| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online December 15, 2006; 10.1104/pp.106.093237 Plant Physiology 143:732-744 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Nitrogen-Dependent Posttranscriptional Regulation of the Ammonium Transporter AtAMT1;11,[W],[OA]Molecular Plant Nutrition, Institute of Plant Nutrition, University of Hohenheim, D–70593 Stuttgart, Germany (L.Y., D.L., F.Y., N.v.W.); and Carnegie Institution, Department of Plant Biology, Stanford, California 94305 (D.L., W.B.F.)
Ammonium transporter (AMT) proteins of the AMT family mediate the transport of ammonium across plasma membranes. To investigate whether AMTs are regulated at the posttranscriptional level, a gene construct consisting of the cauliflower mosaic virus 35S promoter driving the Arabidopsis (Arabidopsis thaliana) AMT1;1 gene was introduced into tobacco (Nicotiana tabacum). Ectopic expression of AtAMT1;1 in transgenic tobacco lines led to high transcript levels and protein levels at the plasma membrane and translated into an approximately 30% increase in root uptake capacity for 15N-labeled ammonium in hydroponically grown transgenic plants. When ammonium was supplied as the major nitrogen (N) form but at limiting amounts to soil-grown plants, transgenic lines overexpressing AtAMT1;1 did not show enhanced growth or N acquisition relative to wild-type plants. Surprisingly, steady-state transcript levels of AtAMT1;1 accumulated to higher levels in N-deficient roots and shoots of transgenic tobacco plants in spite of expression being controlled by the constitutive 35S promoter. Moreover, steady-state transcript levels were decreased after addition of ammonium or nitrate in N-deficient roots, suggesting a role for N availability in regulating AtAMT1;1 transcript abundance. Nitrogen deficiency-dependent accumulation of AtAMT1;1 mRNA was also observed in 35S:AtAMT1;1-transformed Arabidopsis shoots but not in roots. Evidence for a regulatory role of the 3'-untranslated region of AtAMT1;1 alone in N-dependent transcript accumulation was not found. However, transcript levels of AtAMT1;3 did not accumulate in a N-dependent manner, even though the same T-DNA insertion line atamt1;1-1 was used for 35S:AtAMT1;3 expression. These results show that the accumulation of AtAMT1;1 transcripts is regulated in a N- and organ-dependent manner and suggest mRNA turnover as an additional mechanism for the regulation of AtAMT1;1 in response to the N nutritional status of plants.
Membrane proteins of the AMT1 and AMT2 subfamilies are believed to represent the major pathways for high-affinity ammonium transport in plants (Loqué and von Wirén, 2004  ). When expressed in yeast (Saccharomyces cerevisiae), plant AMT proteins mediate uptake of ammonium and the substrate analog methylammonium (MeA; Gazzarrini et al., 1999; Shelden et al., 2001). When expressed in oocytes, AMT1 proteins mediate electrogenic uniport of both substrates in the ionic form (Ludewig et al., 2002, 2003; Mayer et al., 2006). Because all AMT proteins analyzed so far are located to the plasma membrane (Sohlenkamp et al., 2002; Ludewig et al., 2003; Simon-Rosin et al., 2003; Loqué et al., 2006), the AMT transporters are supposed to be responsible for cellular ammonium acquisition as well as for ammonium retrieval, which is required due to passive leakage of ammonia across the membrane (Husted and Schjoerring, 1996; Britto et al., 2001; Loqué et al., 2005). Ammonium influx studies on a T-DNA insertion line in AMT1;1 of Arabidopsis (Arabidopsis thaliana) revealed that in nitrogen (N)-deficient roots, AtAMT1;1 confers approximately 30% of the total ammonium uptake capacity (Kaiser et al., 2002; Loqué et al., 2006). Another 30% of root ammonium influx could be assigned to AtAMT1;3, and analysis of a double T-DNA insertion line showed that both transporters act in an additive manner under N deficiency (Loqué et al., 2006). AMT proteins thus serve as the major transporters for high-affinity ammonium uptake in Arabidopsis roots.
Studies correlating transcript or protein levels with ammonium influx or employing promoter-reporter gene analyses indicated that transcriptional control in response to the N and carbon nutritional status is a major regulatory mechanism for AMTs in plants (Gazzarrini et al., 1999
So far, only a few studies investigated posttranscriptional control of plant nutrient transporters by the substrate or a downstream metabolite. For example, posttranscriptional regulation at the protein level was indicated by analysis of 35S:IRT1 transgenic plants that constitutively expressed IRT1 mRNA but accumulated IRT1 protein only in iron-deficient roots (Connolly et al., 2002 To analyze whether the AtAMT1;1 ammonium transporter is subject to posttranscriptional control, we uncoupled transcriptional control by ectopically expressing the AtAMT1;1 gene under control of a cauliflower mosaic virus (CaMV) 35S promoter in transgenic tobacco (Nicotiana tabacum) plants. Despite the constitutive expression, AtAMT1;1 transcripts accumulated in a N-dependent manner, indicating posttranscriptional regulation. The same type of mRNA regulation was also observed in shoots of transgenic Arabidopsis lines but not in roots, irrespective of whether a full-length AtAMT1;1 cDNA or its 3'-untranslated region (UTR)-deleted version was expressed. We then investigated mRNA accumulation of AtAMT1;3 in 35S:AtAMT1;3-transformed Arabidopsis lines but found no influence of the N nutritional status on mRNA accumulation. This study thus provides solid evidence that posttranscriptional regulation of AtAMT1 mRNA levels is regulated in dependence of the plant organ, the AMT1 homolog, and the N nutritional status of the plants.
Generation of Transgenic Tobacco Ectopically Expressing AtAMT1;1
Axenically grown tobacco seedlings were used for Agrobacterium tumefaciens-mediated transformation with a construct containing the Arabidopsis ammonium transporter AtAMT1;1 cDNA (Ninnemann et al., 1994
To verify proper protein synthesis, protein complex formation, and plasma membrane targeting of the heterologously overexpressed AtAMT1;1 in tobacco, protein gel-blot analysis was conducted employing root microsomal membrane fractions from hydroponically grown plants of the wild type and the line 18. Incubation of protein extracts prior to SDS-PAGE with  -mercaptoethanol (-ME) at 37°C led to detection of a polypeptide with an apparent molecular mass of approximately 40 kD, corresponding to the expected size of the monomer (Fig. 2A
). Although the calculated mass is 53.5 kD, it has been shown previously that AMTs, similar to most other polytopic membrane proteins, show a reduced apparent molecular mass, probably due to incorporation of more SDS compared to soluble proteins (Sauer and Stadler, 1993). In nonreducing sample buffer, only a high molecular mass form of AtAMT1;1 was detected at >120 kD, which is in agreement with the formation of an oligomer, as observed for LeAMT1;1 in tomato (Ludewig et al., 2003). In a parallel blot, low- and high-Mr protein bands of AtAMT1;1 from microsomal membrane fractions of roots of Arabidopsis wild-type plants appeared at the same positions as in the membrane fractions from tobacco. The absence of a cross-reacting polypeptide in an atamt1;1-1 T-DNA insertion line confirmed that both the monomer and oligomer forms correspond to AtAMT1;1 and thus indicated proper oligomerization also of the overexpressed protein.
To verify plasma membrane localization, root and shoot microsomal membrane fractions (M) of N-deficient plants of line 18 were separated by two-phase partitioning into a plasma membrane-enriched upper fraction (U) and a lower fraction (L) enriched in endosomal membranes (Fig. 2B). Purity of the two fractions was assessed by protein gel-blot analysis using an antibody against the plasma membrane-localized H+-ATPase AtAHA2 (DeWitt et al., 1996 ), vacuolar pyrophosphatase (V-PPase; Takasu et al., 1997), or DET3, a subunit of the vacuolar ATPase (Schumacher et al., 1999). In agreement with the localization of AtAMT1;1 to the plasma membrane in Arabidopsis (Loqué et al., 2006), AtAMT1;1 protein in tobacco was enriched in the plasma membrane fraction of roots and shoots, confirming proper targeting of a large majority of the protein also when expression was driven by the CaMV 35S promoter.
To test functionality of the heterologously expressed AtAMT1;1 in tobacco, wild-type plants and the two transgenic lines 18 and 19 were cultured on agar medium supplemented with 2 mM nitrate in the presence of increasing concentrations of MeA. AMTs are known to permeate also the substrate analog MeA, which is toxic to yeast and plants (Gazzarrini et al., 1999
To study potential effects on the uptake capacity, short-term influx studies were conducted using 15N-labeled ammonium and subsequent mass spectrometry. In plants precultured with 10 mM ammonium nitrate, the uptake capacity for ammonium at 200 µM external supply was 27% higher in transgenic tobacco compared to the wild type (Fig. 3C). When plants were precultured under N deficiency for 3 d prior to influx analysis, both wild-type and transgenic plants showed only a small increase in ammonium influx, suggesting that control plants might have experienced latent N deficiency due to the high N demand required to sustain the rapid growth of tobacco plants. Again, both transgenic lines showed approximately 36% higher ammonium uptake capacity. Thus, overexpression of AtAMT1;1 under control of a constitutive CaMV 35S promoter resulted in an enhanced capacity for high-affinity ammonium uptake.
The enhanced ammonium uptake capacity of AtAMT1;1-overexpressing tobacco lines as observed in hydroponic culture promised that these lines might also perform better in soil culture when ammonium is supplied at low concentrations and represents the major N source. We therefore chose a silty loam soil (luvisol) low in organic matter, which was supplemented with ammonium sulfate at four fertilization levels. When ammonium concentrations in the soil solution were monitored throughout the whole vegetation period of 56 d, concentrations ranged between 120 and 150 µM at 40 mg g–1 and between 1.2 and 4.1 mM at 320 mg g–1 ammonium fertilization (data not shown). To avoid nitrification of the ammonium source, the nitrification inhibitor 3,4-dimethylpyrazole phosphate (DMPP) was first mixed with the soil and later added every 2 weeks. Despite this measure, nitrate concentrations in the soil solution ranged from 0.5 to 1 mM during the course of the experiment (data not shown). A comparison of tobacco shoot dry weights from wild-type plants, however, confirmed that, under these experimental conditions, ammonium supply was the major growth-determining factor because shoot dry weights increased from approximately 1 to 4 g plant–1 by increasing ammonium supplementation from 40 to 160 mg kg–1 but decreased at highest ammonium fertilization (Fig. 4A
). As expected, N deficiency in plants grown under low ammonium supply also expressed in lower chlorophyll and total N concentrations of shoots (Fig. 4, B and C). In contrast, plants grown under 320 mg kg–1 ammonium accumulated more N but suffered from growth depression (Fig. 4, A and C), which is highly indicative for ammonium toxicity (Britto and Kronzucker, 2002
Nitrogen-Dependent Regulation of AtAMT1;1 mRNA and Protein Levels in Transgenic Tobacco
As elevated ammonium supply provokes toxicity symptoms in most plants (Britto and Kronzucker, 2002
Previous experiments had shown that short-term supply of ammonium or nitrate to N-limited roots can differentially influence transcript levels of individual AMT genes in roots (Lauter et al., 1996 ; Rawat et al., 1999). To test whether nitrate or ammonium affect the steady-state mRNA levels, hydroponically grown, N-deficient plants of line 18 were resupplied with 4 mM ammonium or nitrate (Fig. 6
). In response to ammonium AtAMT1;1, mRNA levels responded with a transient increase after 3 h before leveling off (Fig. 6A). In case of nitrate, a steady decline of transcript levels was observed (Fig. 6B). AtAMT1;1 protein levels reflected a repressive effect of either resupplied N form, even though with less consistency over time. A slightly different response to the two N forms at later time points was most likely due to the different translocation and assimilation rates of the two N forms and thus a different time-dependent alleviation of the N nutritional status (Bloom et al., 2002; Escobar et al., 2006). Taken together, AtAMT1;1 regulation under N resupply was most prominent at the mRNA level, and not only observed during a N-deficiency response lasting over a few days but also at a much shorter time scale in response to ammonium or nitrate resupply.
Organ- and Nitrogen-Dependent Regulation of AtAMT1;1 mRNA and Protein Levels in Transgenic Arabidopsis
To determine whether posttranscriptional regulation of AtAMT1;1 was the result of heterologous expression in tobacco or presents a general feature of this gene, we investigated the regulation of AtAMT1;1 in Arabidopsis. The Arabidopsis T-DNA insertion line atamt1;1-1 (Loqué et al., 2006
In Arabidopsis roots of both overexpression lines, however, accumulation of AtAMT1;1 transcript levels in response to N differed from that in shoots. Although both transgenic lines had higher mRNA levels compared to wild-type plants when grown under adequate N supply, the mRNA was apparently not proportionally translated into AtAMT1;1 protein because protein levels were lower (Fig. 7B). Under N deficiency, AtAMT1;1 mRNA and protein levels increased in wild-type plants, whereas AtAMT1;1 mRNA levels in the two overexpression lines appeared as diffuse bands of lower size than in wild-type roots. However, more repetitions of this gene expression study showed that AtAMT1;1 mRNA levels in roots varied and could also exceed those in N-deficient wild-type plants (Supplemental Fig. S2). However, in all gel blots from root RNA, AtAMT1;1 transcripts were either detectable as multiple bands of lower size or as diffuse bands, suggesting an enhanced degradation of AtAMT1;1 mRNA under these conditions. Similar as in tobacco, AtAMT1;1 mRNA from Arabidopsis shoot tissue appeared as a double band of the expected size (Fig. 7A; Supplemental Fig. S2). Root AtAMT1;1 protein always accumulated at rather low levels, indicating that AtAMT1;1 transcripts were not proportionally translated into protein (Fig. 7B). A subsequent influx analysis of 15N-labeled ammonium in the same lines indicated no significant contribution of the ectopically expressed protein to overall root ammonium transport capacity under N-deficient but a slight contribution under N-sufficient growth conditions (Fig. 7C). This differential regulation between roots and shoots of AtAMT1;1 mRNA levels in response to N deficiency indicates the existence of an organ- or tissue-specific mechanism for the regulation of AtAMT1;1 transcript levels in Arabidopsis.
Because recent investigations indicated a role of the 3'-UTR in metabolite control of transcript levels (Chan and Yu, 1998
As an alternative approach to assess a possible regulatory function of the 3'-UTR, we expressed the reporter gene EGFP with or without fusion to the 3'-UTR of AtAMT1;1 (1 kb downstream of the stop codon) under control of the CaMV 35S promoter in transgenic Arabidopsis plants and compared EGFP mRNA levels in response to N deficiency. EGFP transcript levels in roots of 35S:EGFP control lines showed no response to N starvation (Supplemental Fig. S3A); they also did not respond when assessed in shoots (data not shown). This observation confirmed that the 35S promoter construct used in this study was not subject to regulation by the plant N nutritional status. Monitoring EGFP mRNA levels in two 35S:EGFP:3'-UTR-transformed lines confirmed that the N-deficiency treatment did not influence mRNA levels in roots (Supplemental Fig. S3B). Likewise, EGFP mRNA levels in shoots of the same transgenic lines also did not show any significant variation in response to N starvation (Supplemental Fig. S3B). These observations indicated that the 3'-UTR of AtAMT1;1 alone was not able to confer N-dependent regulation of transcript levels of a reporter gene but suggested an involvement of the coding sequence and/or of the 5'-UTR of AtAMT1;1 in N-dependent regulation of AtAMT1;1 mRNA levels.
We finally tackled the question whether AtAMT1;3, which is a close homolog to AtAMT1;1 and highly up-regulated under N deficiency in outer root cells (Loqué et al., 2006
Ectopic Expression of AtAMT1;1 in Tobacco Confers an Enhanced Capacity for Ammonium Uptake But Not Enhanced Nitrogen-Use Efficiency
Heterologous expression of AtAMT1;1 in tobacco resulted in transgenic plants with enhanced capacity for ammonium uptake. The enhanced uptake capacity was observed in both short-term uptake studies conducted within several minutes as well as in long-term growth assays. Using 15N-labeled ammonium in influx measurements showed that 35S:AtAMT1;1 plants had an approximately 30% higher uptake capacity relative to the wild type, irrespective of their N nutritional status (Fig. 3C). A recent analysis of transgenic rice (Oryza sativa) plants overexpressing OsAMT1;1 reported an increased rate of ammonium depletion from the nutrient solution and increased ammonium concentrations in roots and shoots when expressed per unit fresh weight (Hoque et al., 2006
A significant contribution of AtAMT1;1 to the overall ammonium uptake capacity in transgenic tobacco was further confirmed by a long-term growth experiment in which transgenic lines developed stronger chlorosis and showed significantly lower biomass production when grown in the presence of MeA (Fig. 3, A and B). MeA has been shown to enter the plant through AMT transporters (Ludewig et al., 2002 Despite successful overexpression of AtAMT1;1, soil-grown transgenic tobacco plants did not show a better growth performance or enhanced N acquisition when ammonium was supplied as a major but limiting N source (Fig. 4). Because nitrification of ammonium in the soil substrate was strongly repressed by the presence of the nitrification inhibitor DMPP and nitrate concentrations in the soil solution were kept below 1 mM during the whole vegetation period, and because plant growth strongly responded to the absolute amount of added ammonium (Fig. 4A), it could be excluded that ammonium acquisition was circumvented by a significant uptake of nitrate. A lacking additional contribution of ectopically expressed AtAMT1;1 to ammonium acquisition is more likely to have been caused by an unknown posttranslational modification of AtAMT1;1 or an up-regulation of endogenous tobacco AMTs because the ammonium uptake capacity of tobacco was apparently not limiting for ammonium acquisition under the given growth conditions. Based on this experience, we conclude that overexpression of wild-type AMT genes might not represent a promising strategy to increase N uptake efficiency in soil-grown horticultural or crop plants.
With regard to nitrate uptake, overexpression of the high-affinity nitrate transporter NpNRT2;1 in transgenic tobacco led to higher transcript levels and nitrate influx, whereas in the presence of ammonium uptake rates of nitrate were strongly depressed although NpNRT2;1 transcript levels remained high (Fraisier et al., 2000
A major finding of this study was that steady-state transcript levels of AtAMT1;1 were apparently influenced by the N nutritional status of the plant (Figs. 5, 6, 7A, and 8A). A recent study by Ortega et al. (2006) Posttranscriptional regulation of AtAMT1;1 mRNA levels in response to N was not an artifact of ectopic gene expression in a heterologous host plant. In fact, 35S-driven AtAMT1;1 expression was also subject to N-dependent posttranscriptional regulation in Arabidopsis shoots, allowing a higher accumulation of transcripts under N deficiency (Fig. 7A). To our surprise, N-dependent regulation of AtAMT1;1 could not be properly assessed in Arabidopsis roots, because in several independent RNA gel-blot analyses root mRNA was detected either as a diffuse band or as bands of lower size, irrespective of whether a full-length cDNA or its 3'-UTR-deleted version was employed (Supplemental Fig. S2; Figs. 7B and 8B). Therefore, posttranscriptional regulation of AtAMT1;1, as most likely being mediated by mRNA turnover, appeared to be different in Arabidopsis root and shoot organs. To verify whether the same organ-specific difference also applies for tobacco, investigations on transgenic tobacco plants overexpressing the orthologous AMT gene would be required.
Tissue specificity in transgene mRNA accumulation was also observed in other cases. For example, 35S-driven Gln synthetase transcripts accumulated to high levels in leaves but were undetectable in nodules of transgenic alfalfa (Ortega et al., 2001
Our study suggests that the plant's nutritional status affects the posttranscriptional regulation of nutrient transporters at the level of mRNA abundance, because AtAMT1;1 transcript levels increased under N deficiency in 35S:AtAMT1;1-expressing tobacco plants (Fig. 5) and responded rapidly to short-term addition of ammonium or nitrate to N-deficient roots (Fig. 6). A possible transcriptional regulation of the CaMV 35S-controlled expression by the N nutritional status has been ruled out previously (Crété et al., 1997
According to Guitérrez et al. (1999), inherent mRNA stability can be caused by specific downstream elements or by AUUUA repeats, both located mainly in the 3'-UTR of transcripts. Such elements, however, were not found in the 3'-UTR of AtAMT1;1. Additionally, the presence of nonsense codons can affect mRNA abundance in a position-dependent manner, and a high A/T content of heterologously expressed genes also appears unfavorable for mRNA stability (Guitérrez et al., 1999). In the case of 35S-controlled Gln synthetase transcripts accumulating in leaves of transgenic alfalfa plants, their 3'-UTR must have been involved in nitrate-dependent mRNA degradation because Gln synthetase transcripts lacking the 3'-UTR remained unaffected by nitrate (Ortega et al., 2006
Nitrogen-dependent posttranscriptional regulation of mRNA levels was different between two closely related AMT genes. While 35S-driven transcript levels of AtAMT1;1 varied with the N nutritional status in Arabidopsis, those of AtAMT1;3 remained unaffected (Figs. 7 and 9). Interestingly, expression of the 35S-AtAMT1;3 construct in the T-DNA insertion line atamt1;3-1 also did not result in a N-dependent regulation of AtAMT1;3 mRNA levels (Loqué et al., 2006 Although the precise regulatory mechanism for the N-dependent control of AtAMT1;1 transcript levels remains to be elucidated, this study indicates that plant cells are able to regulate AtAMT1;1 transcripts at the posttranscriptional level in root and shoot organs independently and in a N-dependent and probably gene-specific manner. It is likely that mRNA turnover represents an additional mechanism to adjust the ammonium transport capacity to the actual N demand of the plant. In general, such posttranscriptional control mechanisms can also represent a major obstacle for transgenic approaches aiming at enhancing nutrient acquisition by overexpression of transporter genes under growth conditions in which the gene of interest is usually repressed.
Gene Constructs and Plant Transformation
Using a NotI restriction site, the DNA fragment carrying the full-length cDNA of AtAMT1;1 (At4g13510; Ninnemann et al., 1994
The NotI DNA fragment of AtAMT1;1 cDNA and the EcoRI DNA fragment of the coding sequence of AtAMT1;1 (Loqué et al., 2006 The coding sequence of EGFP (CLONTECH) was cloned into the binary vector pTKan (kindly provided by Karin Schumacher, ZMBP, Tübingen, Germany) at the ApaI restriction site between the CaMV 35S promoter and rbcs terminator sequence, yielding the plasmid 35S-EGFP. The 1-kb DNA fragment downstream of the AtAMT1;1 ORF stop codon was amplified from genomic DNA (Arabidopsis Col-0) using the primers 3UTR Forward (TTTGGATTTTTACTTTTATTCTCTATT) and 3UTR Reverse (GACTAGTGCTGCCTCATCACTCATGTCA) and cloned into the pGEM-T Easy vector (Promega). Using SacII and SpeI restriction sites, this 1-kb DNA fragment was subcloned behind the EGFP coding sequence in the plasmid 35S-EGFP, resulting in the plasmid 35S-EGFP-3'-UTR. Arabidopsis Col-0 plants were transformed with both constructs, and homozygous T2 lines were selected.
Tobacco seeds were surface sterilized and geminated on agar medium containing half-strength Murashige and Skoog medium and 1% Suc. After 3 weeks of growth on agar plates, tobacco plants were transferred to full nutrient solution containing 1 mM KH2PO4, 1 mM MgSO4, 250 µM K2SO4, 250 µM CaCl2, 100 µM Na-Fe-EDTA, 50 µM KCl, 50 µM H3BO3, 5 µM MnSO4, 1 µM ZnSO4, 1 µM CuSO4, and 1 µM NaMoO4, pH adjusted to 6.0 with KOH. If not indicated otherwise, 2 mM NH4NO3 was supplied to N-sufficient plants. The nutrient solution was renewed every 2 or 3 d for the following 3 weeks. Plants were grown hydroponically under nonsterile conditions in a growth cabinet under the following conditions: 16 h/8 h light/dark; light intensity 280 µmol m–2 s–1; temperature 25°C/20°C; and 70% humidity. Arabidopsis plants were cultured hydroponically as described by Loqué et al. (2006) For plant culture in soil, tobacco seeds were geminated and precultured for 20 d in 50% peat-based substrate (TKS) and 50% quartz sand in a climate chamber (16 h/8 h light/dark, 23°C/18°C, 60% humidity). Single plants were transferred to 2-L pots containing 2.3 kg of a silty loam soil (C-loess) supplemented with 200 mg kg–1 K as K2SO4, 150 mg kg–1 phosphorus as Ca(H2PO4)2 x H2O, and 100 mg kg–1 magnesium as MgSO4 x 7H2O. (NH4)2SO4 was added as a sole N source at four levels (40, 80, 160, or 320 mg N kg–1 soil). To inhibit nitrification, 1% (w/w) DMPP was diluted in water and mixed with the soil at the beginning of the experiment and later added onto the soil surface every 2 weeks. The soil was kept at approximately 50% water holding capacity. The pot experiment was performed in a climate-controlled class 1 greenhouse (16 h/8 h light/dark, 25°C/21°C). Fifty-six-day-old plants were harvested, and shoot dry weights, chlorophyll concentrations, and total N concentrations were measured. N,N-Dimethylformamide was used for extraction and analysis of chlorophyll concentrations, and total N was determined by a Variomax C-N analyzer (Elementar).
Total RNA was extracted using phenol-guanidine followed by lithium chloride precipitation according to Logeman et al. (1987)
Total microsomal membrane fractions were isolated from tobacco or Arabidopsis root and shoot tissues as described by Loqué et al. (2006)
Plasma membranes were enriched by aqueous two-phase partitioning according to Larsson et al. (1987) Protein concentrations were determined using Bradford protein assay (Bio-Rad) using bovine serum albumin as a standard.
Proteins (5–10 µg/lane) were denatured in loading buffer (62.5 mM Tris-HCl, pH 6.8, 10% [v/v] glycerol, 2% [w/v] SDS, 0.01% [w/v] bromphenol blue, 1% PMSF) at 37°C for 30 min with 2.5% (v/v)
Ammonium influx measurements in plant roots were conducted after rinsing the roots in 1 mM CaSO4 solution for 1 min, followed by an incubation during 6 min in nutrient solution containing 200 µM 15N-labeled
The following materials are available in the online version of this article.
We thank Dr. Olaf Ninnemann, Charité Berlin, for tobacco transformation; Elke Dachtler and Susanne Reiner, University of Hohenheim, for skillful technical support; and Dr. Junpei Takano, University of Tokyo, for help with the experiments. We are grateful to Dr. Karin Schumacher, ZMBP Tübingen, for kindly providing the AHA2 and DET3 antibodies, and to Dr. Masayoshi Maeshima, University of Nagoya, for the VPPase antibody. We also thank Dr. Soichi Kojima, University of Hohenheim, for critically reading the manuscript. Received November 16, 2006; accepted December 6, 2006; published December 15, 2006.
1 This work was supported by the Schwerpunktprogramm 1108 via the Deutsche Forschungsgemeinschaft, Bonn (grant no. WI1728/4–2 to N.v.W.), by the European Union INTAS program, and by the European Science award of the Koerber Foundation (to W.B.F.).  The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Nicolaus von Wirén (vonwiren{at}uni-hohenheim.de).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.093237 * Corresponding author; e-mail vonwiren{at}uni-hohenheim.de; fax 49–711–45923295.
Belostotsky D, Meagher RB (1993) Differential organ-specific expression of three poly(A)-binding protein genes from Arabidopsis thaliana. Proc Natl Acad Sci USA 90: 6686–6690 Bloom AJ, Smart DR, Nguyen DT, Searles PS (2002) Nitrogen assimilation and growth of wheat under elevated carbon dioxide. Proc Natl Acad Sci USA 99: 1730–1735 Britto DT, Kronzucker HJ (2002) Britto DT, Siddiqi MY, Glass AD, Kronzucker HJ (2001) Futile transmembrane Chan MT, Yu SM (1998) The 3' untranslated region of a rice a-amylase gene functions as a sugar-dependent mRNA stability determinant. Proc Natl Acad Sci USA 95: 6543–6547 Chiba Y, Ishikawa M, Kijima F, Tyson RH, Kim J, Yamamoto A, Nambara E, Leustek T, Wallsgrove RM, Naito S (1999) Evidence for autoregulation of cystathionine gamma-synthase mRNA stability in Arabidopsis. Science 286: 1371–1374 Connolly EL, Fett JP, Guerinot ML (2002) Expression of the IRT1 metal transporter is controlled by metals at the levels of transcript and protein accumulation. Plant Cell 14: 1347–1357 Crété P, Caboche M, Meyer C (1997) Nitrite reductase expression is regulated at the post-transcriptional level by the nitrogen source in Nicotiana plumbaginifolia and Arabidopsis thaliana. Plant J 11: 625–634[CrossRef][Web of Science][Medline] DeWitt ND, Hong BM, Sussman MR, Harper JF (1996) Targeting of two Arabidopsis H+-ATPase isoforms to the plasma membrane. Plant Physiol 112: 833–844[Abstract] Dickey LF, Petracek ME, Nguyen TT, Hansen ER, Thompson WF (1998) Light regulation of Fed-1 mRNA requires an element in the 5'-untranslated region and correlates with differential polyribosome association. Plant Cell 10: 475–484 Escobar MA, Geisler DA, Rasmusson AG (2006) Reorganization of the alternative pathways of the Arabidopsis respiratory chain by nitrogen supply: opposing effects of ammonium and nitrate. Plant J 45: 775–788[CrossRef][Web of Science][Medline] Fraisier V, Gojon A, Tillard P, Daniel-Vedele F (2000) Constitutive expression of a putative high-affinity nitrate transporter in Nicotiana plumbaginifolia: evidence for post-transcriptional regulation by a reduced nitrogen source. Plant J 23: 1–10[Medline] Gazzarrini S, Lejay L, Gojon A, Ninnemann O, Frommer WB, von Wirén N (1999) Three functional transporters for constitutive, diurnally regulated, and starvation-induced uptake of ammonium into Arabidopsis roots. Plant Cell 11: 937–947 Gil P, Green PJ (1996) Multiple regions of Arabidopsis SAUR-AC1 gene control transcript abundance: the 3'-untranslated region functions as an mRNA instability determinant. EMBO J 15: 1678–1686[Web of Science][Medline] Gustafson AM, Allen E, Givan S, Smith D, Carrington JC, Kasschau KD (2005) ASRP: the Arabidopsis small RNA project database. Nucleic Acids Res 33: D637–D640 Gutiérrez RA, MacIntosh GC, Green PJ (1999) Current perspectives on mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant Sci 4: 429–438[CrossRef][Web of Science][Medline] Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42: 819–832[CrossRef][Web of Science][Medline] Hilson P, Carroll KL, Masson PH (1993) Molecular characterization of PAB2, a member of the multigene family coding for poly(A)-binding proteins in Arabidopsis thaliana. Plant Physiol 103: 525–533[Abstract] Höfgen R, Willmitzer L (1990) Biochemical and genetic analysis of different patatin isoforms expressed in various organs of potato (Solanum tuberosum). Plant Sci 66: 221–230[CrossRef][Web of Science] Hoque MS, Masle J, Udvardi MK, Ryan PR, Upadhyaya NM (2006) Over-expression of the rice OsAMT1-1 gene increases ammonium uptake and content, but impairs growth and development of plants under high ammonium nutrition. Funct Plant Biol 33: 153–163[CrossRef] Hua XJ, van de Cotte B, van Montagu M, Verbruggen N (2001) The 5'-untranslated region of the At-P5R gene is involved in both transcriptional and post-transcriptional regulation. Plant J 26: 157–169[CrossRef][Web of Science][Medline] Husted S, Schjoerring JK (1996) Ammonia flux between oilseed rape plants and the atmosphere in response to changes in leaf temperature, light intensity, and air humidity interactions with leaf conductance and apoplastic ammonium and proton concentrations. Plant Physiol 112: 67–74[Abstract] Kaiser BN, Rawat SR, Siddiqi MY, Masle J, Glass AD (2002) Functional analysis of an Arabidopsis T-DNA "knockout" of the high-affinity Kronzucker HJ, Britto DT, Davenport RJ, Tester M (2001) Ammonium toxicity and the real cost of transport. Trends Plant Sci 6: 335–337[CrossRef][Web of Science][Medline] Larsson C, Widell S, Kjellbom P (1987) Preparation of high-purity plasma membranes. Methods Enzymol 148: 558–568[Web of Science] Lauter FR, Ninnemann O, Bucher M, Riesmeier JW, Frommer WB (1996) Preferential expression of an ammonium transporter and of two putative nitrate transporters in root hairs of tomato. Proc Natl Acad Sci USA 93: 8139–8144 Lejay L, Gansel X, Cerezo M, Tillard P, Muller C, Krapp A, von Wirén N, Daniel-Vedele F, Gojon A (2003) Regulation of root ion transporters by photosynthesis: functional importance and relation with hexokinase. Plant Cell 15: 2218–2232 Logeman J, Shell J, Willmitzer L (1987) Improved method for isolation of RNA from plant tissues. Anal Biochem 163: 16–20[CrossRef][Web of Science][Medline] Loqué D, Ludewig U, Yuan L, von Wirén N (2005) Tonoplast intrinsic proteins AtTIP2;1 and AtTIP2;3 facilitate ammonia transport into the vacuole. Plant Physiol 137: 671–680 Loqué D, von Wirén N (2004) Regulatory levels for the transport of ammonium in plant roots. J Exp Bot 55: 1293–1305 Loqué D, Yuan L, Kojima S, Gojon A, Wirth J, Gazzarrini S, Ishiyama K, Takahashi H, von Wirén N (2006) Additive contribution of AtAMT1;1 and AtAMT1;3 to high-affinity ammonium uptake across the plasma membrane of nitrogen-deficient Arabidopsis roots. Plant J 48: 522–534[CrossRef][Web of Science][Medline] Ludewig U, von Wirén N, Frommer WB (2002) Uniport of Ludewig U, Wilken S, Wu B, Jost W, Obrdlik P, El Bakkoury M, Marini AM, Andre B, Hamacher T, Boles E, et al (2003) Homo- and hetero-oligomerization of ammonium transporter-1 Mayer M, Schaaf G, Mouro I, Lopez C, Colin Y, Neumann P, Cartron JP, Ludewig U (2006) Different transport mechanisms in plant and human AMT/Rh-type ammonium transporters. J Gen Physiol 127: 133–144 Ninnemann O, Jauniaux JC, Frommer WB (1994) Identification of a high affinity Ortega JL, Moguel-Esponda S, Potenza C, Conklin CF, Quintana A, Sengupta-Gopalan C (2006) The 3'-untranslated region of a soybean cytosolic glutamine synthetase (GS(1)) affects transcript stability and protein accumulation in transgenic alfalfa. Plant J 45: 832–846[CrossRef][Web of Science][Medline] Ortega JL, Temple SJ, Sengupta-Gopalan C (2001) Constitutive overexpression of cytosolic glutamine synthetase (GS1) gene in transgenic alfalfa demonstrates that GS1 may be regulated at the level of RNA stability and protein turnover. Plant Physiol 126: 109–121 Rawat SR, Silim SN, Kronzucker HJ, Siddiqi MY, Glass AD (1999) AtAMT1 gene expression and Sauer N, Stadler R (1993) A sink specific H+/monosaccharide cotransporter from Nicotiana tabacum: cloning and heterologous expression in baker's yeast. Plant J 4: 601–610[CrossRef][Web of Science][Medline] Schumacher K, Vafeados D, McCarthy M, Sze H, Wilkins T, Chory J (1999) The Arabidopsis det3 mutant reveals a central role for the vacuolar H+-ATPase in plant growth and development. Genes Dev 13: 3259–3270 Shelden MC, de Bruxelles GL, Whelan J, Ryan PR, Howitt S, Udvardi M (2001) Arabidopsis ammonium transporter, AtAMT1;1 and AtAMT1;2, have different biochemical properties and functional roles. Plant Soil 231: 151–160[CrossRef] Sheu JJ, Yu TS, Tong WF, Yu SM (1996) Carbohydrate starvation stimulates differential expression of rice alpha-amylase genes that is modulated through complicated transcriptional and posttranscriptional processes. J Biol Chem 271: 26998–27004 Shi HZ, Lee BH, Wu SJ, Zhu JK (2003) Overexpression of a plasma membrane Na+/H+ antiporter gene improves salt tolerance in Arabidopsis thaliana. Nat Biotechnol 21: 81–85[CrossRef][Web of Science][Medline] Simon-Rosin U, Wood C, Udvardi M (2003) Molecular and cellular characterisation of LjAMT2;1, an ammonium transporter from the model legume Lotus japonicus. Plant Mol Biol 51: 99–108[CrossRef][Web of Science][Medline] Sohlenkamp C, Wood CC, Roeb GW, Udvardi M (2002) Characterization of Arabidopsis AtAMT2, a high-affinity ammonium transporter of the plasma membrane. Plant Physiol 130: 1788–1796 Soltani BM, Ehlting J, Douglas CJ (2006) Genetic analysis and epigenetic silencing of At4CL1 and At4CL2 expression in transgenic Arabidopsis. Biotechnol J 1: 1124–1136[CrossRef][Medline] Sullivan M, Green P (1996) Mutational analysis of the DST element in tobacco cells and transgenic plants: identification of residues critical for mRNA instability. RNA 2: 308–315[Abstract] Suzuki A, Shirata Y, Ishida H, Chiba Y, Onouchi H, Naito S (2001) The first exon coding region of cystathionine gamma-synthase gene is necessary and sufficient for downregulation of its own mRNA accumulation in transgenic Arabidopsis thaliana. Plant Cell Physiol 42: 1174–1180 Takano J, Miwa K, Yuan L, von Wirén N, Fujiwara T (2005) Endocytosis and degradation of BOR1, a boron transporter of Arabidopsis thaliana, regulated by boron availability. Proc Natl Acad Sci USA 102: 12276–12281 Takasu A, Nakanishi Y, Yamauchi T, Maeshima M (1997) Analysis of the substrate binding site and carboxyl terminal region of vacuolar H+-pyrophosphatase of mung bean with peptide antibodies. J Biochem (Tokyo) 122: 883–889 Vaucheret H (2006) Posttranscriptional small RNA pathways in plants: mechanisms and regulations. Genes Dev 20: 759–771 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
. Bars indicate means ± SD (n = 4), and significant differences at P < 0.001 are indicated by different letters. D, RNA gel-blot analysis of shoot RNA from the same plants as in A, B, or C using the ORF of AtAMT1;1 as a probe. Ethidium bromide-stained rRNA served as loading control.
-synthase gene, the gene product of which catalyzes the key step of Met synthesis, is down-regulated in response to Met application (Chiba et al., 1999
-amylase mRNAs that differentially accumulated in response to Suc treatments of rice suspension cells (Sheu et al., 1996
(95 atom% 15N) as the sole N source, and finally washed in 1 mM CaSO4 solution. Roots were harvested and stored at –70°C before freeze drying. Each sample was ground, and about 1.5 to 2.5 mg powder was used for 15N determination by isotope ratio mass spectrometry (MAT-DELTAplus; Thermo Finnigan). 
