|
|
||||||||
|
First published online December 22, 2006; 10.1104/pp.106.087668 Plant Physiology 143:924-940 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE Transcriptional Profiling of the Arabidopsis Embryo1,[W],[OA]Integrative Cell Biology Laboratory, School of Biological and Biomedical Sciences, Durham University, Durham DH1 3LE, United Kingdom
We have used laser-capture microdissection to isolate RNA from discrete tissues of globular, heart, and torpedo stage embryos of Arabidopsis (Arabidopsis thaliana). This was amplified and analyzed by DNA microarray using the Affymetrix ATH1 GeneChip, representing approximately 22,800 Arabidopsis genes. Cluster analysis showed that spatial differences in gene expression were less significant than temporal differences. Time course analysis reveals the dynamics and complexity of gene expression in both apical and basal domains of the developing embryo, with several classes of synexpressed genes identifiable. The transition from globular to heart stage is associated in particular with an up-regulation of genes involved in cell cycle control, transcriptional regulation, and energetics and metabolism. The transition from heart to torpedo stage is associated with a repression of cell cycle genes and an up-regulation of genes encoding storage proteins, and pathways of cell growth, energy, and metabolism. The torpedo stage embryo shows strong functional differentiation in the root and cotyledon, as inferred from the classes of genes expressed in these tissues. The time course of expression of the essential EMBRYO-DEFECTIVE genes shows that most are expressed at unchanging levels across all stages of embryogenesis. We show how identified genes can be used to generate cell type-specific markers and promoter activities for future application in cell biology.
Embryogenesis represents a critical stage of the sporophytic life cycle, transforming the fertilized egg cell via a precise sequence of events into a multicellular organism (Mayer et al., 1991
Embryogenesis in Arabidopsis (Arabidopsis thaliana) is a continuous process, although for convenience it can be separated into three major phases, described as early, mid, and late. The early phase is one of pattern formation and morphogenesis, during which the axes of the plant body plan are defined and organ systems formed. The mid phase is that of maturation, with a characteristic accumulation of storage reserves. In its late phase, the embryo prepares for developmental arrest. Arabidopsis embryogenesis is rapid, with the early and mid phases completed 11 to 12 d post fertilization and only 14 d to the completion of the late phase and the production of desiccated mature seed (Lindsey and Topping, 1993
Understanding the molecular mechanisms underlying embryogenesis can provide insight into developmental and metabolic regulation and the signaling systems integrating these processes. A great deal of research has been invested into analyzing the genetic control mechanisms, exploiting a range of techniques to isolate genes of importance. The construction and screening of cDNA libraries from isolated RNA (Goldberg et al., 1989
Following the completion of the sequencing of the Arabidopsis genome (The Arabidopsis Genome Initiative, 2000
The use of DNA microarray technology potentially allows a global analysis of the expression of a large proportion of the Arabidopsis genome and has been used to study transcriptional changes in seed development in Arabidopsis. For example, Girke et al. (2000)
In this article, we extend the studies carried out previously on LCM-isolated tissues of globular and heart stage embryos (Casson et al., 2005
The embryonic tissues sampled by LCM for RNA profiling are indicated in Figure 1 . These comprise the apical and basal domains of the globular stage embryo, cotyledonary, and root pole tissues of the heart stage embryo, and cotyledonary, root pole, and shoot apical meristem (SAM) tissues from the torpedo stage embryo following cryosectioning. For each sample, approximately 10 to 15 cells were captured, and samples from approximately 15 embryo sections were pooled, providing approximately 100 to 200 cells for RNA extraction, amplification, and analysis. For illustration, the LCM of a torpedo stage embryo is presented in Figure 2 .
Amplified RNA (aRNA) samples were labeled and analyzed for expression profiles using the Affymetrix ATH1 GeneChip, which contains probes for approximately 22,800 genes of Arabidopsis. The aim was to investigate the changing gene expression patterns through the embryonic time course in both the apical and basal domains. For an additional comparative time point, GeneChip data were utilized from the nonembryonic cotyledon and root tissue of a seedling, 7 d post germination (dpg; Schmid et al., 2005 -glucuronidase (GUS) fusion experiments of candidate genes (Casson et al., 2005
The use of the ATH1 GeneChip allows an estimation to be made of the number of genes that are being expressed in the tissue under analysis and also a comparison to other analyses performed on the same microarray platform. The use of the term estimate refers to the fact that a cutoff point of a minimal Affymetrix signal must be imposed; genes deemed to be expressed are those with a value equal to or greater than this value. The application of a minimal Affymetrix signal value of 75 has been applied to a study of the root transcriptome (Birnbaum et al., 2003 The replicates for each tissue type (torpedo SAM, cotyledon, and root) were collated, and the mean signal values were ranked highest to lowest, thus revealing the number of genes with an equal or greater value than the designated cutoffs (Supplemental Table S10). Using the cutoff value of 75 for the mean value of the replicates analyzed, it was determined that between 8,353 and 11,690 genes (approximately 37%51%) are expressed in the three tissue types of the torpedo stage embryo. If the lower mean signal threshold value of 40 is applied, up to approximately 77% of the genes are deemed to be expressed. A spatial analysis was then performed on genes predicted to be expressed to ascertain what degree of overlap exists between the different tissue types. This analysis is summarized in Figure 3 as a Venn diagram for each cutoff value. The majority of expressed genes are present in all tissue types (60% when using the signal threshold value of 40 and 43% when using the signal threshold value of 75). There are also significant numbers of genes present in single tissue types only (18% when using the signal threshold value of 40 and 29% when using the signal threshold value of 75), suggesting distinct spatial transcriptional profiles are present.
Cluster Analysis of Developmental Stages Cluster analysis of the entire transcriptional profile of roots (basal) and cotyledons (apical) of the globular, heart, torpedo stage embryos and seedlings, and torpedo stage SAM revealed that the transcriptional profiles of the apical regions are more closely related to their respective developmental stage basal region than they are to the other apical regions (Fig. 4 ). These clusters demonstrate that there is a strong correlation between biological replicates from each tissue sampled (see also Supplemental Tables S1S9), and the data support the hypothesis that each developmental stage has its own distinct transcriptional profile. This further suggests that genes with specifically apically and basally localized expression patterns contribute only a minority of the overall profile. The condition clustering analysis also identifies a clear separation between the early embryonic globular and heart stages, and the later torpedo stage, which is calculated to be closer to the seedling in terms of its transcriptional profile. Interestingly, the torpedo stage SAM clusters closer to the torpedo stage root than it does to the torpedo stage cotyledon, indicating a clear transcriptional difference between these adjacent regions.
Transcriptional Changes along an Embryonic Developmental Time Course To characterize in more detail the transcriptional changes taking place between stages, a separate analysis was undertaken for both the apical (cotyledon) regions and the basal (root) regions. While not directly targeting genes of potential importance in apical-basal polarity, it was hoped that such an analysis would provide an insight into potential differences in the functional gene classes of importance in the different regions. A clustal analysis was also undertaken with the aim of elucidating potentially important groups of genes with similar expression profiles across the three stages.
Apical Developmental Time Course
To assess changes in gene expression patterns on a functional level, the data were filtered by significance using a Student's t test with a maximum confidence level of 95% (P 0.05) for genes whose expression was significantly different from a value of 1. A total of 1,872 genes satisfied this criterion in at least one of the three developmental stages. Further filtering was accomplished by calculating a fold-change between the expression values at different developmental stages. Comparisons were made between globular and heart, and heart and torpedo stages. In each case, the 100 most up-regulated genes passing the significance filter were selected. We chose the 100 most up-regulated genes for illustrative purposes, but all our data are available at the NASCArray Web site (http://affymetrix.arabidopsis.info/) for further interrogation by the community. These genes were assigned functional annotation using information from http://mips.gsf.de/proj/thal/db/. Figure 6, A and B
display the functional classifications of the 200 genes (100 in apical tissues, 100 in basal tissues) most up-regulated between developmental stages.
The data reveal during the transition from globular and heart stages the up-regulation of genes involved in energy production; for example, the photosystem, which comprise 21% of the up-regulated genes during that developmental phase. Other significant functional groups up-regulated are metabolism (19%), cellular communication/signal transduction (7%), and transcription (7% at heart stage). The transition from heart stage to torpedo stage is associated with the up-regulation of genes related to the production of energy (20% of the up-regulated genes), and, once again, these are heavily biased toward the photosystem. Also of note is that 15% of the up-regulated genes are involved in protein synthesis, perhaps reflecting a change in emphasis as the embryo progresses toward late embryogenesis. Metabolic genes also comprise 14% of the total. Through all the functional comparisons, those genes of unknown function represented between 22% and 31% of the total. K-means clustal analysis was performed on the 1,872 genes satisfying the significance criteria, using Pearson correlation (GeneSpring version 7.2). Here, the user defines the maximum number of clusters formed; in this case, 10 cluster experiments are illustrated (Supplemental Fig. S11A). It was found that approximately seven distinct expression patterns are present within the sampled genes (Supplemental Fig. S11B).
An analysis was carried out to determine whether any of the clusters obtained were specifically enriched for particular families of predicted transcription factors or receptor kinases. A database of approximately 1,400 predicted transcription factors and receptor kinases (Davuluri et al., 2003
Basal Developmental Time Course
As for the apical time course analysis, the data were filtered by significance using a Student's t test with a maximum confidence level of 95% (P Four main functional groups are up-regulated in the basal tissue between the globular and heart stages (Fig. 6, C and D): metabolism (27%), energy (9%), protein synthesis (8%), and transcription (8%). Over the heart stage to the torpedo stage transition, five main functional groups are up-regulated: metabolism (15%), cell growth (14%), cell rescue/disease (8%), transcription (8%), and protein fate (6%). As with the apical time course functional analysis, a change in pattern occurs between the heart and torpedo stages, possibly reflecting the approach of late embryogenesis. The fraction accounted for by genes with an unknown function is higher than that of the apical region, comprising between 27% and 38% of the total. K-means clustal analysis was performed on the 1,226 genes satisfying the significance criteria. The 10-cluster analysis (Supplemental Fig. S12) found that approximately seven distinct expression patterns are present within the sampled genes, similar to the results for the apical tissue analysis. As was also found for apically expressed genes, no individual cluster showed any notable enrichment for particular families of transcription factors or receptor kinases.
To study further the transcriptional profiles of apical and basal regions, we compared data for the apical and basal region at each stage along the developmental time course. In addition, a comparison was also made between GeneChip data for the cotyledon and root tissue of a 7-dpg seedling, produced by the AtGenExpress Consortium and provided by NASCArrays at http://www.affymetrix.arabidopsis.info. As well as analyzing the most differentially expressed genes between the regions of a particular developmental stage, we also identified the up-regulated genes of each region/developmental stage to assess the degree of overlap and therefore the degree to which these genes were specifically apical or basal throughout development.
Globular Stage Apical versus Basal Domain
A total of 585 genes satisfied these criteria and were sorted into those up-regulated and down-regulated in the apical region compared to the basal region. Further filtering was accomplished by calculating a fold-change between the expression values of the two regions for a particular gene. All genes showing significant up- or down-regulation (280 and 305 genes, respectively) in the apical versus basal regions passing the significance filter at P
Heart Stage Cotyledon versus Root
All genes showing significant up- or down-regulation (345 and 187, genes respectively) in the cotyledon and root passing the significance filter (P
Torpedo Stage Cotyledon versus Root For illustrative purposes, the 100 most up-regulated genes in the cotyledon and root (50 genes for each tissue) passing the significance filter were assigned functional annotation (http://mips.gsf.de/proj/thal/db/; Fig. 7 ). In general, the cotyledon sample has a larger range of functional groups represented compared to the root sample. The most enriched groups in the cotyledon sample are transcription (14%) and protein synthesis (12%); additional groups enriched at a lower level include energy (8%) and signal transduction (6%). In contrast, only two main groups are enriched in the root sample, namely metabolism (26%) and transcription (12%). Cell rescue and defense response genes also comprise 6% of the root sample and 4% of the cotyledon sample. In both samples, the largest group is that of unknown function, which comprises 42% of the cotyledon sample and 48% of the root sample.
Globular Stage Apical Domain versus Torpedo Stage SAM In addition to comparisons between the apical and basal regions of the different stages of embryogenesis, we compared the apical region of the globular stage embryo to the SAM region of the torpedo stage. The reasoning behind this comparison is that in addition to being the region from which the cotyledons are eventually derived, it has also been shown that, despite no morphologically recognizable structure, expression of essential SAM genes is centered in this region (Barton and Poethig, 1993
The globular stage apical region and the torpedo stage SAM samples were normalized and filtered. A total of 921 genes satisfied these criteria and were sorted into those up-regulated and down-regulated in the torpedo stage SAM compared to the globular stage apical region (or vice versa). All genes showing significant up- and down-regulation genes in the torpedo stage SAM versus the globular stage apical region passing the significance filter (P
Seedling Cotyledon versus Root
Genes that under normal conditions are required for viability, and when disrupted cannot be passed on to subsequent generations, can be considered essential. The precise number of such genes expressed during embryogenesis has not yet been established, but it is estimated that 500 to 1,000 genes in Arabidopsis produce an emb phenotype when mutated (Franzmann et al., 1995
Applying the two arbitrary signal cutoff values as before, it was found that approximately 84% of the EMB genes were expressed in at least one of the three tissue types at a signal threshold of 75, rising to almost 96% at a signal threshold of 40. An analysis into the spatial expression of these genes (Fig. 8
) revealed that approximately 76% were present in all tissue types at the lower signal threshold. The 4% of EMB genes deemed not to be expressed at the lower signal threshold could potentially be expressed in the hypocotyl region, which was not sampled or at another stage of embryogenesis. In support of this possibility, comparison with GeneChip data presented by Casson et al. (2005)
It was possible to identify EMB genes with differential expression patterns between tissue types (Supplemental Table S21). Significant examples include At2g34650 (PID), which is approximately 15-fold more abundant in the cotyledons than the root, and At1g62360 (STM), which is approximately 62-fold more abundant in the SAM than in cotyledonary tissue.
The modification of seed development using genetic engineering, such as for the manipulation of embryonic storage product accumulation, requires gene promoters that are active in seed tissues to drive the transcription of transgenes. Such promoters are also useful as cell type markers for developmental studies. To characterize the activity promoters associated with genes identified as being differentially regulated on the basis of the GeneChip data, four promoter-GUS constructs were created and introduced into Arabidopsis plants by Agrobacterium tumefaciens-mediated transformation. Genes selected for promoter::GUS analysis are shown in Table I . The expression patterns based on the GeneChip data during embryogenesis are also shown. Following growth in soil, siliques were removed from plants and analyzed for GUS expression by histology.
GeneChip data for At5g45600, encoding a predicted YEATS domain transcriptional activator protein, indicate that it is expressed relatively strongly in both apical and basal domains of globular, heart, and torpedo stage embryos (Table I). Figure 9, A to C shows promoter-GUS activity for this gene, which is also expressed throughout the cotyledonary stage embryo (Fig. 9A) and the cotyledon (Fig. 9B) and root tip (Fig. 9C) of the seedling. At2g31510, encoding a predicted RING zinc finger protein, shows relatively low levels of transcript abundance in globular embryos, with higher expression in the heart stage root (Table I). GUS activity from the promoter is observed most strongly in the root provascular strand during embryogenesis (Fig. 9D) and in the vascular tissues of aerial parts and roots in seedlings (Fig. 9, E and F). For At5g14610, encoding a DRH1 DEAD box protein-like protein, the GeneChip data suggest expression is found in both apical and basal tissues throughout the embryonic stages, with strongest expression in the cotyledons of heart stage embryos. Promoter-GUS activity was most strongly found in the cotyledons and hypocotyl of the cotyledonary stage embryo (Fig. 9G), with occasional diffuse staining observed in the root. In the seedling, expression appears to be restricted to the stomatal guard cells of the cotyledons and leaf (Fig. 9H). Finally, At5g50810, encoding a predicted small zinc finger-like protein, is also expressed in all embryonic tissues studied (Table I), and promoter-GUS analysis showed a changing pattern of GUS staining during embryogenesis; constitutive staining was observed at the heart stage of embryogenesis (Fig. 9I), but expression was then lost in the root as the embryo entered the torpedo stage (Fig. 9J). Postembryonically, expression is seen most strongly in the seedling root tip (Fig. 9K). These results therefore show a good correlation between the GeneChip analyses and the promoter-GUS fusion studies.
Microarray analysis is a very powerful technique allowing the expression profiles of thousands of genes to be monitored simultaneously. In combination with LCM, we show it is possible to gain a high resolution picture of global gene transcription during the development of the Arabidopsis embryo. In this article, we use a bioinformatics approach to characterize gene expression changes in different tissue domains across a developmental time course from the globular to torpedo stage embryo.
The imposition of an Affymetrix MAS 5.0 signal cutoff value has been employed in two recent studies as a means to providing an estimation of the number of genes expressed in a tissue of interest: roots (Birnbaum et al., 2003
Although RNA amplification causes a shortening of the products, we avoided potential bias between samples by using 3' probe pairs for microarray analysis, as previously discussed (Casson et al., 2005
To test the hypothesis that each developmental stage under investigation has a distinct transcriptional profile, a condition tree clustering analysis was performed. All tissue types sampled from the same developmental stage clustered together, as opposed to all the apical regions clustering separately from the basal regions. This demonstrates that, in terms of overall transcriptional profile, there appears to be a greater input from the temporal expression patterns than the spatial expression patterns. These data fit with an established model based on RNA hybridization studies in tobacco (Nicotiana tabacum), which suggest that while there are significant populations of organ-specific transcripts, 60% to 77% of plant genes are expressed in heterologous organs (Goldberg, 1988
Scheidl et al. (2002)
The torpedo stage is characterized by maturation and the accumulation of storage reserves in preparation for developmental arrest (Lindsey and Topping, 1993
The time course data (Fig. 5) show the majority of genes to be expressed at the same level throughout the developmental stages, centered on the default expression value of 1. However, each developmental stage is represented by a distinct transcriptional profile in both the apical and basal region, as highlighted by the condition tree analysis. Although the absolute level of transcription does not in itself indicate functional importance, because of the possibility of posttranscriptional regulation for a given gene product, our data do demonstrate clear transcriptional changes during embryogenesis.
Functional annotation of genes that show up-regulation along the developmental time course provides new information but must be considered with caution, taking into account statistical significance and confidence of annotation. In order not to be prohibitively restrictive, the significance filter was relaxed with a 95% confidence required at only one of the three developmental stages. This allows a general overview of the time course but has the potential to allow nonstatistically significant results. Second, only approximately 10% of genes in the Arabidopsis genome (approximately 2,500) have had their function deduced or confirmed by direct experimental analysis; therefore, the vast majority of functions are putative and assigned on the basis of sequence similarity (The Arabidopsis Genome Initiative, 2000
Along the apical time course, genes with a functional role in energy, predominantly those involved in photosynthesis and carbon fixation, were up-regulated at every stage. This is in accordance with in situ hybridization studies that show an increasing abundance of chloroplastic gene transcripts progressively from the proembryo stage of embryogenesis, with the highest concentration observed in the cotyledons of the mature embryo (Degenhardt et al., 1991
Another significant change in the apical time course is the up-regulation of genes involved in protein synthesis between the heart stage and the torpedo stage. This could be representative of the transition from early embryogenesis to the maturation and protein accumulation characteristic of mid/late embryogenesis (Lindsey and Topping, 1993
Along the basal time course, the transition from heart to torpedo stage is accompanied by the significant up-regulation of genes encoding proteins involved in cell growth, specifically the growth of cell walls. This group included a substantial number of Hyp-rich glycoproteins, including expansins, which are regarded as key regulators of wall extension and cell expansion (Cosgrove, 2000
K-means clustering was performed on the filtered apical and basal time course gene sets. In both cases, seven distinct dynamic expression patterns were observed along the time course. These represent all but one of the eight possible patterns of change, with the missing pattern for apical samples being a reduction in expression from globular to heart stage followed by unchanged expression from heart to torpedo stage (Supplemental Fig. S2B), and for the basal samples, the continued reduction in expression from globular to heart to torpedo stage (Supplemental Fig. S3B). The clustering program used assigned genes to clusters based on a user-defined cluster number and did not create these clusters if the number was defined as seven. Hennig et al. (2004)
GeneSpring analysis was used to uncover statistically significant genes, which show differential expression between the apical (cotyledon) and basal (root) samples along the developmental time course as a resource for future analysis. An additional aim was to deduce whether some of these apical and basal genes represented an organ-specific gene set throughout embryogenesis.
Casson et al. (2005) As a nonembryonic comparison, data from 7-dpg seedling cotyledons and roots were analyzed. Compared to the embryonic samples, the seedling analysis produced extremely high fold-changes between the tissue samples. This suggests that differential spatial gene expression is more pronounced in the seedling than the embryo.
A comparison was also made between the apical region of the globular stage embryo and the SAM region of the torpedo stage embryo. The presence of STM in the up-regulated genes of the SAM indicates that the SAM was successfully captured. Caution is required when analyzing this data, as the initial LCM step was not precise enough to achieve specific capture of the SAM, and therefore some degree of contamination from the surrounding tissue is expected. Interestingly, two known cytoskeletal genes were up-regulated in the SAM compared to the globular stage apical region, namely TUA4 (Kopczak et al., 1992
Functional analysis of the 100 most differentially expressed genes in the cotyledon versus root provides a very different perspective to the temporal function analysis conducted for the apical and basal time courses. Basing predicted function for unknown genes on sequence similarity, approximately 30% of the genome remains without putative functional classification (The Arabidopsis Genome Initiative, 2000
The range of functions represented in the up-regulated root genes is limited compared to those of the cotyledon. The most significant functional group represented in the root is that of metabolism, and this correlates well with the analysis performed by Yamada et al. (2003) A significant number of putative transcription factors are present in both the cotyledon and root gene lists, providing potential targets for further analysis into spatial control mechanisms.
Analysis of the overlap between significant apical and basal genes at each developmental stage did not reveal the existence of a population of genes with a distinct spatial expression pattern throughout development. Expression pattern analysis of genes such as PIN4 show that defined spatial expression along the embryonic time course does exist (Friml et al., 2002
Of the collection of 220 EMB genes described by Tzafrir et al. (2004)
Many of the EMB genes appear to be of low abundance, as indicated by low signal values in the GeneChip data, and so care must be taken when assessing some of the fold-changes observed between different embryonic regions. Nevertheless, a number of EMB genes show distinct spatial patterns of differential expression in the torpedo stage embryo. For example, the Ser-Thr protein kinase PINOID is highly up-regulated (15-fold more abundant) in the cotyledon compared to the root correlating with the defective cotyledon morphology observed in the pinoid mutant (Christensen et al., 2000
Bioinformatics tools provide a powerful approach to identify changing patterns of gene expression during development. In combination with relatively new tools such as LCM, a new level of resolution can be achieved. In turn, this allows the identification of specific classes of genes for further study. It must be remembered that this analysis represents a starting point for detailed functional studies, and further experimental research is required to expand on the findings obtained to define the molecular mechanisms underpinning the cellular patterning and biochemical differentiation of the plant embryo and the complex networks of interactions involved.
Sample Preparation and LCM
Embryonic tissues at globular, heart, and torpedo stage were embedded in OCT embedding medium (RA Lamb), frozen, and cryosectioned, as described (Casson et al., 2005
RNA from LCM cells was extracted using the Absolutely RNA Nanoprep kit (Stratagene) and amplified using the MessageAmp aRNA kit (Ambion Europe), as described (Casson et al., 2005
The Affymetrix GeneChip Arabidopsis ATH1 Genome Array (approximately 22,800 genes) was used for DNA microarray analysis, as described (Casson et al., 2005
Approximately 2.5-kb genomic sequences were cloned upstream of the ATG codon of the genes of interest by PCR. The primer pairs used for promoter amplification are as follows: At5g45600, forward GTAGTGATGATACTCAAGCACACC, reverse, CTCGGCTTAACTTCAACAGATCTGCTTC; At2g31510, forward TTGGATCCCATGGAGTGCACGTTTCCTCTCG, reverse TTGGATCCGATCAGAGAAAACGAAATGGC; At5g14610, forward CCAACTGTCATAGGCATATAAGTCC, reverse CCTCAGGAGCGTAACGAATTGCAG; At5g50810, forward GCGGATTCTGCTTTTCCTTTAG, reverse GCAATTCCGGGTTGTTTGCC. Each promoter fragment was initially cloned into the TOPO vector and then transferred to the binary vector p
Tissues were cleared and mounted for light microscopy in chloral hydrate (Topping and Lindsey, 1997
The following materials are available in the online version of this article.
We thank Dr. Sean May of the Nottingham Arabidopsis Seed Centre for assistance with microarray analysis. Received July 31, 2006; accepted December 7, 2006; published December 22, 2006.
1 This work was supported by the Biotechnology and Biological Sciences Research Council (funding to K.L.; a BBSRC Cooperative Awards in Science and Engineering studentship in collaboration with Syngenta to M.S.).
2 Present address: Department of Plant Sciences, University of Oxford, South Parks Road, Oxford OX1 2RB, UK. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Keith Lindsey (keith.lindsey{at}durham.ac.uk).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.087668 * Corresponding author; e-mail keith.lindsey{at}durham.ac.uk; fax 441913341201.
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653657 Ausubel F, Benfey P (2002) Arabidopsis functional genomics. Plant Physiol 129: 393 Barton KM, Poethig RS (1993) Formation of the shoot apical meristem in Arabidopsis thaliana: an analysis of development in the wild type and in the shoot meristemless mutant. Development 119: 823831 Beemster GTS, De Veylder L, Vercruysse S, West G, Rombaut D, Van Hummelen P, Galichet A, Gruissem W, Inzé D, Vuylsteke M (2005) Genome-wide analysis of gene expression profiles associated with cell cycle transitions in growing organs of Arabidopsis. Plant Physiol 132: 734743 Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Ser B 57: 289300 Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW, Benfey PN (2003) A gene expression map of the Arabidopsis root. Science 302: 19561960 Bonner RF, Emmert-Buck MR, Cole K, Pohida T, Chuaqui RF, Goldstein SR, Liotta LA (1997) Cell sampling-laser capture microdissection: molecular analysis of tissue. Science 278: 14811483 Borroto KE, Dure L III (1986) The expression of chloroplast genes during cotton embryogenesis. Plant Mol Biol 7: 105113[CrossRef][Web of Science] Casson S, Spencer M, Walker K, Lindsey K (2005) Laser capture microdissection for the analysis of gene expression during embryogenesis of Arabidopsis. Plant J 42: 111123[CrossRef][Web of Science][Medline] Chang YC, Walling LL (1991) Abscisic acid negatively regulates expression of chlorophyll a/b binding protein genes during soybean development. Plant Physiol 97: 12601264 Chang YC, Walling LL (1992) Chlorophyll a/b binding protein genes are differentially expressed during soybean development. Plant Mol Biol 19: 217230[CrossRef][Web of Science][Medline] Christensen SK, Dagenais N, Chory J, Weigel D (2000) Regulation of auxin response by the protein kinase PINOID. Cell 100: 469478[CrossRef][Web of Science][Medline] Christianson ML (1986) Fate map of the organizing shoot apex in Gossypium. Am J Bot 73: 947958[CrossRef][Web of Science] Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline] Cosgrove DJ (2000) Loosening of plant cell walls by expansins. Nature 407: 321326[CrossRef][Medline] Craigon DJ, James N, Okyere J, Higgins J, Jotham J, May S (2004) NASCArrays: a repository for microarray data generated by NASC's Transcriptomics Service. Nucleic Acids Res 32: D575D577 Davuluri RV, Sun H, Palaniswamy SK, Matthews N, Molina C, Kurtz M, Grotewold E (2003) AGRIS: Arabidopsis Gene Regulatory Information Server, an information resource of Arabidopsis cis-regulatory elements and transcription factors. BMC Bioinformatics 4: 25[CrossRef][Medline] Degenhardt J, Fiebig C, Link G (1991) Chloroplast and nuclear transcripts for plastid proteins in Arabidopsis thaliana: tissue distribution in mature plants and during seedling development and embryogenesis. Bot Acta 104: 455463[Web of Science] Doelling JH, Yan N, Kurepa J, Walker J, Vierstra RD (2001) The ubiquitin-specific protease UBP14 is essential for early embryo developmental in Arabidopsis thaliana. Plant J 27: 393405[CrossRef][Web of Science][Medline] Emmert-Buck MR, Bonner RF, Smith PD, Chuaqui RF, Zhuang ZP, Goldstein SR, Weiss RA, Liotta LA (1996) Laser capture microdissection. Science 274: 9981001 Franzmann LH, Yoon ES, Meinke DW (1995) Saturating the genetic map of Arabidopsis thaliana with embryonic mutations. Plant J 7: 341350[CrossRef][Web of Science] Friml J, Benková E, Blilou I, Wisniewska J, Hamann T, Ljung K, Woody S, Sandberg G, Scheres B, Jürgens G, et al (2002) AtPIN4 mediates sink-driven auxin gradients and root patterning in Arabidopsis. Cell 108: 661673[CrossRef][Web of Science][Medline] Gillespie JW, Best CJM, Bischel VE, Cole KA, Greenhut SF, Hewitt SM, Ahram M, Gathright YB, Merino MJ, Strausberg RL, et al (2002) Evaluation of non-formalin tissue fixation for molecular profiling studies. Am J Pathol 160: 449457 Girke T, Todd J, Ruuska S, Benning C, Ohlrogge J (2000) Microarray analysis of developing Arabidopsis seeds. Plant Physiol 124: 15701581 Goldberg RB (1988) Plants: novel developmental processes. Science 240: 14601467 Goldberg RB, Barker SJ, Perez-Grau L (1989) Regulation of gene expression during plant embryogenesis. Cell 56: 149160[CrossRef][Web of Science][Medline] Hennig L, Gruissem W, Grossniklaus U, Köhler C (2004) Transcriptional programs of early reproductive stages in Arabidopsis. Plant Physiol 135: 17651775 Hilson P, Small I, Kuiper MTR (2003) European consortia building integrated resources for Arabidopsis functional genomics. Curr Opin Plant Biol 6: 426429[CrossRef][Web of Science][Medline] Jones L, McQueen-Mason S (2004) A role for expansins in dehydration and rehydration of the resurrection plant Craterostigma plantagineum. FEBS Lett 559: 6165[CrossRef][Web of Science][Medline] Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U, Speed TP (2003) Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4: 249264[Abstract] Koncz C, Schell J (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol Gen Genet 204: 383396[CrossRef][Web of Science] Kopczak SD, Haas NA, Hussey PJ, Silflow CD, Snustad DP (1992) The small genome of Arabidopsis contains at least six expressed Laux T, Wurschum T, Breuninger H (2004) Genetic regulation of embryonic pattern formation. Plant Cell 16: S190S202 Li Y, Jones L, McQueen-Mason S (2003) Expansins and cell growth. Curr Opin Plant Biol 6: 603610[CrossRef][Web of Science][Medline] Lindsey K, Topping JF (1993) Embryogenesis: a question of pattern. J Exp Bot 44: 359374 Liu CM, McElver J, Tzafrir I, Joosen R, Wittich P, Patton D, Van Lammeren AAM, Meinke D (2002) Condensin and cohesin knockouts in Arabidopsis exhibit a titan seed phenotype. Plant J 29: 405415[CrossRef][Web of Science][Medline] Liu CM, Meinke DW (1998) The titan mutants of Arabidopsis are disrupted in mitosis and cell cycle control during seed development. Plant J 16: 2131[CrossRef][Web of Science][Medline] Long JA, Moan EI, Medford JI, Barton MK (1996) A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379: 6669[CrossRef][Medline] Martinoia E, Klein M, Geisler M, Bovet L, Forestier C, Kokukisaoglu Ü, Müller-Röber B, Schulz B (2002) Multifunctionality of plant ABC transporters more than just detoxifiers. Planta 214: 345355[CrossRef][Web of Science][Medline] Mayer KFX, Schoof H, Haecker A, Lenhard M, Jürgens G, Laux T (1998) Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95: 805815[CrossRef][Web of Science][Medline] Mayer U, Torres Ruiz RA, Berleth T, Miséra S, Jürgens G (1991) Mutations affecting body organization in the Arabidopsis embryo. Nature 353: 402407[CrossRef] McElver J, Tzafrir I, Aux G, Rogers R, Ashby C, Smith K, Thomas C, Schetter A, Zhou Q, Cushman MA, et al (2001) Insertional mutagenesis of genes required for seed development in Arabidopsis thaliana. Genetics 159: 17511763 Meinke DW, Sussex IM (1979) Embryo-lethal mutants of Arabidopsis thaliana: a model system for genetic analysis of plant embryo development. Dev Biol 72: 5061[CrossRef][Web of Science][Medline] Morita-Yamamuro C, Tsutsui T, Tanaka A, Yamaguchi J (2004) Knock-out of the plastid ribosomal protein S21 causes impaired photosynthesis and sugar-response during germination and seedling development in Arabidopsis thaliana. Plant Cell Physiol 45: 781788 Nakazono M, Qui F, Borsuk LA, Schnable PA (2003) Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize. Plant Cell 15: 583596 Parinov S, Sevugan M, Ye D, Yang WC, Kumaran M, Sundaresan V (1999) Analysis of flanking sequences from dissociation insertion lines: a database for reverse genetics in Arabidopsis. Plant Cell 11: 22632270 Pesaresi P, Varotto C, Meurer J, Jahns P, Salamini F, Leister D (2001) Knock-out of the plastid ribosomal protein L11 in Arabidopsis: effects on mRNA translation and photosynthesis. Plant J 27: 179189[CrossRef][Web of Science][Medline] Poethig RS, Coe EH, Johri MM (1986) Cell lineage patterns in maize embryogenesis: a clonal analysis. Dev Biol 117: 392404[CrossRef][Web of Science] Raghavan V (1997) Molecular Embryology of Flowering Plants. Cambridge University Press, Cambridge, UK Scheidl SJ, Nilsson S, Kalén M, Hellström M, Takemoto M, Håkansson J, Lindahl P (2002) mRNA expression profiling of laser microbeam microdissected cells from slender embryonic structures. Am J Pathol 160: 801813 Scheres B, Wolkenfelt H, Willemsen V, Terlouw M, Lawson E, Dean C, Weisbeek P (1994) Embryonic origin of the Arabidopsis primary root and root meristem initials. Development 120: 24752487 Schmid M, Davison TS, Henz SR, Pape UJ, Demar M, Vingron M, Scholkopf B, Weigel D, Lohmann JU (2005) A gene expression map of Arabidopsis thaliana development. Nat Genet 37: 501506[CrossRef][Web of Science][Medline] Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P, Bacwaden J, Ko C, et al (2002) A high-throughput Arabidopsis reverse genetics system. Plant Cell 14: 29852994 Shiu S-H, Bleecker AB (2003) Expansion of the receptor-like kinase/Pelle gene family and receptor-like proteins in Arabidopsis. Plant Physiol 132: 530543 Simone NL, Bonner RF, Gillespie JW, Emmert-Buck MR, Liotta LA (1998) Laser-capture microdissection: opening the microscopic frontier to molecular analysis. Trends Genet 14: 272276[CrossRef][Web of Science][Medline] The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796815[CrossRef][Medline] Topping JF, Agyeman F, Henricot B, Lindsey K (1994) Identification of molecular markers of embryogenesis in Arabidopsis thaliana by promoter trapping. Plant J 5: 895903[CrossRef][Web of Science][Medline] Topping JF, Lindsey K (1997) Promoter trap markers differentiate structural and positional components of polar development in Arabidopsis. Plant Cell 9: 17131725[Abstract] Tzafrir I, McElver JA, Liu CM, Yang LJ, Wu JQ, Martinez A, Patton DA, Meinke D (2002) Diversity of TITAN functions in Arabidopsis seed development. Plant Physiol 128: 3851 Tzafrir I, Pena-Muralla R, Dickermann A, Berg M, Rogers R, Hutchens S, Sweeney TC, McElver J, Aux G, Patton D, et al (2004) Identification of genes required for embryo development in Arabidopsis. Plant Physiol 135: 12061220 Whittington AT, Vugrek O, Wei KJ, Hasenbein NG, Sugimoto K, Rashbrooke MC, Wasteneys GO (2001) MOR1 is essential for organizing cortical microtubules in plants. Nature 411: 610613[CrossRef][Medline] Wortman JR, Haas BJ, Hannick LI, Smith RK Jr, Maiti R, Ronning CM, Chan AP, Yu C, Ayele M, Whitelaw CA, et al (2003) Annotation of the Arabidopsis genome. Plant Physiol 132: 461468 Yamada K, Lim J, Dale JM, Chen H, Shinn P, Palm CJ, Southwick AM, Wu HC, Kim C, Nguyen M, et al (2003) Empirical analysis of transcriptional activity in the Arabidopsis genome. Science 302: 842846 Related articles in Plant Physiol.:
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|