|
|
||||||||
|
First published online February 23, 2007; 10.1104/pp.106.095158 Plant Physiology 143:1534-1546 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Mitochondrial Complex II Is Essential for Gametophyte Development in Arabidopsis1,[W],[OA]Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile, Casilla 114D, Santiago, Chile
Mitochondrial complex II (succinate dehydrogenase [SDH]) is part of the tricarboxylic acid cycle and the respiratory electron transport chain. Its flavoprotein subunit is encoded by two nuclear genes, SDH1-1 and SDH1-2, in Arabidopsis (Arabidopsis thaliana). The SDH1-2 gene is significantly expressed only in roots, albeit at very low level, and its disruption has no effect on growth and development of homozygous mutant plants. In contrast, SDH1-1 transcripts are ubiquitously expressed, with highest expression in flowers. Disruption of the SDH1-1 gene results in alterations in gametophyte development. Indeed, heterozygous SDH1-1/sdh1-1 mutant plants showed normal vegetative growth, yet a reduced seed set. In the progeny of selfed SDH1-1/sdh1-1 plants, distorted segregation ratios were observed, and no homozygous mutant plants were obtained. Reciprocal test crosses with the wild type demonstrated that the mutated sdh1-1 allele is not transmitted through the male gametophyte and is only partially transmitted through the female gametophyte. Consistently, microscopic analysis showed that mutant microspores develop normally until the vacuolated microspore stage, but fail to undergo mitosis I, and then cell structures are degraded and cell content disappears. On the other hand, half the mutant embryo sacs showed arrested development, either at the two-nucleate stage or before polar nuclei fusion. Down-regulation of SDH1-1 by RNA interference results in pollen abortion and a reduced seed set, as in the insertional mutant. Altogether, our results show that SDH1-1, and therefore complex II, are essential for gametophyte development.
Succinate:ubiquinone oxidoreductase (succinate dehydrogenase [SDH]; EC 1.3.5.1), commonly referred to as mitochondrial complex II, has a central role in mitochondrial metabolism as a member of both the electron transport chain and the tricarboxylic acid (TCA) cycle. This membrane-associated complex catalyzes the oxidation of succinate to fumarate and the reduction of ubiquinone to ubiquinol, and has been characterized in bacteria and heterotrophic eukaryotes (Lemire and Oyedotun, 2002
SDH subunits are all encoded in the nuclear genome in Arabidopsis (Arabidopsis thaliana), just like complex II from heterotrophic eukaryotes (Scheffler, 1998
SDH1-1 (At5g66760) and SDH1-2 (At2g18450) have similar structures and encode highly similar proteins that would be functional as complex II flavoprotein since they are highly conserved when compared to their homologs in other organisms (Figueroa et al., 2002
The highest SDH1-1 mRNA levels were found in flowers (Figueroa et al., 2002 To gain insight into the physiological role of complex II and to explore the function of the multiple genes encoding the same SDH subunit, our group has undertaken a reverse genetic analysis of the SDH genes. Here we report the analysis of T-DNA insertional mutants in SDH1-1 and SDH1-2, the flavoprotein genes. Our results reveal that SDH1-2 is dispensable and that the sdh1-1 null allele behaves as a general gametophytic mutation, demonstrating that complex II plays an essential role in gametophyte development.
Isolation of T-DNA Insertion Mutants of Arabidopsis SDH1 Genes Several different mutant lines carrying T-DNA insertions in the SDH1-2 gene were identified as described in "Materials and Methods." One mutant was isolated and further characterized: the T-DNA was confirmed to be in the eighth out of 15 exons, and interrupted codon 336. The precursor SDH1-2 polypeptide deduced from the gene sequence has 632 amino acids and disruption at codon 336 that is upstream of several residues involved in FAD and substrate binding, and in catalysis is expected to result in a null mutation. Homozygous sdh1-2 mutant plants were obtained and showed no apparent phenotypic defects during vegetative or reproductive growth when compared to wild-type plants, at least under the growth conditions used.
These results indicate that the loss of SDH1-2 has no impact on Arabidopsis growth and development, a fact consistent with our previous expression data (Figueroa et al., 2002 For SDH1-1, only one mutant line was identified: the T-DNA insertion was mapped to exon 9 and interrupts codon 317 (Fig. 1A ). The SDH1-1 precursor polypeptide has 634 amino acids and disruption at codon 317 is expected to result in a null mutation. Genotyping of T2 plants obtained from the seed pool sent by the Arabidopsis Biological Resource Center (ABRC) led to the identification of several heterozygous SDH1-1/sdh1-1 mutant plants (Fig. 1B). However, attempts to identify homozygous sdh1-1/sdh1-1 mutant plants were unsuccessful. Moreover, no homozygous mutant seedlings were obtained in the progeny of selfed SDH1-1/sdh1-1 plants, suggesting that gametophyte and/or embryo development are altered and that SDH1-1 is an essential gene. Currently, there are no other mutant alleles available for SDH1-1, as confirmed by searching the Arabidopsis Insertion Data Base (http://atidb.org/cgi-perl/index).
Molecular Characterization of Heterozygous SDH1-1/sdh1-1 Mutant Plants Northern-blot analysis was performed using RNA from three wild-type plants and six plants carrying the sdh1-1 mutated allele (Fig. 1C). As expected, the heterozygous mutant plants showed a reduced steady-state level of the SDH1-1 mRNA (roughly 50%). To assess whether this transcript decrease results in a lower complex II activity, succinate:quinone reductase (SQR) activity was measured in three independent experiments performed with mitochondrial fractions prepared from wild-type and SDH1-1/sdh1-1 18-d-old seedlings. Heterozygous mutant plants consistently showed a 32% reduction in SQR activity (Fig. 1D). When 1 mM thenoyltrifluoroacetone, a known complex II inhibitor, was included in the assays, the activity was completely abolished. Thus, these heterozygous mutant plants have a mild reduction in complex II activity, a result consistent with their normal phenotype during sporophytic growth (see below). Since no other sdh1-1 mutant alleles are available to establish a correlation between a phenotype (see below) and different mutations in SDH1-1, it was important to characterize the mutated sdh1-1 locus and to analyze the number of T-DNA insertions in the mutant genome. PCR amplification of SDH1-1 gene/T-DNA junctions first suggested that the insertion is complex. Indeed, both insertion sides were amplified using the left-border primer (primer 1 in Fig. 1A) in combination with either an upstream (primer 2) or a downstream (primer 3) gene-specific primer. Sequencing of the PCR products demonstrated that the T-DNA left border was present at both ends of the insertion, suggesting the presence of at least two T-DNA molecules. More importantly, sequence analysis established that no major deletions or chromosomal rearrangements took place during the insertional event. Only a minor 23 bp deletion occurred in SDH1-1 at the insertion site.
T-DNA copy number was determined through DNA gel-blot analysis, using a T-DNA noncutting enzyme (PstI). Hybridization of PstI-restricted DNA with a T-DNA-specific probe identified two DNA fragments in the heterozygous mutant plants (Fig. 2
,
Gametophytic Development Is Altered in SDH1-1/sdh1-1 Heterozygous Mutant Plants
All the heterozygous SDH1-1/sdh1-1 mutant plants were phenotypically indistinguishable from the wild type during vegetative development, at least under the growth conditions used. To examine flower development we used some parameters of the phenotypic analysis platform described by Boyes et al. (2001)
Altogether, these observations suggest that both pollen and embryo sac development are compromised in the heterozygous SDH1-1/sdh1-1 mutant plants, and that the sdh1-1 mutation is gametophytic (Park et al., 1998
The T-DNA insertion in the SDH1-1/sdh1-1 mutant plants confers kanamycin resistance (Kanr). Segregation of Kanr was analyzed in the progeny of six selfed T2 heterozygous SDH1-1/sdh1-1 plants (Supplemental Table S1). From a total of 1,243 offspring, only 387 seedlings were kanamycin resistant. This segregation ratio of 0.5:1 for Kanr:Kans (kanamycin sensitive) is far below from the expected 3:1 segregation for a dominant resistant phenotype and from the 1:1 expected ratio for a fully penetrant mutation in either the male or female gametophyte, and is indicative of a gametophytic defect affecting both the male and female parents (Howden et al., 1998 Therefore, the sdh1-1 mutation is partially penetrant in the female gametophyte and fully penetrant in the male gametophyte, strongly suggesting that complex II activity is essential for pollen development and important for embryo sac development.
Our genetic analyses demonstrated that the male germ line was unable to transmit the sdh1-1 mutated allele and prompted us to analyze pollen development in detail. First, pollen of wild-type and SDH1-1/sdh1-1 plants was analyzed for viability by the staining method of Alexander (1969)
Second, we compared anther and pollen development in SDH1-1/sdh1-1 and wild-type plants (Fig. 5 ). Anther development has been divided into 14 stages based on morphological landmarks and cellular events visible under the light microscope (Sanders et al., 1999
Transmission electron microscopy was conducted on cross sections of wild-type and mutant SDH1-1/sdh1-1 anthers (Fig. 6 ). By the vacuolated microspore stage, mutant microspores were not detectably different from those of wild-type plants (Fig. 6, A and B; Owen and Makaroff, 1995
In SDH1-1/sdh1-1 anthers, wild-type-like pollen grains followed a normal developmental fate: generative cell occupies a more central location in the cytoplasm of the vegetative cell, the large vacuole is resorbed (Fig. 6E), and lipid bodies accumulate in the vegetative cells at the surface of the generative cell (Fig. 6F). Later, the cytoplasm of the vegetative cell becomes highly vacuolated (Fig. 6G). Neither of these landmarks of normal pollen development was observed in altered pollen grains. In these grains, autolysis led to the disintegration of cellular structures and progressive disappearance of cellular content (Fig. 6, H and I). Finally, pollen grains had collapsed completely (Fig. 6J).
Reduced seed set, accompanied by the presence of white, small senescing ovules, and reduced transmission of the sdh1-1 mutation through the female gametophyte, suggested defects in embryo sac maturation and led us to analyze the phenotype of female gametophytes. To do this, we allowed the female gametophytes within wild-type and heterozygous pistils to progress to the terminal developmental stage, in the absence of fertilization, and embryo sacs were examined under Nomarski optics. In ovaries of wild-type plants, all embryo sacs reached the terminal developmental stage, containing one secondary central cell nucleus, one egg cell nucleus, and two synergid cell nuclei (Fig. 7A ). In mutant plants, only 72.75% (n = 291) of embryo sacs displayed the wild-type phenotype (Fig. 7B). In addition, two abnormal phenotypes were observed. In 14.75% (n = 59) of the analyzed ovules, embryo sacs were arrested at the two-nucleate stage (Fig. 7C), and in 12.5% of the embryo sacs (n = 50) the overall morphology of the egg cell, central cell, and synergid cells was normal, yet polar nuclei failed to fuse (Fig. 7D). Therefore, 27% of the embryo sacs in SDH1-1/sdh1-1 plants were phenotypically mutant, a value in good agreement with the seed set reduction (33%).
Down-Regulation of SDH1-1 by RNA Interference Results in a Phenotype Similar to That of the Insertional Mutant
Since no other mutant alleles were available for SDH1-1, an RNA interference approach was used. Figure 8A
illustrates the construct: the 35S RNA promoter of the Cauliflower mosaic virus drives the transcription of partial SDH1-1 sequences cloned in sense and antisense orientations and separated by a plant intron. After formation of hairpin RNA structures (ihpRNA) and splicing, the resulting double-stranded RNA transcripts can cause posttranscriptional silencing of endogenous gene activity (Smith et al., 2000
T2 seeds from one of these two lines were germinated on kanamycin and five resistant seedlings were transferred to hydroponic medium. Northern-blot analysis was performed using RNA from these five transgenic plants and two wild-type plants. The results are shown in Figure 8B, with actin as a constitutive control. Compared to wild-type plants, all transgenic plants showed a decrease in the SDH1-1 mRNA levels. These RNAi plants were phenotypically indistinguishable from the wild type during sporophytic development. However, analysis of pollen viability by the staining method of Alexander showed varying percentages, ranging from 13.5% to 66.8% of dead, unviable pollen grains (Fig. 8, C and D). Moreover, seed set was significantly reduced in the transgenic plants bearing the RNAi construct (Fig. 8E). Interestingly, a correlation was found between the level of SDH1-1 mRNA expression and the degree of seed set reduction and pollen abortion (for instance, plant no. 5 showed the strongest reduction in mRNA, pollen viability, and seed set). In conclusion, plants in which SDH1-1 gene expression is decreased by dsRNA showed the same phenotype as the heterozygous insertional mutant plants, i.e. reduced seed set and pollen abortion.
SDH1 genes are interesting targets for reverse genetics analysis, to gain insights into the role of complex II in plants. Thus, we have characterized knockout alleles of SDH1-1 and SDH1-2 genes. The SDH1-2 gene appears to be dispensable, at least under the growth conditions used, presumably because the SDH1-1 gene encodes the predominant flavoprotein. Our results do not rule out a SDH1-2 nonessential role in a restricted group of cells or in a particular developmental stage, resulting in subtle beneficial characteristics. Such a hypothesis may provide an explanation for SDH1-2 integrity and conservation when compared to SDH1-1. Alternatively, SDH1 duplication may be very recent, evolutionarily speaking, and either SDH1-2 inactivation or SDH1-2 gain of a new function are under way. Molecular and genetic characterization of heterozygous SDH1-1/sdh1-1 mutant plants permit us to conclude that sdh1-1 is a gametophytic mutation affecting both male and female gametophyte development. SDH1-1 is essential for pollen development and the first defect was evident in sdh1-1 microspores at pollen mitosis I, the asymmetric mitosis that results in bicellular pollen grains. Mutant microspores never underwent mitosis, the large vacuole was not resorbed, and cellular content progressively disappeared. These results formally established that microspore mitochondria (and complex II) have an essential role in pollen development.
During male gametophyte development, defined as development of the haploid microspores, pollen grains show a very high metabolic activity. For instance, respiration rates are 10 times higher in pollen grains than in green tissues (Tadege and Kuhlemeier, 1997 In addition to its essential role during pollen development, SDH1-1 is important for normal embryo sac development. Although our data indicate that the SDH1-1 protein is essential for efficient megagametophyte development, a fraction of the gametophytes still remains functional. Therefore, these mutant gametophytes cannot be completely energy deficient. The more plausible explanations for this observation are (1) a stochastic inheritance and persistence of wild-type mitochondria from the diploid megaspore mother cell, which would result in variable depletion rates of SDH1-1 through cell division and protein turnover during embryo sac development, and/or (2) variable provision of nutrients (ATP, carbon skeletons) to the female gametophyte from the surrounding sporophytic cells. In this context, it is tempting to speculate that male mutant gametophytes have a more severe phenotype because more nutrients are carried from sporophytic tissues to the female than to the male gametophyte. These arguments may also explain why more than one phenotype was found in the mutant embryo sacs (see below).
During megagametogenesis, a functional haploid megaspore gives rise to the mature female gametophyte (Yadegari and Drews, 2004
Large collections of gametophytic mutants defective in female gametophyte development have been reported, and in some cases characterized with respect to the genes responsible for the observed defects (e.g. Christensen et al., 2002
Few defects in the respiratory chain and TCA cycle have been reported. For instance, a knockout mutation in a subunit of the NAD+-dependent isocitrate dehydrogenase has been described in Arabidopsis (Lin et al., 2004
The best-characterized respiratory chain mutant is a Nicotiana sylvestris mitochondrial mutant, CMS II. In this mutant, the mitochondrial nad7 gene encoding the NAD7 subunit of complex I is deleted, and mitochondria are impaired in complex I structure and function (Pla et al., 1995
Deficiencies of any of the four subunits of SDH are associated with a broad spectrum of human diseases, ranging from myo- and encephalopathies to aging and tumor formation (Rustin and Rötig, 2002 Although development and function of gametophytes are crucial for plant reproduction, relatively little is known about the genes required for, and the pathways involved in gametophytic development in flowering plants. An important question is whether plants exploit metabolism as a way to control development. We have found here that an apparent metabolic mutant shows developmental effects, raising the possibility that some developmental regulators exert their effects through the modulation of basic metabolic processes. Metabolic regulation thus should be considered as one possible effector pathway in models of genetic regulation of development.
Plant Material and Growth Conditions
Arabidopsis (Arabidopsis thaliana) ecotype Wassilewskija (Ws) seeds were cold treated for 48 h at 4°C in darkness and then germinated and grown hydroponically at 20°C to 24°C, under a 16-h light/8-h dark cycle (Gibeaut et al., 1997
The Arabidopsis Knockout Facility (AKF) alpha and BASTA populations (Sussman et al., 2000
The Salk Institute collection (Alonso et al., 2003 Arabidopsis Ws seeds from the positive AKF pools containing the sdh1-1 and sdh1-2 mutant alleles were obtained from the ABRC (Ohio State University, Columbus, OH). These T2 seeds were stratified, germinated, and grown as described above. To identify SDH1 mutant plants and eventually isolate plants homozygous for a mutation, seedlings were genotyped by a PCR-based approach, using total DNA extracted from one cotyledon or one small leaf. Briefly, tissue was homogenized in 100 µL of TNE/SDS buffer (0.2 M Tris-HCl pH 8.0, 0.25 M NaCl, 0.02 M EDTA, 0.5% [w/v] SDS), using a disposable pestle adapted to a portable drill. After a 5 min centrifugation at 14,000g, the DNA in the supernatant was precipitated with 1 volume of isopropanol, washed with 70% (v/v) ethanol, and resuspended in sterile water. The genotype of plants was determined by PCR using primers flanking the insertion point for the wild-type allele and a gene-specific and left border-specific (JL202) primer pair for the insertional mutant alleles. For SDH1-1, the wild-type allele was amplified with 5' CAACCTCAGCACATACATGCACAG 3' (primer 2 in Fig. 1A) and 5' CCATCTCATGCTTAACTCCACACA 3' (primer 3 in Fig. 1A), and the mutant allele with JL202 (primer 1 in Fig. 1A) and primer 2. For SDH1-2, the wild-type allele was amplified with 5' TATTTCACTGCTGCAACATTATGGGCTTT 3' (primer sdha3) and 5' GATGGACGGTCTCGATTAAACGGTTAGAT 3' (primer sdha4), and the mutant allele with JL202 and sdha4.
Total DNA was prepared from green leaves according to Ausubel et al. (1994)
A crude mitochondrial fraction was prepared from Arabidopsis in vitro-grown 18-d-old seedlings. All steps were performed at 2°C to 4°C. The tissue (1 g fresh weight) was chilled in 10 mL of ice-cold grinding buffer (0.03 M MOPS/KOH pH 7.5, 0.3 M Mannitol, 0.001 M EDTA, 0.004 M L-Cysteine, 0.1% [w/v] fatty acid-free bovine serum albumin [fraction V], 0.6% [w/v] Polyvinylpyrrolidone-40) and homogenized with a Dounce potter. The homogenate was filtered through Miracloth and the filtrate was centrifuged at 1,000g for 20 min. The supernatant was then centrifuged at 12,500g for 20 min and the pellet was suspended in washing buffer (0.03 M MOPS/KOH pH 7.5, 0.3 M Mannitol, 0.001 M EDTA). Both centrifugation steps were repeated. Finally, the pellet (crude mitochondrial fraction) was resuspended in 200 µL of washing buffer. Protein concentration was determined by the Bradford method (Bradford, 1976
SQR activity was determined as described by Miyadera et al. (2003)
Alexander staining of pollen was performed by incubating anthers from recently opened flowers in Alexander's solution for 15 min (Alexander, 1969
For transmission electron microscopy, samples were fixed in 3% (v/v) glutaraldehyde, 0.1 M sodium cacodylate, pH 7.2, and postfixed in 1% osmium tetroxide for 1 h, dehydrated in a graduate acetone series, embedded in Epon resin, and polymerized at 60°C for 24 h. Ultrathin sections (60 nm) were cut with a diamond knife (Micro Star) on a Sorvall MT-5000 microtome and mounted on 300 mesh copper grids. Sections were stained with 4% (w/v) uranyl acetate and lead citrate in methanol (Reynolds, 1963 To analyze the terminal phenotype of ovules, flowers were emasculated and ovules observed 48 h after emasculation. For this, wild-type and mutant pistils were dissected longitudinally with hypodermic needles, fixed overnight at room temperature in 50% (v/v) ethanol, 5% (v/v) glacial acetic acid, 10% (v/v) formaldehyde, and then cleared in chloral hydrate:glycerol:water (8g:2 mL:1 mL). Single ovules were dissected and viewed with a light microscope (Optiphot-2, Nikon) equipped for differential interference contrast (DIC). Images were captured using a Nikon Coolpix 4500 CCD digital camera.
A 225-bp fragment containing the 5' UTR and the first exon of SDH1-1 was PCR amplified using the forward primer 5' AAGCAGGCTACTAGTGTTCGCGTCTTCCT 3' and the reverse primer 5' CAAGAAAGCTGGGTAGAACCAGTGGAGA 3' (partial attB sites in italics, SpeI restriction site underlined). The resulting product, which contained at both ends partial attB recombination sites of the Gateway system (Invitrogen), was reamplified using primers attB1 (5' GGGGACAAGTTTGTACAAAAAAGCAGGCT 3') and attB2 (5' GGGGACCACTTTGTACAAGAAAGCTGGGT 3'). The PCR product (attB1:SDH1-1:attB2) was cloned into a pGEM-T easy vector (Promega) and sequenced. An in vitro recombination reaction was performed according to the manufacturer's protocol, using BP Clonase (Invitrogen), the vector pHELLSGATE4 (Helliwell et al., 2002
The following materials are available in the online version of this article.
The authors are greatly thankful to Alejandro Araya, Simon Litvak, and Laura Tarragó-Litvak for their constant encouragement. We also would like to thank Hannetz Roschzttardtz and Rodrigo Tapia for critical reading of the manuscript and constant discussion of results. Also, we thank to Bernard Hausser for technical advice on DIC microscopy and Sheila Johnson-Brousseau for experimental guidelines. We thank the AKF (University of Wisconsin) for mutant screens and for making T-DNA insertion lines publicly available through the ABRC. Received December 21, 2006; accepted February 14, 2007; published February 23, 2007.
1 This work was supported by the Fondecyt grant number 1060485 and Beca Apoyo Tesis Doctoral 2003 to G.L.
2 Present address: Núcleo Milenio de Biología Celular Vegetal, Centro de Biotecnología Vegetal, Universidad Andrés Bello, República 217, Santiago, Chile. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (http://www.plantphysiol.org) is: Xavier Jordana (xjordana{at}bio.puc.cl).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.095158 * Corresponding author; e-mail xjordana{at}bio.puc.cl; fax 5622225515.
Alexander MP (1969) Differential staining of aborted and non-aborted pollen. Stain Technol 44: 117122[Web of Science][Medline] Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653657 Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1994) Current Protocols in Molecular Biology. Wiley Interscience, New York Bourgeron T, Rustin P, Chretien D, Birch-Machin M, Bourgeois M, Viegas-Péquignot E, Munnich A, Rötig A (1995) Mutation of a nuclear succinate dehydrogenase gene results in mitochondrial respiratory chain deficiency. Nat Genet 11: 144149[CrossRef][Web of Science][Medline] Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Görlach J (2001) Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13: 14991510 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248254[CrossRef][Web of Science][Medline] Carrari F, Nunes-Nesi A, Gibon Y, Lytovchenko A, Ehlers Loureiro M, Fernie AR (2003) Reduced expression of aconitase results in an enhanced rate of photosynthesis and marked shifts in carbon partitioning in illuminated leaves of wild species tomato. Plant Physiol 133: 13221335 Christensen CA, Gorsich SW, Brown RH, Jones LG, Brown J, Shaw JM, Drews GN (2002) Mitochondrial GFA2 is required for synergid cell death in Arabidopsis. Plant Cell 14: 22152232 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline] De Buck S, Jacobs A, Van Montagu M, Depicker A (1999) The DNA sequences of T-DNA junctions suggest that complex T-DNA loci are formed by a recombination process resembling T-DNA integration. Plant J 20: 295304[Web of Science][Medline] De Neve M, De Buck S, Jacobs A, Van Montagu M, Depicker A (1997) T-DNA integration patterns in co-transformed plant cells suggest that T-DNA repeats originate from co-integration of separate T-DNAs. Plant J 11: 1529[CrossRef][Web of Science][Medline] Drews GN, Yadegari R (2002) Development and function of the angiosperm female gametophyte. Annu Rev Genet 36: 99124[CrossRef][Web of Science][Medline] Dutilleul C, Driscoll S, Cornic G, De Paepe R, Foyer CH, Noctor G (2003a) Functional mitochondrial complex I is required by tobacco leaves for optimal photosynthetic performance in photorespiratory conditions and during transients. Plant Physiol 131: 264275 Dutilleul C, Garmier M, Noctor G, Mathieu C, Chétrit P, Foyer CH, De Paepe R (2003b) Leaf mitochondria modulate whole cell redox homeostasis, set antioxidant capacity, and determine stress resistance through altered signaling and diurnal regulation. Plant Cell 15: 12121226 Elorza A, León G, Gómez I, Mouras A, Holuigue L, Araya A, Jordana X (2004) Nuclear SDH2-1 and SDH2-2 genes, encoding the iron-sulfur subunit of mitochondrial complex II in Arabidopsis, have distinct cell-specific expression patterns and promoter activities. Plant Physiol 136: 40724087 Elorza A, Roschzttardtz H, Gómez I, Mouras A, Holuigue L, Araya A, Jordana X (2006) A nuclear gene for the iron-sulfur subunit of mitochondrial complex II is specifically expressed during Arabidopsis seed development and germination. Plant Cell Physiol 47: 1421 Figueroa P, León G, Elorza A, Holuigue L, Araya A, Jordana X (2002) The four subunits of mitochondrial respiratory complex II are encoded by multiple nuclear genes and targeted to mitochondria in Arabidopsis thaliana. Plant Mol Biol 50: 725734[CrossRef][Web of Science][Medline] Figueroa P, León G, Elorza A, Holuigue L, Jordana X (2001) Three different genes encode the iron-sulfur subunit of succinate dehydrogenase in Arabidopsis thaliana. Plant Mol Biol 46: 241250[CrossRef][Web of Science][Medline] Gibeaut DM, Hulett J, Cramer GR, Seemann JR (1997) Maximal biomass of Arabidopsis thaliana using a simple, low-maintenance hydroponic method and favorable environmental conditions. Plant Physiol 115: 317319[CrossRef][Web of Science][Medline] Gutierres S, Sabar M, Lelandais C, Chétrit P, Diolez P, Degand H, Boutry M, Vedel F, de Kouchkovsky Y, De Paepe R (1997) Lack of mitochondrial and nuclear-encoded subunits of complex I and alteration of the respiratory chain in Nicotiana sylvestris mitochondrial deletion mutants. Proc Natl Acad Sci USA 94: 34363441 Hanson MR, Bentolila S (2004) Interactions of mitochondrial and nuclear genes that affect male gametophyte development. Plant Cell (Suppl) 16: S154169 Heiser V, Brennicke A, Grohmann L (1996) The plant mitochondrial 22 kDa (PSST) subunit of respiratory chain complex I is encoded by a nuclear gene with enhanced transcript levels in flowers. Plant Mol Biol 31: 11951204[CrossRef][Web of Science][Medline] Helliwell CA, Wesley SV, Wielopolska AJ, Waterhouse PM (2002) High-throughput vectors for efficient gene silencing in plants. Funct Plant Biol 29: 12171225[CrossRef] Honys D, Twell D (2004) Transcriptome analysis of haploid male gametophyte development in Arabidopsis. Genome Biol 5: R85 Howden R, Park SK, Moore JM, Orme J, Grossniklaus U, Twell D (1998) Selection of T-DNA-tagged male and female gametophytic mutants by segregation distortion in Arabidopsis. Genetics 149: 621631 Huang J, Friedhelm S, Matzinger DF, Levings CS III (1994) Flower-enhanced expression of a nuclear-encoded mitochondrial respiratory protein is associated with changes in mitochondrion number. Plant Cell 6: 439448[Abstract] Johnson-Brousseau SA, McCormick S (2004) A compendium of methods useful for characterizing Arabidopsis pollen mutants and gametophytically-expressed genes. Plant J 39: 761775[CrossRef][Web of Science][Medline] Landschütze V, Willmitzer L, Müller-Rober B (1995) Inhibition of flower formation by antisense repression of mitochondrial citrate synthase in transgenic potato plants leads to a specific disintegration of the ovary tissues of flowers. EMBO J 14: 660666[Web of Science][Medline] Lee B, Lee H, Xiong L, Zhu J-K (2002) A mitochondrial complex I defect impairs cold-regulated nuclear gene expression. Plant Cell 14: 12351251 Lee SLJ, Warmke HE (1979) Organelle size and number in fertile and T-cytoplasmic male-sterile corn. Am J Bot 60: 141148[CrossRef] Lemire BD, Oyedotun KS (2002) The Saccharomyces cerevisiae mitochondrial succinate: ubiquinone oxidoreductase. Biochim Biophys Acta 1553: 102116[Medline] Lin M, Behal RH, Oliver DJ (2004) Characterization of a mutation in the IDH-II subunit of the NAD+-dependent isocitrate dehydrogenase from Arabidopsis thaliana. Plant Sci 166: 983988 McCormick S (2004) Control of male gametophyte development. Plant Cell (Suppl) 16: S142S153 Meyers BC, Vu TH, Tej SS, Ghazal H, Matvienko M, Agrawal V, Ning J, Haudenschild CD (2004) Analysis of the transcriptional complexity of Arabidopsis thaliana by massively parallel signature sequencing. Nat Biotechnol 22: 10061011[CrossRef][Web of Science][Medline] Millar HA, Eubel H, Jänsch L, Kruft V, Heazlewood JL, Braun HP (2004) Mitochondrial cytochrome c oxidase and succinate dehydrogenase complexes contain plant specific subunits. Plant Mol Biol 56: 7790[CrossRef][Web of Science][Medline] Miyadera H, Shiomi K, Ui H, Yamaguchi Y, Masuma R, Tomoda H, Miyoshi H, Osanai A, Kita K, Omura S (2003) Atpenins, potent and specific inhibitors of mitochondrial complex II (succinate-ubiquinone oxidoreductase). Proc Natl Acad Sci USA 100: 473477 Niewiadomski P, Knappe S, Geimer S, Fischer K, Schulz B, Unte US, Rosso MG, Ache P, Flügge U-I, Schneider A (2005) The Arabidopsis plastidic glucose 6-phosphate/phosphate translocator GPT1 is essential for pollen maturation and embryo sac development. Plant Cell 17: 760775 Nunes-Nesi A, Carrari F, Lytovchenko A, Smith AMO, Ehlers Loureiro M, Ratcliffe RG, Sweetlove LJ, Fernie AR (2005) Enhanced photosynthetic performance and growth as a consequence of decreasing mitochondrial malate dehydrogenase activity in transgenic tomato plants. Plant Physiol 137: 611622 Owen HA, Makaroff CA (1995) Ultrastructure of microsporogenesis and microgametogenesis in Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija (Brassicaceae). Protoplasma 185: 721[CrossRef][Web of Science] Pagnussat GC, Yu H-J, Ngo QA, Rajani S, Mayalagu S, Johnson CS, Capron A, Xie L-F, Ye D, Sundaresan V (2005) Genetic and molecular identification of genes required for female gametophyte development and function in Arabidopsis. Development 132: 603614 Park SK, Howden R, Twell D (1998) The Arabidopsis thaliana gametophytic mutation gemini pollen1 disrupts microspore polarity, division asymmetry and pollen cell fate. Development 125: 37893799[Abstract] Piruat JI, Pintado CO, Ortega-Sáenz P, Roche M, López-Barneo J (2004) The mitochondrial SDHD gene is required for early embryogenesis, and its partial deficiency results in persistent carotid body glomus cell activation with full responsiveness to hypoxia. Mol Cell Biol 24: 1093310940 Pla M, Mathieu C, De Paepe R, Chétrit P, Vedel F (1995) Deletion of the last two exons of the mitochondrial nad7 gene results in lack of the NAD7 polypeptide in a Nicotiana sylvestris CMS mutant. Mol Gen Genet 248: 7988[CrossRef][Web of Science][Medline] Portereiko MF, Sandaklie-Nikolova L, Lloyd A, Dever CA, Otsuga D, Drews GN (2006) NUCLEAR FUSION DEFECTIVE1 encodes the Arabidopsis RPL21M protein and is required for karyogamy during female gametophyte development and fertilization. Plant Physiol 141: 957965 Reynolds ES (1963) The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J Cell Biol 17: 208212 Rustin P, Rötig A (2002) Inborn errors of complex IIunusual human mitochondrial diseases. Biochim Biophys Acta 1553: 117122[Medline] Sabar M, De Paepe R, de Kouchkovsky Y (2000) Complex I impairment, respiratory compensations, and photosynthetic decrease in nuclear and mitochondrial male sterile mutants of Nicotiana sylvestris. Plant Physiol 124: 12391250 Sanders PM, Bui AQ, Weterings K, McIntire KN, Hsu Y-C, Lee PY, Truong MT, Beals TP, Goldberg RB (1999) Anther developmental defects in Arabidopsis thaliana male-sterile mutants. Sex Plant Reprod 11: 297322[CrossRef] Scheffler IE (1998) Molecular genetics of succinate:quinone oxidoreductase in eukaryotes. Progr Nucleic Acid Res Mol Biol 60: 267315[Web of Science][Medline] Schmid M, Davison TS, Henz SR, Pape UJ, Demar M, Vingron M, Schölkopf B, Weigel D, Lohmann JU (2005) A gene expression map of Arabidopsis thaliana development. Nat Genet 37: 501506[CrossRef][Web of Science][Medline] Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P, Bacwaden J, Ko C, et al (2002) A high-throughput Arabidopsis reverse genetics system. Plant Cell 14: 29852994 Smart CJ, Monéger F, Leaver CJ (1994) Cell-specific regulation of gene expression in mitochondria during anther development in sunflower. Plant Cell 6: 811825[Abstract] Smith NA, Singh SP, Wang M-B, Stoutjesdijk PA, Green AG, Waterhouse PM (2000) Total silencing by intron-spliced hairpin RNAs. Nature 407: 319320[CrossRef][Medline] Sussman MR, Amasino RM, Young JC, Krysan PJ, Austin-Phillips S (2000) The Arabidopsis knockout facility at the University of Wisconsin-Madison. Plant Physiol 124: 14651467 Tadege M, Kuhlemeier C (1997) Aerobic fermentation during tobacco pollen development. Plant Mol Biol 35: 343354[CrossRef][Web of Science][Medline] Yadegari R, Drews GN (2004) Female gametophyte development. Plant Cell (Suppl) 16: S133S141 Yankovskaya V, Horsefield R, Törnroth S, Luna-Chavez C, Miyoshi H, Léger C, Byrne B, Cecchini G, Iwata S (2003) Architecture of succinate dehydrogenase and reactive oxygen species generation. Science 299: 700704 Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004) Genevestigator: Arabidopsis microarray database and analysis toolbox. Plant Physiol 136: 26212632 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|