| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online January 26, 2007; 10.1104/pp.106.090811 Plant Physiology 143:1372-1384 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Characterization of a Plastid Triacylglycerol Lipase from Arabidopsis1,[OA]Department of Biology, University of Waterloo, Waterloo, Ontario, Canada N2L 3G1 (A.K.P., M.T.H., T.-W.W., L.M.M., M.L., C.A.T., J.E.T.); and Department of Biology, Wilfrid Laurier University, Waterloo, Ontario, Canada N2L 3C5 (L.G.L.R., M.D.S.)
Full-length cDNA corresponding to Arabidopsis (Arabidopsis thaliana) gene At2g31690, which has been annotated in GenBank as a putative triacylglycerol (TAG) lipase, was obtained by reverse transcription-polymerase chain reaction using RNA from senescing rosette leaves of Arabidopsis as a template. The cognate protein was found to contain the lipase active site sequence, and corresponding recombinant protein proved capable of deesterifying TAG. In vitro chloroplast import assays indicated that the lipase is targeted to chloroplasts. This was confirmed by confocal microscopy of rosette leaf tissue treated with fluorescein isocyanate-labeled, lipase-specific antibody, which revealed that lipase protein colocalizes with plastoglobular neutral lipids. Western-blot analysis indicated that the lipase is expressed in roots, inflorescence stems, flowers, siliques, and leaves and that it is strongly up-regulated in senescing rosette leaf tissue. Transgenic plants with suppressed lipase protein levels were obtained by expressing At2g31690 cDNA in antisense orientation under the regulation of a constitutive promoter. Transgenic plants bolted and flowered at the same time as wild-type plants, but were severely stunted and exhibited delayed rosette senescence. Moreover, the stunted growth phenotype correlated with irregular chloroplast morphology. The chloroplasts of transgenic plants were structurally deformed, had reduced abundance of thylakoids that were abnormally stacked, and contained more plastoglobular neutral lipids than chloroplasts of wild-type plants. These observations collectively indicate that this TAG lipase plays a role in maintaining the structural integrity of chloroplasts, possibly by mobilizing the fatty acids of plastoglobular TAG.
Analysis of the amino acid sequence of fatty acid-deesterifying lipases cloned from animals, bacteria, fungi, and higher plants has shown that they typically contain the 10-amino acid sequence [LIV]-X-[LIVAFY]-[LIAMVST]-G-[HYWV]-S-X-G-[GSTAC] (Derewenda and Derewenda, 1991  ). The Ser residue of this motif is a key element of the active site of fatty acid-deesterifying lipases (Brick et al., 1995).
Several types of fatty acid-deesterifying lipases, including phospholipase A1 and phospholipase A2, have been identified in plants. Phospholipase A2 catalyzes deesterification of the sn2 fatty acid of phospholipids, yielding free fatty acid and 1-acyl-2-lysophospholipid, and is thought to generate free linolenic acid substrate for the octadecanoid pathway (Grechkin, 1998
Lipolytic acyl hydrolases, another class of fatty acid-deesterifying lipases, are also prevalent in plants. These lipases release fatty acids from a number of different substrates, including phospholipids and wax esters, and, in the case of phospholipids, deesterify at both the sn1 and sn2 positions (Galliard, 1980
Galactolipase functions in the same way as lipolytic acyl hydrolase, with the exception that it specifically cleaves fatty acids from both the sn1 and sn2 positions of galactolipids. Deesterification of galactolipids has been shown to be induced by drought stress, chilling, and senescence (Kaniuga and Gemel, 1984
Triacylglycerol (TAG) lipases deesterify fatty acids from TAG, a major storage lipid that, in oil-storing seeds, is localized in oil bodies (Somerville et al., 2000
Plastoglobuli, which are lipid bodies localized in chloroplasts, also contain TAG and, increasingly, appear to be structurally analogous to seed oil bodies (Martin and Wilson, 1984 In this study, we have characterized a putative TAG lipase in Arabidopsis that is localized in the plastoglobuli of chloroplasts. Suppression of this lipase in transgenic plants by constitutive expression of a corresponding antisense transgene resulted in severely stunted growth as well as reduced abundance and disorganization of thylakoid membranes. The results are consistent with the view that TAG lipase mobilizes fatty acids from complex plastoglobular lipids.
Lipase Gene Isolation and Function
Full-length cDNA from Arabidopsis (corresponding to GenBank accession no. At2g31690 and encoding the protein with GenBank accession no. AAD24845) was obtained by reverse transcription (RT)-PCR using RNA isolated from the rosette leaves of 6-week-old plants as a template. The nucleotide and inferred amino acid sequences of the full-length cDNA are shown in Figure 1
. A comparison of the genomic and cDNA nucleotide sequences indicated that the gene does not contain introns. Analysis of the inferred amino acid sequence predicts a molecular mass for the full-length protein of approximately 53 kD. The programs TargetP (version 1.0; http://www.cbs.dtu.dk/services/TargetP; Emanuelsson et al., 2000
In an effort to confirm that the protein corresponding to accession number AAD24845 corresponds to a lipase, cDNAs corresponding to the full-length and predicted mature (plastid-localized) forms of the protein were overexpressed as recombinant maltose binding protein (MBP) fusion proteins in Escherichia coli. SDS-PAGE and western-blot analysis confirmed the presence of the recombinant proteins in E. coli extracts (data not shown). Purified recombinant fusion proteins were tested for lipase activity in vitro. For this purpose, the MBP fusion proteins were immobilized on amylose resin and tested for their ability to hydrolyze the TAG trilinolein (18:2). In this assay, the full-length AAD24845-MBP fusion protein (MBP-LipF) demonstrated only slightly higher lipase activity than the background registered by MBP on its own (Table I ). In contrast, the predicted mature version of the AAD24845 protein (i.e. lacking the predicted transit peptide) fused to MBP (MBP-LipS) exhibited a significantly higher activity compared to both the control MBP and the full-length AAD24845-MBP fusion (Table I). This was true whether the samples were assayed by thin-layer chromatography (TLC) or using the nonesterified fatty acid (NEFA)-C assay kit and suggests that the AAD24845 protein is a bona fide TAG lipase. Furthermore, it appears that cleavage of the predicted transit peptide is required for the protein to attain its fully active form. Lipase activity was undetectable in the presence of phospholipid (soybean [Glycine max] phosphatidylcholine) or galactolipid (monogalactosyl diacylglycerol) substrate.
Expression and Localization Analyses Western blots of total protein extracts from rosette leaves of Arabidopsis plants at different stages of development were probed with antiserum raised against a synthetic peptide corresponding to the putative TAG lipase. An approximately 46-kD polypeptide, which corresponds to the expected size of the mature protein, was barely detectable in leaves from 2- and 3-week-old plants, but showed increased abundance through weeks 5 and 6 (Fig. 2A ). The progress of rosette leaf development and senescence was scored by measuring changes in the levels of leaf chlorophyll. Chlorophyll levels proved to be high (10–12 mg g–1 dry weight of leaf tissue) in 2- and 3-week-old leaves, declined by 25% between weeks 4 and 5 as leaf senescence commenced, and by week 6, when the leaves were turning yellow in color, had decreased to approximately 50% of their peak values (Fig. 2B).
In an effort to confirm that the predicted plastid transit peptide directs the putative TAG lipase to plastids, chloroplasts were purified from the rosette leaves of 4.5-week-old Arabidopsis using a Percoll gradient and analyzed for the presence of the lipase protein by western blotting. Pure intact chloroplasts were subfractionated into total chloroplast membranes and stroma by lysis and centrifugation. The lipase protein was detectable in intact chloroplasts and also in stroma, but not in the chloroplast membrane fraction (Fig. 3A ). Indeed, TAG lipase proved to be substantially enriched in the stroma as compared to intact chloroplasts, suggesting that it is primarily a stromal protein (Fig. 3A, compare lanes 1 and 3). In addition, the molecular mass of the stromal TAG lipase proved to be approximately 46 kD, the expected size of the mature protein (Fig. 3A). These data are in agreement with the results of in vitro chloroplast import assays in which the recombinant AAD24845 lipase precursor was incubated with intact chloroplasts isolated from Arabidopsis. These data show that the approximately 53-kD full-length TAG lipase precursor is converted to an approximately 46-kD protein following incubation and reisolation of chloroplasts (Fig. 3B). Furthermore, the processed form of the TAG lipase is resistant to treatment with thermolysin (Fig. 3B, lane 3), which indicates that the protein has been successfully imported into the interior of the chloroplast. In addition, both the western blot and in vitro import data are consistent with the predicted 7-kD size of the transit peptide and confirm that this is a plastid transit peptide capable of directing the protein to chloroplasts.
Confocal microscopy of rosette leaves from 4.5-week-old plants provided additional evidence that the putative TAG lipase is localized in chloroplasts. Green pseudocolored autofluorescing chlorophyll reflecting the presence of thylakoids was clearly evident in confocal images of leaf cells, as was blue pseudocolored fluorescence corresponding to FITC antibody-labeled TAG lipase (Fig. 4, A and B ). When the chlorophyll fluorescence and antibody fluorescence images were merged, it was clear that the TAG lipase is localized within chloroplasts (Fig. 4C).
Western blotting of protein isolates from a number of tissues of 6-week-old Arabidopsis plants revealed that the TAG lipase protein is also present in non-green organs, such as roots, suggesting that the transit peptide directs the protein to plastids other than chloroplasts. At 6 weeks of age, inflorescence stems and cauline leaves had not begun to senesce, flowers were a mixture of senescent and nonsenescent, and siliques were developing, but had not yet reached maturity. An approximately 46-kD protein corresponding to the TAG lipase was detected in roots, inflorescence stems, cauline leaves, flowers, and siliques. However, the TAG lipase protein proved to be more abundant in flowers and cauline leaves than in other tissues analyzed (Fig. 5 ).
Transgenic Plants with Suppressed Expression of the Putative TAG Lipase Transgenic Arabidopsis plants expressing antisense full-length cDNA corresponding to the TAG lipase were obtained by vacuum infiltration. T1 seedlings were selected on kanamycin plates, transplanted to soil, and grown to maturity. The presence of the transgene was confirmed by PCR. T1 plants were severely stunted in comparison with wild-type plants, but bolted and flowered at the same time as corresponding wild-type plants. This is illustrated for five transgenic lines (Figure 6, A–D , lines 1–5). That the intensity of the phenotype correlated with the degree of expression of the transgene is illustrated by the phenotypes of segregating T2 plants. For example, for line 2, 75% of the T2 plants exhibited the same degree of stunted growth that was evident for the corresponding T1 plants (Fig. 6, C and E), and a kanamycin screen of the T3 seeds from these plants yielded a 3:1 segregation ratio, indicating that these T2 plants were heterozygous (Fig. 6E). However, 25% of the T2 plants for line 2 exhibited a much more pronounced stunted phenotype and, in the kanamycin screen of the corresponding T3 seeds, 100% of the seedlings survived, indicating that these T2 plants were homozygous (Fig. 6E). There was also an accumulation of anthocyanin in the leaves of homozygous transgenic plants, indicating that they were under stress (Fig. 6F). Although the transgenic plants bolted and flowered at the same time as the wild-type plants, notwithstanding their stunted phenotype (Fig. 6, A–E), rosette senescence was dramatically delayed. Even at 10.5 weeks after planting, by which time the rosettes of wild-type plants were completely dead, the rosettes of transgenic plants were still green. This is illustrated for homozygous line 2 plants in Figure 6G.
That the phenotype correlated with suppressed expression of the putative TAG lipase gene was confirmed by western blotting. Protein was isolated from rosette leaves of 4.5-week-old wild-type and transgenic plants. At this age, wild-type and transgenic plants were at comparable stages of development, although the transgenic plants were stunted (Fig. 6). The TAG lipase was clearly apparent in rosette leaves from wild-type plants, but was barely detectable in rosette leaf protein from transgenic plants, as is illustrated for lines 2B-1 and 2B-2 in Figure 7 . The effect of transgene expression on levels of TAG lipase protein was also assessed by confocal microscopy. Sections from the first leaf pair of 4.5-week-old wild-type and transgenic leaves were treated with FITC-labeled secondary antibody. When these sections were examined by confocal microscopy, it was clear that the TAG lipase protein is localized in chloroplasts in both wild-type and transgenic plants and that the abundance of TAG lipase protein was greatly reduced in transgenic leaf sections in comparison with wild-type leaf sections. This is illustrated for transgenic line 2 in Figure 8, A and B , as compared with wild type in Figure 8, E and F.
Southern-blot analyses confirmed GenBank data indicating that the Arabidopsis genome contains only one copy of the At2g31690 gene. When rosette leaf genomic DNA was digested with the restriction enzyme HindIII, for which there is no site in the open reading frame of the lipase gene, fractionated on an agarose gel, blotted, and probed with full-length At2g31690 cDNA corresponding to the TAG lipase, only one restriction fragment was visible for wild-type plants (Fig. 9 ). In corresponding blots for transgenic line 2, one additional restriction fragment corresponding to a single copy of the transgene was also discernible (Fig. 9). Transgenic lines 2B and 2C were homozygous with respect to the transgene and, as expected, the restriction fragments corresponding to the endogenous gene and the single transgene were of comparable intensity (Fig. 9). However, transgenic line 2A was heterozygous with respect to the transgene and, accordingly, the intensity of the transgene restriction fragment was approximately one-half that of the endogenous gene (Fig. 9).
Colocalization of Lipase with Chloroplast Neutral Lipids
Confocal microscopy of sections from the first leaf pair of 4.5-week-old wild-type and transgenic plants indicated that the TAG lipase colocalizes with neutral lipids in chloroplasts. Lipase protein was visualized using FITC-labeled antibody against the TAG lipase primary antibody and neutral lipid (e.g. TAG) was stained with the fluorescent dye, Nile Red. For wild-type leaves, TAG lipase protein was abundant and clearly localized in the chloroplasts (Fig. 8, E and F). Levels of chloroplast neutral lipids, which are localized in plastoglobuli, were low, but detectable (Fig. 8G). However, because the neutral lipid levels were so low in wild-type leaves, merging of the Nile Red-stained image and the TAG lipase image did not provide clear evidence for colocalization of neutral lipid and TAG lipase (Fig. 8H). As in wild-type leaves, the TAG lipase of transgenic leaves was also localized in chloroplasts (Fig. 8, A and B). However, levels of lipase were greatly reduced in transgenic as compared to wild-type plants (Fig. 8, B and F), whereas neutral lipid levels were enhanced in transgenic plants (Fig. 8, C and G). In addition, merging of the TAG lipase image and the Nile Red-stained image for transgenic leaf sections provided clear evidence for colocalization of TAG lipase protein and neutral lipids likely contained within plastoglobuli (Fig. 8D). Of particular note is the fact that the high levels of TAG lipase protein in wild-type leaf segments are accompanied by low levels of neutral lipids (Fig. 8, F and G), whereas in transgenic leaf segments high levels of neutral lipids are accompanied by low levels of TAG lipase protein (Fig. 8, B and C). Inasmuch as the neutral lipids visualized by Nile Red staining would include TAG, this is consistent with the notion that TAG lipase hydrolyzes chloroplast TAG. Moreover, in both wild-type and transgenic leaf sections, lipase protein and neutral lipids appear as clusters, suggesting that they are colocalized in plastoglobuli (Fig. 8), which are known to contain neutral lipids, such as TAG (Kaup et al., 2002 Transmission electron microscopy of thin sections from the first leaf pair of 3.5-week-old wild-type and transgenic plants revealed that suppression of this putative TAG lipase also resulted in chloroplast structural aberrations. Chloroplasts in wild-type leaves proved to be compact with tightly stacked thylakoids and several large plastoglobuli (Fig. 10A ). By contrast, chloroplasts of transgenic plants were deformed with wavy outer envelopes and reduced levels of thylakoid membranes that were loosely stacked. Distinct plastoglobuli that were smaller than those evident in wild-type chloroplasts were also discernible in the chloroplasts of transgenic leaves (Fig. 10, A and B). However, in keeping with the greater abundance of neutral lipid in the chloroplasts of transgenic plants depicted by Nile Red staining (Fig. 8, C and G), there were also large numbers of small osmium-stained stromal particles evident in thin-sectioned transgenic chloroplasts that are likely plastoglobuli (Fig. 10B).
The Arabidopsis gene characterized in this study is identified as a putative TAG lipase in GenBank (At2g31690) based on its degree of sequence identity to known TAG lipases. Western-blot data indicated that this putative TAG lipase (protein accession no. AAD24845) is present in flowers, inflorescence stems, cauline and rosette leaves, siliques, and roots of Arabidopsis plants. Moreover, several lines of evidence indicate that it is targeted to plastids. Examination of the deduced protein sequence using the programs TargetP (version 1.01), Predator (version 1.03), and ChloroP (version 1.1) predicted that it is targeted to chloroplasts and possesses a 63-amino acid (approximately 7 kD) transit peptide (Fig. 1). Western-blot analysis of leaf subcellular fractions indicated that the lipase is localized in chloroplasts (Fig. 3A). This contention was further supported by confocal microscopy, which showed that FITC-labeled antibody against the AAD24845-specific antibody recognized a protein that was localized to chloroplasts (Fig. 4) and by in vitro chloroplast import assays, which showed that the protein is imported and processed to generate a mature protease-protected protein that is approximately 7 kD shorter than the original full-length (precursor) protein (Fig. 3B). Of note is that the TAG lipase was also detectable by western blotting in roots that do not contain chloroplasts, suggesting that it is also associated with plastid types other than chloroplasts. Storage plastids that contain neutral lipids, including TAG, are known to be present in tissues that are nonphotosynthetic (Xue et al., 1997 ; Staehelin and Newcomb, 2000; Murphy, 2001), and it is therefore to be expected that one or more lipases are targeted to such plastids.
The findings that the putative TAG lipase has a plastid transit peptide, is localized in chloroplasts, and is found as well in tissues that contain storage plastids are all consistent with the contention that it is a plastid lipase. Moreover, there are several lines of evidence indicating that the protein is in fact a lipase. First, the amino acid sequence contains the 10-residue lipase active site sequence, [LIV]-X-[LIVAFY]-[LIAMVST]-G-[HYWV]-S-X-G-[GSTAC]. This motif is normally a feature of lipases that deesterify fatty acids from complex lipids (Derewenda and Derewenda, 1991
It is apparent from GenBank that lipase AAD24845 is encoded by a single-copy gene and this was confirmed by Southern blotting in this study. That down-regulation of expression of lipase gene At2g31690 had been achieved in antisense At2g31690 transgenic plants was confirmed by western-blot analysis of levels of the lipase protein AAD24845 in leaves at comparable stages of development and also by confocal microscopy. The antibodies used for detection of the putative TAG lipase protein were raised against a synthetic peptide deemed to be unique to AAD24845 based on BLAST interrogation of its sequence. The severely stunted nature of transgenic plants with suppressed AAD24845 indicates that this protein plays a seminal role in plant growth. It appears to be constitutively expressed at low levels, but, judging from western-blot analysis, there is clear up-regulation of expression in senescing leaves. Senescing chloroplasts are known to be enriched in plastoglobuli, which form coincident with the breakdown of thylakoid membranes (Harwood, 1980
Plastoglobuli are present in chloroplasts of both senescing and nonsenescing leaves, but are much more distinct and abundant in senescing leaves. Moreover, their increased size and abundance in senescing leaves has been shown to be paralleled by an increase in TAG originating from galactolipid and up-regulation of DGAT1, which mediates the final acylation step in the formation of TAG (Kaup et al., 2002
Of particular interest is the finding that the chloroplasts of AAD24845-suppressed transgenic plants appeared deformed and had fewer thylakoids than the chloroplasts of wild-type plants. Moreover, thylakoids of transgenic plants were loosely stacked in comparison with grana of wild-type plants. These observations suggest that putative TAG lipase AAD24845 plays a role in maintaining the structural integrity of thylakoids and that lack of grana structural integrity in transgenic plants accounts for their stunted growth. Transgenic plants were clearly under stress throughout growth and development as indicated by the consistent presence of anthocyanin in the leaves. Previous studies have demonstrated activation of TAG synthesis and a concurrent decrease in galactolipids in ozone-fumigated leaves (Sakaki et al., 1990a
Plant Material Arabidopsis (Arabidopsis thaliana ecotype Columbia) was grown on Promix BX (Premier Brands). Seeds were sown in 6-inch pots, covered with plastic wrap, and stratified at 4°C for 2 d to achieve uniform germination. Plants were transferred to a growth chamber operating at 16-h-light/8-h-dark cycles, 23°C ± 3°C, and 150 µmol m–2 s–1 photosynthetically active radiation. Each pot contained eight to 10 plants, which were grown for a period of 7 to 8 weeks after transfer to the growth chamber with senescence starting after 4 weeks and seed production finished by 8 weeks. Rosette leaves were harvested at 2, 3, 4, 5, and 6 weeks of age. In some cases, additional organs were harvested from 6-week-old plants, specifically roots, inflorescence stems, cauline leaves, flowers, and siliques.
Full-length cDNA corresponding to GenBank sequence At2g31690 (encoding protein AAD24845) was obtained by RT-PCR using RNA isolated from 6-week-old Arabidopsis rosette leaves as the template. The upstream primer (5'-CGTGTCGACTTCCATCAATGGCCTTGATCC-3') contained the restriction enzyme site for SalI and the downstream primer (5'-GCCAAGCTTACGCTGACGTTGTACGAATTATAG-3') contained the restriction enzyme site for HindIII. The PCR product was subcloned into pBluescript KS that had been digested with SalI and HindIII, amplified in Escherichia coli DH5-
Suppression of the endogenous At2g31690 gene was achieved by expressing full-length At2g31690 cDNA in the antisense orientation under the regulation of a constitutive promoter in transgenic plants. At2g31690 cDNA was excised from pBluescript KS by double digestion with SalI/HindIII and subcloned into the binary vector, pKYLX71 (Schardl et al., 1987
Leaf genomic DNA for Southern-blot analysis was isolated according to Wang et al. (2001)
For western-blot analysis, total protein was extracted from tissues at specified ages. The tissue (200 µg) was homogenized on ice with a mortar and pestle in 500 µL of extraction buffer (50 mM HEPES, pH 7.4). Homogenate protein was quantified according to Ghosh et al. (1988)
For the purpose of western-blot analyses, chloroplasts were isolated from the rosette leaves of 4.5-week-old, soil-grown Arabidopsis rosettes using a Percoll gradient as described by Kunst (1998)
Chlorophyll was extracted and quantified as described by Porra et al. (1989)
Discs (4-mm diameter) were cut from the center portion of the first leaf pairs. Leaf discs were vacuum infiltrated for 10 min in 4% paraformaldehyde in phosphate-buffered saline (PBS) and stored at 4°C until stained. Discs were washed with PBS twice (30 min each) at room temperature to remove the fixative and once with 1% Triton X-100 in PBS to permeabilize the tissue. Discs were then gently shaken overnight at room temperature with purified lipase antibody (1:50) in PBS containing 1% bovine serum albumin (BSA), washed twice in PBS, and probed with goat anti-rabbit antibody conjugated to FITC (Sigma; 1:100 in PBS plus 1% BSA) for 2 h in the dark. Discs were then washed twice with PBS and mounted on slides in 70% glycerol. Nile Red staining was performed according to Fowler and Greenspan (1985) Samples were observed using a Zeiss LSM 510 confocal laser-scanning microscope attached to an Axiovert inverted microscope.
Segments of tissue (approximately 2 mm2) were cut from the center of first leaf pairs, vacuum infiltrated in 20 mM sodium phosphate buffer (pH 7.2), and fixed overnight at 4°C in 4% gluteraldehyde in 20 mM sodium phosphate buffer (pH 7.2). Samples were then washed four times in 20 mM phosphate buffer (pH 7.2), postfixed in 1% osmium tetroxide in 20 mM phosphate buffer (pH 7.2) for 2 h at 4°C, and washed four times in water. They were then dehydrated in a graded series of acetone, washed four times in 100% acetone, and embedded in Epon-Araldite. Ultrathin sections (70–90 nm) were stained in lead citrate and uranyl acetate, and examined with a Philips CM 10 electron microscope operating at 60 kV.
To obtain recombinant AAD24845 protein, two versions of At2g31690 cDNA were subcloned into the expression vector pMal-c2X (New England Biolabs), which produces MBP fusion proteins. Full-length cDNA (corresponding to the full-length putative precursor protein) was amplified by PCR using two primer adapters (U1, TCTTGTCGACATGGCCTTGATCCAAAACCC, SalI site underlined; D, TAGTAAGCTTTACGCTGACGTTGTACGAAT, HindIII site underlined) that incorporated restriction sites to facilitate subcloning. The PCR product was subcloned into pMal-c2X to form pMal-lipF, which encodes the recombinant fusion protein MBP-LipF. The truncated cDNA corresponding to the predicted mature form of the protein lacking the predicted transit peptide was obtained by eliminating the first 162 bp of the full-length cDNA. This was accomplished by amplification using PCR with primer-adapters (U2, TCTGTCGACGCACCAGTGATTCTAAATTCTCCGG, SalI site underlined; D, same as above). The PCR product was subcloned into pMal-c2X to form pMal-lipS, which encodes the recombinant fusion protein MBP-LipS. Both constructs were expressed in E. coli and purified according to the manufacturer's recommendations.
TAG lipase activity of the recombinant MBP fusion proteins was measured in vitro. To prepare the recombinant proteins, overnight cultures of each of the E. coli clones containing pMal-lipF, pMal-lipS, or pMal (empty control vector) were prepared in 2x yeast extract tryptone (YT) containing 50 µg/mL ampicillin and 0.2% (w/v) Glc. The next day, these cultures were used to inoculate 35 mL of fresh 2x YT containing 0.2% Glc and incubated at 37°C for 1.5 h. To induce expression of the recombinant fusion proteins, isopropylthio-
Following overnight incubation, lipids were extracted essentially as described by Bligh and Dyer (1959)
For the purpose of preparing protein to be used for in vitro chloroplast import assays, cDNA encoding the putative lipase precursor protein was subcloned into the NheI and SalI recognition sites of pET21B (Novagen) following PCR using primer adapters, such that the corresponding protein contained its naturally occurring N terminus. [35S]Met-labeled protein was generated in vitro using a coupled transcription-translation system containing rabbit reticulocyte lysate according to the manufacturer's recommendations (Promega).
Arabidopsis (ecotype Columbia) seedlings were grown on agar plates supplemented with 0.5x Murashige and Skoog growth medium and 1% (w/v) Suc as described previously (Smith et al., 2002
In vitro chloroplast import assays were performed essentially as described in Smith et al. (2002) Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers NP_180727, AAY78709, and AAD24845.
We are grateful to Mr. Dale Weber for expert technical assistance with microscopy and to Dr. Alexandre Joyeux for technical support. Received October 3, 2006; accepted January 3, 2007; published January 26, 2007.
1 This work was supported by the Natural Sciences and Engineering Research Council of Canada (Discovery grants to J.E.T. and M.D.S.), and Wilfrid Laurier University is gratefully acknowledged (by M.D.S.).  The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: John E. Thompson (jet{at}sciborg.uwaterloo.ca).
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.090811 * Corresponding author; e-mail jet{at}sciborg.uwaterloo.ca; fax 519–746–2543.
Anderson MM, McCarty RE, Zimmer EA (1974) The role of galactolipids in spinach chloroplast lamellar membranes. I. Partial purification of bean leaf galactolipid lipase and its action on sub-chloroplast particles. Plant Physiol 53: 699–704 Austin II Jr, Frost E, Vidi P-A, Kessler F, Staehelin A (2006) Plastoglobules are lipoprotein subcompartments of the chloroplast that are permanently coupled to thylakoid membranes and contain biosynthetic enzymes. Plant Cell 18: 1693–1703 Bailey JL, Whyborn AG (1963) The osmiophillic globules of chloroplasts II. Globules of the spinach-beet chloroplasts. Biochim Biophys Acta 1143: 113–134 Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C R Acad Sci III Sci Vie 316: 1194–1199 Beisson F, Ferte N, Bruley S, Voultoury R, Verger R, Arondel V (2001) Oil-bodies as substrates for lipolytic enzymes. Biochim Biophys Acta 1531: 47–58 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOP
ABSTRACT
RESULTS
, and sequenced. 
-galactoside was added to a final concentration of 0.3 mM and incubation continued at 30°C for 3.5 h. Cells were collected by centrifugation, resuspended in 1 mL of lysis buffer (100 mM Tris, pH 8.0, 150 mM NaCl, and 0.1% Triton X-100), and sonicated. The lysates were cleared by centrifugation and the soluble extracts were added to 200 µL of amylose resin slurry (New England Biolabs), which had been equilibrated with lysis buffer. After allowing the MBP fusion proteins to bind for at least 15 min at 4°C, the amylose resin was washed three times with lysis buffer. Another 1 mL of lysis buffer was added to the resin and the suspension was divided into four equal parts. Resin-bound protein was eluted from one aliquot with 20 mM maltose in lysis buffer for estimating the protein content (Bradford, 1976