmed that the N-deficiency treatment did not influence mRNA levels in roots (Supplemental Fig. S3B). Likewise, EGFP mRNA levels in shoots of the same transgenic lines also did not show any significant variation in response to N starvation (Supplemental Fig. S3B). These observations indicated that the 3'-UTR of AtAMT1;1 alone was not able to confer N-dependent regulation of transcript levels of a reporter gene but suggested an involvement of the coding sequence and/or of the 5'-UTR of AtAMT1;1 in N-dependent regulation of AtAMT1;1 mRNA levels.
Posttranscriptional Regulation of mRNA and Protein Levels in Transgenic Arabidopsis Differs between AtAMT1;1 and AtAMT1;3
We finally tackled the question whether AtAMT1;3, which is a close homolog to AtAMT1;1 and highly up-regulated under N deficiency in outer root cells (Loqué et al., 2006 ), might show a similar N-dependent posttranscriptional regulation as AtAMT1;1. For this purpose, a 35S:AtAMT1;3 construct was expressed in the same genetic background of the atamt1;1-1 line (Loqué et al., 2006 ). In roots of the two homozygous lines 10c and 17 d, accumulation of AtAMT1;3 transcript levels was dramatically enhanced relative to those in the atamt1;1-1 plants (Fig. 9
). In roots of atamt1;1-1 plants, AtAMT1;3 transcript levels strongly increased under N deficiency, whereas no further N deficiency-induced increase of AtAMT1;3 mRNA abundance was evident in the two transgenic lines. This was in agreement with results from protein gel-blot analysis confirming high but N-independent expression levels of AtAMT1;3 protein in the two transgenic lines. Relative to atamt1;1-1 plants, these higher mRNA and protein levels also resulted in a significantly increased capacity for ammonium uptake under both N-sufficient and N-deficient conditions (Loqué et al., 2006 ). Thus, in contrast to AtAMT1;1, AtAMT1;3 mRNA was properly overexpressed in Arabidopsis roots and apparently unaffected by N-dependent posttranscriptional regulation in atamt1;1-1.

View larger version (78K):
[in this window]
[in a new window]
[as a PowerPoint slide]
|
Figure 9. Nitrogen-independent accumulation of AtAMT1;3 mRNA and protein in transgenic Arabidopsis plants overexpressing AtAMT1;3. A, RNA gel-blot analysis of root RNA (top) and protein gel-blot analysis of root microsomal membrane fractions (bottom) from the atamt1;1-1 insertion line and transgenic Arabidopsis plants (lines 10c and 17 d) overexpressing an AtAMT1;3 ORF in the atamt1;1-1 background (Loqué et al., 2006 ). The ORF of AtAMT1;3 served as a probe and an anti-AtAMT1;3 antibody for protein detection. Ethidium bromide-stained rRNA and protein levels of DET3 served as loading controls. The plants were precultured for 6 weeks on nutrient solution with 2 mM ammonium nitrate and harvested after 4 d of growth in the presence (+N) or absence (N) of 2 mM ammonium nitrate.
|
|
 |
DISCUSSION
|
|---|
Ectopic Expression of AtAMT1;1 in Tobacco Confers an Enhanced Capacity for Ammonium Uptake But Not Enhanced Nitrogen-Use Efficiency
Heterologous expression of AtAMT1;1 in tobacco resulted in transgenic plants with enhanced capacity for ammonium uptake. The enhanced uptake capacity was observed in both short-term uptake studies conducted within several minutes as well as in long-term growth assays. Using 15N-labeled ammonium in influx measurements showed that 35S:AtAMT1;1 plants had an approximately 30% higher uptake capacity relative to the wild type, irrespective of their N nutritional status (Fig. 3C). A recent analysis of transgenic rice (Oryza sativa) plants overexpressing OsAMT1;1 reported an increased rate of ammonium depletion from the nutrient solution and increased ammonium concentrations in roots and shoots when expressed per unit fresh weight (Hoque et al., 2006 ). These indications for increased ammonium uptake, however, were accompanied by lower biomass production, so that it remained unclear whether roots of these lines really possess an enhanced capacity for ammonium uptake.
A significant contribution of AtAMT1;1 to the overall ammonium uptake capacity in transgenic tobacco was further confirmed by a long-term growth experiment in which transgenic lines developed stronger chlorosis and showed significantly lower biomass production when grown in the presence of MeA (Fig. 3, A and B). MeA has been shown to enter the plant through AMT transporters (Ludewig et al., 2002 , 2003 ). The enhanced MeA sensitivity and ammonium uptake capacity in 35S:AtAMT1;1 plants is in agreement with higher AtAMT1;1 mRNA and protein levels (Fig. 1). Moreover, a similar oligomerization pattern of the ectopically expressed AtAMT1;1 protein in tobacco as in wild-type Arabidopsis plants (Fig. 2A) and the predominant accumulation of the ectopically expressed AtAMT1;1 protein in plasma membrane-enriched membrane fractions (Fig. 2B) demonstrate that the enhanced ammonium uptake capacity is mainly conferred by a larger amount of AtAMT1;1 protein at the root plasma membrane. Taken together, these results indicate that CaMV 35S-driven expression of AtAMT1;1 in transgenic tobacco can be used to increase ammonium uptake capacity via an increased level of AtAMT1;1 transcripts and of properly assembled and targeted protein.
Despite successful overexpression of AtAMT1;1, soil-grown transgenic tobacco plants did not show a better growth performance or enhanced N acquisition when ammonium was supplied as a major but limiting N source (Fig. 4). Because nitrification of ammonium in the soil substrate was strongly repressed by the presence of the nitrification inhibitor DMPP and nitrate concentrations in the soil solution were kept below 1 mM during the whole vegetation period, and because plant growth strongly responded to the absolute amount of added ammonium (Fig. 4A), it could be excluded that ammonium acquisition was circumvented by a significant uptake of nitrate. A lacking additional contribution of ectopically expressed AtAMT1;1 to ammonium acquisition is more likely to have been caused by an unknown posttranslational modification of AtAMT1;1 or an up-regulation of endogenous tobacco AMTs because the ammonium uptake capacity of tobacco was apparently not limiting for ammonium acquisition under the given growth conditions. Based on this experience, we conclude that overexpression of wild-type AMT genes might not represent a promising strategy to increase N uptake efficiency in soil-grown horticultural or crop plants.
AtAMT1;1 Transcript Accumulation Depends on the Nitrogen Nutritional Status and Plant Tissue
With regard to nitrate uptake, overexpression of the high-affinity nitrate transporter NpNRT2;1 in transgenic tobacco led to higher transcript levels and nitrate influx, whereas in the presence of ammonium uptake rates of nitrate were strongly depressed although NpNRT2;1 transcript levels remained high (Fraisier et al., 2000 ). While this study provided clear evidence for posttranscriptional regulation of NpNRT2;1, it remained unclear whether ammonium resupply influenced nitrate uptake rates at the mRNA and/or protein level.
A major finding of this study was that steady-state transcript levels of AtAMT1;1 were apparently influenced by the N nutritional status of the plant (Figs. 5, 6, 7A, and 8A). A recent study by Ortega et al. (2006) showed that CaMV 35S-controlled Gln synthetase transcripts in leaves of transgenic alfalfa (Medicago sativa) plants accumulated in the absence of nitrate but disappeared when plants were fed with nitrate. Other examples for a metabolic regulation of mRNA levels have been reported for sulfur and carbohydrate metabolism. Transcript accumulation of the cystathione- -synthase gene, the gene product of which catalyzes the key step of Met synthesis, is down-regulated in response to Met application (Chiba et al., 1999 ; Suzuki et al., 2001 ). Regulation at the level of transcript turnover has also been observed in the case of -amylase mRNAs that differentially accumulated in response to Suc treatments of rice suspension cells (Sheu et al., 1996 ). Evidence for a metabolic regulation of nutrient transporters in plants at the transcript level has not yet been reported. However, CaMV 35S-driven expression of the Na+/H+ antiporter gene SOS1 conferred accumulation of SOS1 transcripts only in salt-treated plants, suggesting that salt stress also interferes with SOS1 at the posttranscriptional level (Shi et al., 2003 ).
Posttranscriptional regulation of AtAMT1;1 mRNA levels in response to N was not an artifact of ectopic gene expression in a heterologous host plant. In fact, 35S-driven AtAMT1;1 expression was also subject to N-dependent posttranscriptional regulation in Arabidopsis shoots, allowing a higher accumulation of transcripts under N deficiency (Fig. 7A). To our surprise, N-dependent regulation of AtAMT1;1 could not be properly assessed in Arabidopsis roots, because in several independent RNA gel-blot analyses root mRNA was detected either as a diffuse band or as bands of lower size, irrespective of whether a full-length cDNA or its 3'-UTR-deleted version was employed (Supplemental Fig. S2; Figs. 7B and 8B). Therefore, posttranscriptional regulation of AtAMT1;1, as most likely being mediated by mRNA turnover, appeared to be different in Arabidopsis root and shoot organs. To verify whether the same organ-specific difference also applies for tobacco, investigations on transgenic tobacco plants overexpressing the orthologous AMT gene would be required.
Tissue specificity in transgene mRNA accumulation was also observed in other cases. For example, 35S-driven Gln synthetase transcripts accumulated to high levels in leaves but were undetectable in nodules of transgenic alfalfa (Ortega et al., 2001 ). Evidence for a possible mechanism behind cell-specific regulation of mRNA stability has been achieved with the analysis of a downstream (DST) element in the 3'-UTR of small auxin-up RNA (SAUR) transcripts, which can be differentially recognized in transgenic tobacco leaves and in a tobacco BY-2 cell culture (Sullivan and Green, 1996 ). These sequence-specific elements, however, are not found in AtAMT1;1. Nevertheless, tissue specificity of a mechanism controlling mRNA levels might not be surprising with regard to differential expression levels between roots and leaves of genes that are supposed to be involved in mRNA stability. Poly(A)-binding proteins that are promising candidates to confer the exonucleolytic decay of mRNA molecules (Gutiérrez et al., 1999 ) are expressed in an organ-specific manner in Arabidopsis (Belostotsky and Meagher, 1993 ; Hilson et al., 1993 ). Recent investigations on expression levels of a -glucuronidase reporter gene driven by a promoter from a gene involved in the phenylpropanoid metabolism uncovered Arabidopsis mutants in which -glucuronidase expression was differently affected in roots and shoots. In this study, evidence was provided that epigenetic silencing of the ectopically expressed gene was organ specific (Soltani et al., 2006 ). Thus, transgene silencing mechanisms might also be involved in the differential AtAMT1;1 transcript accumulation observed in N-deficient roots and shoots of Arabidopsis (Figs. 7 and 8).
Possible Mechanisms for a Nitrogen-Dependent Regulation of AtAMT1;1 Transcript Levels
Our study suggests that the plant's nutritional status affects the posttranscriptional regulation of nutrient transporters at the level of mRNA abundance, because AtAMT1;1 transcript levels increased under N deficiency in 35S:AtAMT1;1-expressing tobacco plants (Fig. 5) and responded rapidly to short-term addition of ammonium or nitrate to N-deficient roots (Fig. 6). A possible transcriptional regulation of the CaMV 35S-controlled expression by the N nutritional status has been ruled out previously (Crété et al., 1997 ; Ortega et al., 2001 ) and has been confirmed here, because the same promoter did not confer an increase in EGFP transcript levels in response to N deficiency when 35S-EGFP-transformed Arabidopsis plants were assayed (Supplemental Fig. S3A). Thus, N-dependent changes in AtAMT1;1 transcript accumulation as observed in tobacco or in Arabidopsis shoots are a posttranscriptional event, most likely arising from a lower mRNA stability under N sufficiency.
According to Guitérrez et al. (1999), inherent mRNA stability can be caused by specific downstream elements or by AUUUA repeats, both located mainly in the 3'-UTR of transcripts. Such elements, however, were not found in the 3'-UTR of AtAMT1;1. Additionally, the presence of nonsense codons can affect mRNA abundance in a position-dependent manner, and a high A/T content of heterologously expressed genes also appears unfavorable for mRNA stability (Guitérrez et al., 1999). In the case of 35S-controlled Gln synthetase transcripts accumulating in leaves of transgenic alfalfa plants, their 3'-UTR must have been involved in nitrate-dependent mRNA degradation because Gln synthetase transcripts lacking the 3'-UTR remained unaffected by nitrate (Ortega et al., 2006 ). Because the importance of the 3'-UTR in metabolic regulation of transcript levels was also highlighted in other studies (Gil and Green, 1996 ; Chan and Yu, 1998 ), we investigated an involvement of the 3'-UTR of AtAMT1;1 in N-dependent decay of its own transcripts by two approaches. First, ectopic expression of a 3'-UTR-deleted version of AtAMT1;1 neither altered N-dependent regulation of AtAMT1;1 mRNA in shoots nor improved mRNA stability in roots (Fig. 8). Second, when the 3'-UTR of AtAMT1;1 was fused to the reporter EGFP for expression under control of the 35S promoter, a N-dependent regulation of EGFP transcript levels could not be conferred to shoots or roots (Supplemental Fig. S3B). Thus, the 3'-UTR of AtAMT1;1 might not be involved in N-dependent mRNA regulation of its own transcripts. Despite its short length (20 bp), an alternative or additional involvement of the 5'-UTR can also not be neglected. For example, in ferredoxin-1 mRNA, a cis-acting element determining mRNA stability and translation is indeed located in the 5'-UTR and 5'-coding region (Dickey et al., 1998 ), and, likewise, salt stress-dependent accumulation of pyrroline-5-carboxylate reductase mRNA also involves its 5'-UTR (Hua et al., 2001 ).
Nitrogen-dependent posttranscriptional regulation of mRNA levels was different between two closely related AMT genes. While 35S-driven transcript levels of AtAMT1;1 varied with the N nutritional status in Arabidopsis, those of AtAMT1;3 remained unaffected (Figs. 7 and 9). Interestingly, expression of the 35S-AtAMT1;3 construct in the T-DNA insertion line atamt1;3-1 also did not result in a N-dependent regulation of AtAMT1;3 mRNA levels (Loqué et al., 2006 ). As differential posttranscriptional regulation between the two genes was unlikely to be caused by the genetic background of atamt1;1-1, the regulation at the mRNA level probably does not represent a regulatory step common to all AMT transporters but might be specific to certain AMT homologs. Indeed, evidence for a differential posttranscriptional regulation of these two genes is provided by the Arabidopsis small RNA project database (Gustafson et al., 2005 ). While two small RNA target sites have been found in the ORF of AtAMT1;1, none has been identified so far in the other Arabidopsis AMT genes. Small RNAs can behave as regulators for posttranscriptional gene silencing (Vaucheret, 2006 ). Because small RNAs in plants are generally produced from genes distinct from those that they regulate, they might also determine organ- and N-dependent expression, as observed for AtAMT1;1.
Although the precise regulatory mechanism for the N-dependent control of AtAMT1;1 transcript levels remains to be elucidated, this study indicates that plant cells are able to regulate AtAMT1;1 transcripts at the posttranscriptional level in root and shoot organs independently and in a N-dependent and probably gene-specific manner. It is likely that mRNA turnover represents an additional mechanism to adjust the ammonium transport capacity to the actual N demand of the plant. In general, such posttranscriptional control mechanisms can also represent a major obstacle for transgenic approaches aiming at enhancing nutrient acquisition by overexpression of transporter genes under growth conditions in which the gene of interest is usually repressed.
 |
MATERIALS AND METHODS
|
|---|
Gene Constructs and Plant Transformation
Using a NotI restriction site, the DNA fragment carrying the full-length cDNA of AtAMT1;1 (At4g13510; Ninnemann et al., 1994 ) was released from the vector pFL61. The NotI DNA fragment was blunted and then cloned into pBinAR (Höfgen and Willmitzer, 1990 ) using the SmaI restriction site between the CaMV 35S promoter and the OCS-3' terminator sequence. Tobacco (Nicotiana tabacum) cv SNN plants transformed by Agrobacterium tumefaciens were selected via kanamycin resistance, and homozygous T2 lines were further selected by segregation analysis. For the use of the 3'-OCS as a probe, a DNA fragment of 194 bp was amplified from pBinAR-AtAMT1;1 using the primers AR-F (AATGAGATATGCGAGACGCCT) and AR-R (TAGTAGGGTACAATCAGTAAA).
The NotI DNA fragment of AtAMT1;1 cDNA and the EcoRI DNA fragment of the coding sequence of AtAMT1;1 (Loqué et al., 2006 ) carrying a 151-bp deletion in the 3'-UTR of the AtAMT1;1 cDNA were subcloned into pGreen0029 (Hellens et al., 2000 ) between the CaMV 35S promoter and CaMV terminator sequence. The Arabidopsis (Arabidopsis thaliana) atamt1;1-1 insertion line was transformed, and homozygous T2 lines were selected. To use the 3'-UTR of AtAMT1;1 as a probe, a DNA fragment of 258 bp was amplified from ecotype Columbia (Col-0) genomic DNA using the primers 3'-UTR-F (TTTGGATTTTTACTTTTATTCTCTATT) and 3'-UTR-R (CTTAGTCCATGCTTCACATTCCTA).
The coding sequence of EGFP (CLONTECH) was cloned into the binary vector pTKan (kindly provided by Karin Schumacher, ZMBP, Tübingen, Germany) at the ApaI restriction site between the CaMV 35S promoter and rbcs terminator sequence, yielding the plasmid 35S-EGFP. The 1-kb DNA fragment downstream of the AtAMT1;1 ORF stop codon was amplified from genomic DNA (Arabidopsis Col-0) using the primers 3UTR Forward (TTTGGATTTTTACTTTTATTCTCTATT) and 3UTR Reverse (GACTAGTGCTGCCTCATCACTCATGTCA) and cloned into the pGEM-T Easy vector (Promega). Using SacII and SpeI restriction sites, this 1-kb DNA fragment was subcloned behind the EGFP coding sequence in the plasmid 35S-EGFP, resulting in the plasmid 35S-EGFP-3'-UTR. Arabidopsis Col-0 plants were transformed with both constructs, and homozygous T2 lines were selected.
Plant Culture
Tobacco seeds were surface sterilized and geminated on agar medium containing half-strength Murashige and Skoog medium and 1% Suc. After 3 weeks of growth on agar plates, tobacco plants were transferred to full nutrient solution containing 1 mM KH2PO4, 1 mM MgSO4, 250 µM K2SO4, 250 µM CaCl2, 100 µM Na-Fe-EDTA, 50 µM KCl, 50 µM H3BO3, 5 µM MnSO4, 1 µM ZnSO4, 1 µM CuSO4, and 1 µM NaMoO4, pH adjusted to 6.0 with KOH. If not indicated otherwise, 2 mM NH4NO3 was supplied to N-sufficient plants. The nutrient solution was renewed every 2 or 3 d for the following 3 weeks. Plants were grown hydroponically under nonsterile conditions in a growth cabinet under the following conditions: 16 h/8 h light/dark; light intensity 280 µmol m2 s1; temperature 25°C/20°C; and 70% humidity. Arabidopsis plants were cultured hydroponically as described by Loqué et al. (2006) using a 10-h/14-h light/dark and 22°C/18°C growth regime.
For plant culture in soil, tobacco seeds were geminated and precultured for 20 d in 50% peat-based substrate (TKS) and 50% quartz sand in a climate chamber (16 h/8 h light/dark, 23°C/18°C, 60% humidity). Single plants were transferred to 2-L pots containing 2.3 kg of a silty loam soil (C-loess) supplemented with 200 mg kg1 K as K2SO4, 150 mg kg1 phosphorus as Ca(H2PO4)2 x H2O, and 100 mg kg1 magnesium as MgSO4 x 7H2O. (NH4)2SO4 was added as a sole N source at four levels (40, 80, 160, or 320 mg N kg1 soil). To inhibit nitrification, 1% (w/w) DMPP was diluted in water and mixed with the soil at the beginning of the experiment and later added onto the soil surface every 2 weeks. The soil was kept at approximately 50% water holding capacity. The pot experiment was performed in a climate-controlled class 1 greenhouse (16 h/8 h light/dark, 25°C/21°C). Fifty-six-day-old plants were harvested, and shoot dry weights, chlorophyll concentrations, and total N concentrations were measured. N,N-Dimethylformamide was used for extraction and analysis of chlorophyll concentrations, and total N was determined by a Variomax C-N analyzer (Elementar).
RNA Gel-Blot Analysis
Total RNA was extracted using phenol-guanidine followed by lithium chloride precipitation according to Logeman et al. (1987) . Total RNA (30 µg/lane) was separated by electrophoresis on MOPS-formaldehyde agarose gels, blotted onto Hybond-N+ nylon membranes (Amersham), and cross-linked to the membrane by incubation at 80°C for 2 h. A 32P-labeled DNA fragment was used as probe for hybridization, which was performed at 42°C in 50% (v/v) formamide, 1% (w/v) sarcosyl, 5x SSC, and 100 µg mL1 yeast (Saccharomyces cerevisiae) tRNA. Membranes were washed at 42°C twice in 2x SSC, 0.1% (w/v) SDS for 20 min, once in 0.2x SSC, 0.1% (w/v) SDS, and finally in 0.1x SSC, 0.1% (w/v) SDS for 20 min. Ethidium bromide-stained gels were used as RNA loading control.
Isolation of Membrane Fractions
Total microsomal membrane fractions were isolated from tobacco or Arabidopsis root and shoot tissues as described by Loqué et al. (2006) . The fresh plant tissues were homogenized by a blender in a buffer containing 250 mM Tris-HCl, pH 8.5, 290 mM Suc, 25 mM EDTA, 5 mM -ME, 2 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride (PMSF). Homogenates were centrifuged at 10,000g for 15 min. Supernatants were filtered through nylon mesh (58 µM) and centrifuged at 100,000g for 30 min to pellet microsomal membrane fractions. The pellet was resuspended in conservation buffer (5 mM BisTris-propane, MES, pH 6.5, 250 mM sorbitol, 20% [w/v] glycerol, 1 mM dithiothreitol, 2 mM PMSF) and gently homogenized in a potter.
Plasma membranes were enriched by aqueous two-phase partitioning according to Larsson et al. (1987) . A drained microsomal pellet was resuspended in microsomal buffer (5 mM KH2PO4, pH 7.8, 250 mM Suc, 3 mM KCl) and added to 36-g phase partitioning system (final concentration, 6.2% dextran T-500, 6.2% polyethylene glycol 3350, 5 mM KH2PO4, 3 mM KCl, and 250 mM Suc). The two phases were mixed and centrifuged at 1,500g for 5 min. Upper and lower phase were collected and repartitioned twice with fresh buffer. The purified phases were diluted with washing buffer and centrifuged at 100,000g for 60 min to pellet the membranes. The drained pellet was resuspended in conservation buffer and gently homogenized in a potter.
Protein concentrations were determined using Bradford protein assay (Bio-Rad) using bovine serum albumin as a standard.
Protein Gel-Blot Analysis
Proteins (510 µg/lane) were denatured in loading buffer (62.5 mM Tris-HCl, pH 6.8, 10% [v/v] glycerol, 2% [w/v] SDS, 0.01% [w/v] bromphenol blue, 1% PMSF) at 37°C for 30 min with 2.5% (v/v) -ME or without -ME at 0°C, separated on 10% SDS polyacrylamide gels, and transferred to a polyvinylidene fluoride membrane (Immobilon-P; Millipore) by electroblotting. Blots were developed using an ECL Advance Western Blotting Detection kit (Amersham) according to the manufacturer's protocol. Primary antibodies and secondary antibody (peroxidase-conjugated anti-rabbit IgG; Amersham) were diluted in blocking solution at the following concentration combinations: anti-AtAMT1;1 at 1:400 (Loqué et al., 2006 ) with secondary antibody at 1:25,000; anti-AtAMT1;3 at 1:5,000 (Loqué et al., 2006 ); anti-AtAHA2 (DeWitt, et al., 1996 ) at 1:20,000; anti-VPPase (Takasu et al., 1997 ) at 1:2,000; and anti-DET3 (Schumacher et al., 1999 ) at 1:20,000 with the secondary antibody at 1:100,000. MagicMark Western Standard (Invitrogen) was used as Mr marker. Protein blots of DET3, a subunit of the vacuolar ATPase, were used as a control for equal loading.
15N-Ammonium Uptake Analysis
Ammonium influx measurements in plant roots were conducted after rinsing the roots in 1 mM CaSO4 solution for 1 min, followed by an incubation during 6 min in nutrient solution containing 200 µM 15N-labeled (95 atom% 15N) as the sole N source, and finally washed in 1 mM CaSO4 solution. Roots were harvested and stored at 70°C before freeze drying. Each sample was ground, and about 1.5 to 2.5 mg powder was used for 15N determination by isotope ratio mass spectrometry (MAT-DELTAplus; Thermo Finnigan).
Supplemental Data
The following materials are available in the online version of this article. - Supplemental Figure S1. Two transcript species appeared in CaMV 35S-AtAMT1;1-transformed tobacco plants.
- Supplemental Figure S2. Nitrogen-dependent regulation of AtAMT1;1 mRNA in transgenic Arabidopsis plants overexpressing AtAMT1;1 cDNA.
- Supplemental Figure S3. The CaMV 35S promoter and the 3'-UTR of AtAMT1;1 alone do not confer N-dependent accumulation of transcripts.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Olaf Ninnemann, Charité Berlin, for tobacco transformation; Elke Dachtler and Susanne Reiner, University of Hohenheim, for skillful technical support; and Dr. Junpei Takano, University of Tokyo, for help with the experiments. We are grateful to Dr. Karin Schumacher, ZMBP Tübingen, for kindly providing the AHA2 and DET3 antibodies, and to Dr. Masayoshi Maeshima, University of Nagoya, for the VPPase antibody. We also thank Dr. Soichi Kojima, University of Hohenheim, for critically reading the manuscript.
Received November 16, 2006;
accepted December 6, 2006;
published December 15, 2006.
 |
FOOTNOTES
|
|---|
1 This work was supported by the Schwerpunktprogramm 1108 via the Deutsche Forschungsgemeinschaft, Bonn (grant no. WI1728/42 to N.v.W.), by the European Union INTAS program, and by the European Science award of the Koerber Foundation (to W.B.F.). 
The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Nicolaus von Wirén (vonwiren{at}uni-hohenheim.de).
[W] The online version of this article contains Web-only data. 
[OA] Open Access articles can be viewed online without a subscription. 
www.plantphysiol.org/cgi/doi/10.1104/pp.106.093237
* Corresponding author; e-mail vonwiren{at}uni-hohenheim.de; fax 4971145923295.
 |
LITERATURE CITED
|
|---|
Belostotsky D, Meagher RB (1993) Differential organ-specific expression of three poly(A)-binding protein genes from Arabidopsis thaliana. Proc Natl Acad Sci USA 90: 66866690[Abstract/Free Full Text]Bloom AJ, Smart DR, Nguyen DT, Searles PS (2002) Nitrogen assimilation and growth of wheat under elevated carbon dioxide. Proc Natl Acad Sci USA 99: 17301735[Abstract/Free Full Text] Britto DT, Kronzucker HJ (2002) toxicity in higher plants. A critical review. J Plant Physiol 159: 567584[CrossRef][ISI] Britto DT, Siddiqi MY, Glass AD, Kronzucker HJ (2001) Futile transmembrane cycling: a cellular hypothesis to explain ammonium toxicity in plants. Proc Natl Acad Sci USA 98: 42554258[Abstract/Free Full Text] Chan MT, Yu SM (1998) The 3' untranslated region of a rice a-amylase gene functions as a sugar-dependent mRNA stability determinant. Proc Natl Acad Sci USA 95: 65436547[Abstract/Free Full Text] Chiba Y, Ishikawa M, Kijima F, Tyson RH, Kim J, Yamamoto A, Nambara E, Leustek T, Wallsgrove RM, Naito S (1999) Evidence for autoregulation of cystathionine gamma-synthase mRNA stability in Arabidopsis. Science 286: 13711374[Abstract/Free Full Text] Connolly EL, Fett JP, Guerinot ML (2002) Expression of the IRT1 metal transporter is controlled by metals at the levels of transcript and protein accumulation. Plant Cell 14: 13471357[Abstract/Free Full Text] Crété P, Caboche M, Meyer C (1997) Nitrite reductase expression is regulated at the post-transcriptional level by the nitrogen source in Nicotiana plumbaginifolia and Arabidopsis thaliana. Plant J 11: 625634[CrossRef][ISI][Medline] DeWitt ND, Hong BM, Sussman MR, Harper JF (1996) Targeting of two Arabidopsis H+-ATPase isoforms to the plasma membrane. Plant Physiol 112: 833844[Abstract] Dickey LF, Petracek ME, Nguyen TT, Hansen ER, Thompson WF (1998) Light regulation of Fed-1 mRNA requires an element in the 5'-untranslated region and correlates with differential polyribosome association. Plant Cell 10: 475484[Abstract/Free Full Text] Escobar MA, Geisler DA, Rasmusson AG (2006) Reorganization of the alternative pathways of the Arabidopsis respiratory chain by nitrogen supply: opposing effects of ammonium and nitrate. Plant J 45: 775788[CrossRef][ISI][Medline] Fraisier V, Gojon A, Tillard P, Daniel-Vedele F (2000) Constitutive expression of a putative high-affinity nitrate transporter in Nicotiana plumbaginifolia: evidence for post-transcriptional regulation by a reduced nitrogen source. Plant J 23: 110[Medline] Gazzarrini S, Lejay L, Gojon A, Ninnemann O, Frommer WB, von Wirén N (1999) Three functional transporters for constitutive, diurnally regulated, and starvation-induced uptake of ammonium into Arabidopsis roots. Plant Cell 11: 937947[Abstract/Free Full Text] Gil P, Green PJ (1996) Multiple regions of Arabidopsis SAUR-AC1 gene control transcript abundance: the 3'-untranslated region functions as an mRNA instability determinant. EMBO J 15: 16781686[ISI][Medline] Gustafson AM, Allen E, Givan S, Smith D, Carrington JC, Kasschau KD (2005) ASRP: the Arabidopsis small RNA project database. Nucleic Acids Res 33: D637D640[Abstract/Free Full Text] Gutiérrez RA, MacIntosh GC, Green PJ (1999) Current perspectives on mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant Sci 4: 429438[CrossRef] |