OPEN ACCESS ARTICLE

This Article Free via Open Access: OA OA Abstract Full Text (PDF) A correction has been published OA All Versions of this Article: 143/4/1547    most recent pp.107.096396v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via CrossRef Citing Articles via ISI Web of Science (2) Citing Articles via Google Scholar Google Scholar Articles by Park, S. Articles by Melis, A. Search for Related Content PubMed PubMed Citation Articles by Park, S. Articles by Melis, A. Agricola Articles by Park, S. Articles by Melis, A.

BIOENERGETICS AND PHOTOSYNTHESIS

REP27, a Tetratricopeptide Repeat Nuclear-Encoded and Chloroplast-Localized Protein, Functions in D1/32-kD Reaction Center Protein Turnover and Photosystem II Repair from Photodamage^1,[OA]

Department of Plant and Microbial Biology, University of California, Berkeley, California, 94720–3102

	ABSTRACT

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 
The goal of this research is elucidation of the molecular mechanism for the unique photosystem II (PSII) damage and repair cycle in chloroplasts. A frequently occurring, irreversible photooxidative damage inhibits the PSII charge separation reaction and stops photosynthesis. The chloroplast PSII repair process rectifies this adverse effect by selectively removing and replacing the photoinactivated D1/32-kD reaction center protein (the chloroplast-encoded psbA gene product) from the massive (>1,000 kD) water-oxidizing and O₂-evolving PSII holocomplex. DNA insertional mutagenesis in the model organism Chlamydomonas reinhardtii was applied for the isolation and characterization of rep27, a repair-aberrant mutant. Gene cloning and biochemical analyses in this mutant resulted in the identification of REP27, a nuclear gene encoding a putative chloroplast-targeted protein, which is specifically required for the completion of the D1 turnover process but is not essential for the de novo biogenesis and assembly of the PSII holocomplex in this model green alga. The REP27 protein contains two highly conserved tetratricopeptide repeats, postulated to facilitate the psbA mRNA cotranslational insertion of the nascent D1 protein in the existing PSII core template. Elucidation of the PSII repair mechanism may reveal the occurrence of hitherto unknown regulatory and catalytic reactions for the selective in situ replacement of specific proteins from within multiprotein complexes.

The PSII holocomplex performs the functions of light absorption and excitation energy transfer to P680, leading to water oxidation, the release of O₂ and protons, and the transport of electrons from water to reduce plastoquinone molecules in the thylakoid membrane. The transient formation of strong oxidants, the abundance of O₂, and the presence of excitation energy are conditions that may lead to photooxidative damage (Ohad et al., 1984; Barber, 1994; Melis, 1999), causing irreversible inactivation in the electron-transport function of the D1 protein and inhibiting the function of PSII (Kok, 1956; Powles, 1984; Melis, 1991; Aro et al., 1993). An elaborate repair mechanism operates in organisms of oxygenic photosynthesis and restores the functional status of PSII. The PSII damage and repair cycle, as the phenomenon has come to be known (Guenther and Melis, 1990), operates in tandem with photosynthesis and appears to be conserved in cyanobacteria, algae, and crop plants.

The rate constant of photodamage is proportional to the incident light intensity (Baroli and Melis, 1996; Tyystjarvi and Aro, 1996; Hakala et al., 2005; Ohnishi et al., 2005). Thus, photodamage can occur with a half time as slow as 24 h under very low light intensity conditions, or as fast as 30 min under bright sunlight (Kim et al., 1993; Yokthongwattana and Melis, 2006). The rate-limiting step in the enzymatic repair of PSII occurs with a half time of about 2 h (Sundby et al., 1993; Vasilikiotis and Melis, 1994; Neidhardt et al., 1998). This defines the overall rate constant for the repair process and is largely independent of the light intensity to which the photosynthetic organism is exposed.

In PSII repair-aberrant mutants of C. reinhardtii, water oxidation and electron transport capacity depend on the balance between de novo biogenesis/assembly of PSII complexes (presence of acetate) and the rate of photodamage. Therefore, in repair-aberrant mutants, the degree of photoinhibition of photosynthesis can be manipulated by the relative dominance of these two players, i.e. de novo biogenesis/assembly and photodamage of PSII. In the presence of acetate and under weak light intensities, when the rate of de novo biogenesis/assembly of PSII is comparable to that of photodamage, intermediate levels of photoinhibition will manifest in relation to a wild-type control. Stronger light intensities, however, would make the rate of photodamage far exceed the rate of de novo biogenesis/assembly, causing a quantitative accumulation of photodamaged PSII and the end of detectable photosynthetic water oxidation activity.

In this study, DNA insertional mutagenesis of C. reinhardtii was employed to generate and isolate PSII repair mutants. The appropriate screening steps (Zhang et al., 1997) resulted in the isolation of rep27, a C. reinhardtii strain that is defective in photoautotrophic growth, which, however, greens normally in the presence of acetate and displays a lowered photosynthetic water oxidation and CO₂ conversion activity when grown under low irradiance conditions. Under moderate and high light intensity conditions, PSII activity is selectively abolished in this mutant, suggesting a defect in the repair from photodamage. Gene cloning and biochemical analyses in this PSII repair-aberrant mutant resulted in the identification of REP27, a nuclear gene encoding a putative chloroplast-targeted protein, which is specifically required for the completion of the D1 turnover process but is not essential for the de novo biogenesis/assembly of the PSII holocomplex in this model green alga. A working hypothesis model is presented, postulating a function of the REP27 protein in the psbA mRNA translation and/or cotranslational insertion of nascent D1 in existing PSII core templates.

	RESULTS

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 

Isolation and Characterization of rep27, a Putative PSII Repair Mutant

A putative PSII repair mutant, termed rep27, was isolated following DNA insertional mutagenesis and on the basis of a stringent two-step screening protocol (Zhang et al., 1997). Acetate requirement was the first screening step in this protocol. Whereas both wild-type and rep27 mutant strains grew well on acetate-containing Tris-acetate phosphate (TAP) media, only the wild type grew on minimal Tris-bicarbonate-phosphate (TBP) media (Table I ; Fig. 1A ). Cellular chlorophyll (Chl) content was similar in wild type and rep27 mutant, about 3.4 x 10^–15 mol/cell when grown under 10 µmol photons m^–2 s^–1 (10 µE) and about 1.7 x 10^–15 mol/cell when grown under 150 µmol photons m^–2 s^–1 (150 µE). Moreover, wild type and rep27 displayed similar Chl a/b ratios (data not shown). These results suggested that in the presence of acetate, growth, Chl accumulation, as well as the assembly and acclimation properties of the photosynthetic apparatus were not affected by the rep27 mutation. When cultivated in TAP media under either 10- or 50-µE conditions, the wild type displayed a slightly faster rate of growth than the rep27 mutant (Fig. 1B).

View larger version (26K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 1. Phenotypic characterization of C. reinhardtii wild-type (cw15) and rep27 mutant strains. A, Growth of cw15 wild type and lack of growth of the rep27 mutant on TBP minimal media at 50 µmol photons m–2 s–1 (50 µE). B, Growth curves of wild type and rep27 in TAP liquid media under approximately 10- or 50-µE conditions. The values shown are the average of the three independent experiments. C, Efficiency of PSII primary photochemistry (Fv/Fm) measured as a function of growth irradiance for wild type and rep27 mutant. D, Light-saturated rate of oxygen evolution for wild type and rep27 mutant as a function of growth irradiance. Cells were grown in TAP for 3 d prior to the measurement. Values shown are the average from the two independent experiments.

The F_v/F_m fluorescence yield ratio was measured in C. reinhardtii cells grown under different irradiance regimes (10–150 µE; Fig. 1C). The ratio was lower in the rep27 mutant than in the wild type under all growth irradiance conditions, suggesting fewer functional PSII reaction centers in the former than in the latter. This was confirmed by sensitive absorbance difference spectrophotometry (A₃₂₀; Melis, 1989), which revealed a substantially lower concentration of the functional primary quinone acceptor (Q_A) in the mutant than in the wild type. For cells grown at 150 µE, analysis showed Q_A/Chl (wild type) = 1:560 mol:mol; Q_A/Chl (rep27) = 1:1,800 mol:mol, whereas P700/Chl ratios were similar at about 1:650 mol:mol in each of these the two strains. Accordingly, the operational PSII/PSI ratio was lowered in the rep27 mutant in an irradiance-dependent fashion (Table I). These results are consistent with the interpretation that the rep27 strain is a putative PSII repair mutant.

To independently assess the functional capacity of PSII, the light-saturated rate of photosynthesis (Pmax) was measured (Fig. 1D). Wild type and rep27 mutant were grown at three different irradiances (10, 50, and 150 µE) and Pmax was measured from the rate of oxygen evolution in a Clark-type oxygen electrode under saturating illumination conditions. Figure 1D shows that Pmax for the wild type increased with growth irradiance, as is expected upon acclimation of the photosynthetic apparatus to the level of irradiance (Anderson, 1986; Baroli and Melis, 1996). On the contrary, Pmax for the rep27 declined with growth irradiance and dropped below the isosbestic point when grown at 150 µE, consistent with the repair-aberrant phenotype of this mutant. Under higher than 150 µE growth irradiance conditions, photosynthetic O₂ evolution in the rep27 mutant became negligible, and the only gas exchange reaction recorded was that of cellular respiration that consumed oxygen from the medium. These results are consistent with the notion that, at irradiance levels greater than 150 µE, the rate of photodamage was substantially greater than that of de novo PSII biogenesis/assembly, resulting in a quantitative PSII photoinhibition. Survival of the organism under these conditions is ensured by the presence of acetate, which supports oxidative phosphorylation by the cells.

The F_v/F_m ratio of the rep27 mutant did not exceed 0.4, irrespective of whether cells were grown under low light or in the dark. At present, it is not clear why the rep27 cells have a lower than wild type F_v/F_m ratio. The possibility cannot be excluded that, although PSII biogenesis/de novo assembly and the PSII repair processes occur in different regions of the chloroplast thylakoid membrane and likely involve substantially different mechanisms, they may nevertheless utilize at least some common enzymatic reactions, possibly including the one catalyzed by the REP27 protein. Further work is needed to delineate these points.

Biochemical Analysis of Wild-Type and rep27 Strains

Figure 2A (D1) shows that the rep27 mutant has lower than wild-type steady-state levels of the D1/32-kD reaction center protein in its thylakoid membranes, consistent with earlier finding on this mutant (Zhang et al., 1997). Figure 2A also shows that subunits of the PSII holocomplex, other than the D1 reaction center (e.g. D2, CP47, and PsbO), occur in equivalent amounts in the wild type and rep27 mutant. This observation offers additional evidence that de novo biogenesis/assembly of the PSII holocomplex is not impaired in the rep27 mutant. Rather, the effect of the mutation appears to be specific to the replacement (turnover) of the photodamaged D1. Figure 2B shows that subunits of non-PSII complexes in thylakoids, e.g. Cyt b6-f, PSI, and ATP synthase, also occur in equivalent amounts in wild type and rep27 mutant. This observation strengthens the interpretation that biogenesis/assembly of the thylakoid membrane and the electron transport chain are not impaired in the rep27 mutant. Somewhat enhanced HSP70B protein accumulation was observed in the rep27 mutant relative to that in the wild type (Fig. 2B). This could be attributed to the apparently inhibited and, therefore, unfinished repair in the rep27 mutant (accumulation of the PSII repair intermediate; Yokthongwattana et al., 2001).

View larger version (50K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 2. A, Western-blot analysis of 50-µE grown C. reinhardtii wild type and rep27 total protein cell extract. The steady-state level of PSII subunits was determined from the intensity of the antibody cross-reaction in the western blots with specific polyclonal antibodies generated against D1, D2, CP47, and PsbO, respectively. B, Western-blot analysis of 50-µE grown wild type and rep27 total protein cell extract. The steady-state level of these thylakoid membrane proteins was determined from the intensity of the antibody cross-reaction in the western blots with specific polyclonal antibodies generated against PsaK, Cyt f, PetC, AtpA, and Hsp70B.

One possible scenario for the presence of lower steady-state levels of the D1 protein in the rep27 mutant might be a defect in the incorporation of nascent D1 in the photodamaged PSII core complex. This hypothesis requires that psbA gene transcription and mRNA levels are about the same in wild type and rep27 mutant. Steady-state levels of psbA and psbD mRNA were measured by northern-blot analysis (Fig. 3A ), showing that psbA mRNA levels in mutant and wild type were indistinguishable from each other. Interestingly, rep27 showed somewhat enhanced steady-state levels of psbD mRNA relative to the wild type, underlining the greater relative amounts of D2 protein in the mutant (Fig. 3A) relative to that in the wild type.

View larger version (66K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 3. A, Northern-blot analysis of total RNA from 50-µE grown wild-type and rep27 mutant strains separated onto 1.5% agarose gel. Following transfer to a nylon membrane, samples were treated with radiolabeled psbA and psbD cDNA. The C. reinhardtii rRNA loading control is shown at the bottom. B, Autoradiogram of [35S]-radiolabeled proteins in C. reinhardtii. Chloroplast protein biosynthesis was conducted in vivo under 50 µE illumination for a period of 10 min (pulse) in the presence of [35S]-Na2SO4. [35S]-radiolabeled proteins were visualized upon exposure of the SDS-PAGE onto a radioactivity detector. The protein positions corresponding to D1, D2, Rubisco large subunit (LSU), and ATP synthase -subunit (CF1) are denoted. Minor rep27-specific protein bands are denoted by asterisk, while black circles denote wild-type-specific bands.

Figure 3B shows about equivalent amounts of large subunit of Rubisco, ATP synthase -subunit (CF1-), and D2 protein that were labeled in wild type and mutant. These provide a measure of the de novo biogenesis/assembly and accumulation of chloroplast components as a function of cell growth in the presence of acetate. Interestingly, in the rep27, but not in the wild type, radiolabeled D1 and D2 accumulated in about equal amounts, evidence that de novo biogenesis/assembly of D1 is not affected in the mutant. However, the wild type showed a much greater accumulation of radiolabeled D1 than the mutant, consistent with the active turnover of this PSII reaction center protein. These results are evidence of selective inhibition of the D1 turnover/PSII repair and lack of impairment in the de novo biogenesis/assembly of the PSII complex during cell growth in the mutant. In sum, except for the remarkable disparity of D1 radiolabeling in wild type and rep27, the labeling of other PSII and thylakoid membrane proteins was found to occur in equivalent amounts in the two strains.

Deletion of Genomic DNA upon pJD67 Plasmid DNA Insertion in rep27

Backcrosses of rep27 (mt+) and strain CC1068 (mt–) revealed that the repair-aberrant rep27 phenotype cosegregated with the ARG7 tag that was employed to generate the insertional mutagenesis library (data not shown). To determine the copy number of pJD67 plasmid insertions in rep27, Southern-blot analysis with the wild type and rep27 genomic DNA was carried out, as follows. ARG7-NdeI primer set (Table II ) was used to PCR amplify a 0.75-kb NdeI/NdeI DNA fragment, derived from the 3' end of the ARG7 plasmid, as indicated in Figure 4 . This DNA fragment of the Arg-7 gene was employed as a probe in Southern-blot analysis of wild-type and rep27 genomic DNA, digested with NcoI or HpaI restriction enzymes. Figure 4A shows a single hybridization band between the probe and the wild-type genomic DNA corresponding to the endogenous inactive ARG7 gene. The rep27 showed polymorphism with two distinct hybridization bands between probe and mutant genomic DNA. In addition to the endogenous ARG7 gene, a single extra DNA band was observed, confirming a single pJD67 plasmid insertion in the rep27 mutant genome (Fig. 4A; see also Yokthongwattana and Melis, 2006).

View larger version (21K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 4. A, Southern-blot analysis of C. reinhardtii genomic DNA using the NdeI/NdeI 3' end of the Arg-7 gene on NcoI or HpaI digested wild-type and rep27 genomic DNA. Black arrows indicate the position of the intrinsic inactivated ARG7 genes in the wild-type and rep27 DNA and white arrows show the position of a single additional band resulting from the insert DNA in the rep27 mutant. B, C. reinhardtii genomic DNA map, derived from the JGI Chlamydomonas Genome Project, showing the relative position of five ORFs (scaffold 8, contigs 25 and 26) and the insertion locus of pJD67. Restriction enzyme sites (NcoI and HpaI) used in the digestion of genomic DNA and the position of probes for Southern-blot analysis (NdeI/NdeI) are indicated on the pJD67 plasmid. The dotted rectangle in the 5' end of the pJD67 shows the missing pBluescript portion, apparently deleted during the pJD67 insertion. Also indicated by opposite-facing arrows is the location of six primer sets (RT0–RT5). Four subclones (1A, 2A, 4A, and 8) isolated from BAC clone 10A5 were used for the rep27 complementation experiments. TAIL-PCR amplified fragment (TAIL) and the position of the TPB primer for the TAIL-PCR also shown.

To define the opposite (5' end) site of the pJD67 insertion locus, we designed six marker primer sets for PCR-based diagnostic analysis (RT0–RT5; Fig. 4B; Table II). Reverse transcription (RT)-PCR results with the RT0 to RT5 set of primers revealed that a 25-kb fragment of the C. reinhardtii genomic DNA, encompassing the RT1-RT4 loci, was missing and apparently deleted during the pJD67 insertional event (Fig. 4B). Four ORFs were annotated in the missing fragment of the Chlamydomonas genomic DNA. Of those, ORF1 (Fig. 4B, shaded) turned out to be the gene necessary and sufficient to alleviate the acetate-requiring phenotype of the rep27 strain (please see below).

The TAIL-PCR-amplified genomic DNA flanking the insertion site was subsequently used as a probe for the screening of a C. reinhardtii bacterial artificial chromosome (BAC) genomic library, obtained from the Clemson University Genomics Institute (https://www.genome.clemson.edu/). Four BAC clones (27N13, 10C5, 10A5, and 10K12) hybridized to the TAIL-PCR-amplified genomic DNA fragment (data not shown). Restriction patterns of these BAC clones showed that they were identical to each other and contained the missing 25-kb genomic DNA fragment of rep27 (data not shown).

Complementation of rep27 with BAC Clone and Subcloned Genomic DNA

BAC clone 10A5 was used to complement the rep27 acetate-requiring phenotype. Cotransformation of the rep27 mutant with the BAC clone 10A5 DNA was implemented with the pSL18 plasmid, conferring paramomycin resistance (Depege et al., 2003). Transformants were selected on TAP-agar plates containing 5 µg/mL paramomycin. To test whether BAC clone 10A5 complements the acetate-requiring phenotype of rep27, each BAC transformant (approximately 200 colonies in total) was replica plated onto paramomycin containing TAP-agar and TBP-agar media. One such transformant, which showed robust and unequivocally photoautotropic growth in TBP media (Fig. 5A , BAC-T), was recovered and further analyzed by PCR (Fig. 5B). A randomly selected BAC clone 10A5 transformant (BAC-C), which did not grow on TBP media, was chosen as a negative control for the molecular and PCR analysis. Genomic DNA from BAC-T and BAC-C were used as templates in these PCR amplifications. Figure 5B shows that RT0 and RT5 primer sets, probing a DNA region outside the deleted 25 kb in the rep27 strain, generated PCR products, consistent with the presence of this genomic DNA in the mutant. The RT1 primer set failed to generate PCR products in either BAC-T or BAC-C transformants, suggesting that ORF0 may not be responsible for the autotrophic growth properties of the BAC-T strain. RT2 primer set successfully generated PCR products from the BAC-T genomic DNA only, but not from the BAC-C DNA, suggesting that ORF1 is present in the BAC-T and might encode a protein that confers autotrophic growth properties of the BAC-T strain (Fig. 5B). RT3 primer set successfully generated PCR products in both BAC-T and BAC-C transformants. Conversely, RT4 primer set generated PCR products in the BAC-C but not in the BAC-T transformant, suggesting that ORF3 may not be responsible for the autotrophic growth properties of the BAC-T strain. These results point to ORF1 as the likely gene candidate that confers autotrophic growth properties to the rep27 mutant. The results also provide testimony to the complex nature and unpredictable outcome of C. reinhardtii complementation by BAC clone DNA.

View larger version (53K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 5. A, Growth of wild type, rep27 mutant, and BAC clone 10A5 complemented rep27 strains on TBP minimal media under 50-µE irradiance. BAC clone 10A5, which contains the 25-kb deleted genomic DNA fragment, successfully rescued the acetate-requiring mutant phenotype in rep27 (BAC-T). BAC-C was randomly selected as a negative control for BAC-T. B, PCR characterization of BAC-T and BAC-C genomic DNA. PCR amplification of BAC-T and BAC-C was performed with a variety of different marker primer sets (RT0–RT5), as indicated.

The REP27 Gene Product Is Required for the PSII Repair

For further molecular and biochemical analysis, three independent transformant lines with subclone 4A were selected (rep27-complemented [rep27-comp] strains). In the subsequent physiological and biochemical analyses, and to alleviate crowding and enhance clarity of the presentation, results from only one line are reported. However, all three lines displayed similar properties to those of the rep27-comp strain shown.

RT-PCR with the RT2 primer set confirmed the presence of the REP27 transcript in the rep27-comp strains (data not shown). Because the rep27-comp strains were selected on the basis of growth on TBP-agar minimal media, which lack acetate, it was initially assumed that transcription of REP27 is necessary and sufficient to rescue the acetate-requiring phenotype of the rep27 mutant. To further test this hypothesis, the F_v/F_m fluorescence yield ratio and photosynthetic activity in wild-type, rep27 mutant, and rep27-comp strains were measured under a variety of growth conditions.

A phenotype of the rep27 mutation is the lower-than-wild-type F_v/F_m ratio under all growth irradiance conditions (Fig. 1C), consistent with the interpretation that the rep27 strain is a PSII repair-aberrant mutant (Zhang et al., 1997). The effect of light-shift experiments on the F_v/F_m value of the rep27-comp strains was compared to that of the wild type and rep27 mutant (Fig. 6A ). Cells grown under 10 µE were transferred to approximately 1,000 µE. Chl fluorescence yield parameters were measured as a function of exposure time to 1,000 µE (Fig. 6A). Prior to the light shift, F_v/F_m for the wild type and rep27-comp strain was high (about 0.78), whereas it was considerably lower for the rep27 mutant (0.37). F_v/F_m for rep27 decreased to nearly zero within 1 h under a 1,000-µE irradiance, whereas the F_v/F_m for the wild type and rep27-comp strains declined to about 0.45 in the same period of time. These results are consistent with the notion that rep27 is a PSII repair-aberrant mutant and that complementation of this strain with a wild-type copy of the REP27 gene rescues the mutation.

View larger version (24K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 6. Physiological and biochemical analyses of C. reinhardtii wild-type, rep27, and rep27-comp strains. A, Strains were grown on TAP under 10 µE and transferred to 1,000 µE for different periods of time. Fv/Fm was plotted as a function of incubation time in 1,000 µE. Values shown are the average of two independent experiments. B, The light-saturation curves of photosynthesis in wild-type, rep27, and rep27-comp strains grown in TAP under 10- or 50-µE conditions. Registration of the dark respiration in the cell suspension was followed by 5-min measurements of the rate of oxygen evolution at 500, 1,000, 1,500, 2,000, and 2,500 µE. The values shown are the average of two independent experiments. C, Western-blot analysis of total cell protein extracts from wild-type, rep27, and rep27-comp strains loaded on an equal Chl basis. Proteins were probed with specific anti-D1 polyclonal antibodies.

The preceding analysis suggested that rep27 undergoes a normal biogenesis/assembly of functional PSII units when grown in the presence of acetate, but cannot repair them when PSII photodamage occurs. There is thus a competition between the de novo biogenesis/assembly of functional PSII units in the presence of acetate and the irreversible inhibition of PSII due to photodamage in the rep27 mutant. This interpretation requires that either photodamaged and inactive D1 accumulates in the thylakoid membrane or, if the lesion is in a step subsequent to inactive D1 degradation, a depletion of the D1 protein in the mutant relative to that in the wild type. To delineate between these two different mechanistic alternatives, western-blot analysis was applied to assay steady-state levels of D1 protein in wild-type, rep27, and rep27-comp strains (Fig. 6C). It is seen that rep27 has substantially lower steady-state amounts of the D1 protein relative to the wild type, whereas the rep27-comp strain displayed levels of D1 that were comparable to those of the wild type. These results strengthened the notion that the rep27 lesion does not prevent degradation of the photodamaged and inactive D1, but it does interfere with the next step, i.e. the biosynthesis and/or cotranslational insertion of the nascent D1, thereby impeding the completion of the D1 protein turnover and the PSII repair process.

REP27 Gene Identification and Structure

To identify the transcription start site of the REP27 gene, 5' RNA ligase mediated-RACE was employed and resulted in the identification of 455 coding region nucleotides, in addition to those reported by the U.S. Department of Energy Joint Genome Institute (JGI) for ORF1 (Fig. 4). These occurred in the upstream region of the JGI-reported ORF1 translation initiation site. A full-length REP27 cDNA was subsequently isolated by RT-PCR amplification using 27P-F3 and 27E11-R1X primer set (Table II), which confirmed the extended REP27 coding sequence. The REP27 cDNA nucleotide sequence was deposited in the GenBank with accession number EF127650, predicted to encode a 449-amino acid putative precursor protein (Fig. 7A ), with a molecular mass of 49.5 kD for the precursor polypeptide and 45.6 kD for the mature protein. The REP27 genomic DNA was also predicted to contain a minimum of 11 exons and 10 introns.

View larger version (40K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 7. Deduced amino acid sequence alignments (ClustalW analysis; Higgins et al., 1994) of REP27 and its homologs. A, Database searches revealed that the deduced amino acid sequence of rice (Os01g0358300), Arabidopsis (At1g02910), and Ostreococcus (CAL55849) gene products are orthologs to that of REP27. Asterisks mark absolutely conserved residues among the four protein sequences. High and low similarity residues are marked by double or single dots, respectively. Vertical arrow indicates the predicted cleavage site of the chloroplast transit peptide targeting sequence. Solid lines and dotted lines over the amino acid sequences indicate the TPR motifs and predicted transmembrane helices, respectively. B, Phylogenetic tree showing the relative evolutionary proximity of the REP27 ortholog (Os01g0358300, At1g02910, and CAL55849) and paralog proteins (Os04g0507100 [rice], At2g28740 [Arabidopsis], CAL58275 [Ostreococcus], and C_142189 [Chlamydomonas]) based on the amino acid sequence comparisons.

Amino acid sequence analysis by ChloroP1.1 software (Emanuelsson et al., 1999) predicted that REP27 contains a chloroplast transit peptide. Similarly, application of the HMMTOP v2.0 software (Tusnady and Simon, 2001) pointed to the existence of two putative transmembrane helices in REP27 (amino acid regions TMH1 and TMH2 including amino acids 180–202 and 217–239, respectively; Fig. 7A), which may suggest that REP27 is a thylakoid membrane integral protein. Application of Inter-ProScan 13.1 software analysis (Quevillon et al., 2005) identified two distinct TRP motifs in REP27 (TPR1A/TPR1B and TPR2A/TPR2B; Fig. 7A). The helix-rich TPR motifs have been described in the literature to form a compact unit of two helices interacting with each other in the antiparallel direction. It is thought that such conserved TPR motifs are involved in a variety of critical protein-protein interactions in the living cell (for review, see Lamb et al., 1995) and are consistent with the putative role of the REP27 in the D1 turnover and PSII repair.

A search of the National Center for Biotechnology Information database revealed the occurrence of six REP27 homologs, including two copies each in rice (Oryza sativa), Arabidopsis (Arabidopsis thaliana), and Ostreococcus, a small unicellular green alga whose genomic DNA sequence and annotation recently became available (Derelle et al., 2006). Moreover, a search of the C. reinhardtii genomic DNA database revealed the occurrence of a REP27 homolog in this green alga. Accordingly, it appears that two copies of REP27 homologs are present in each of these photosynthetic organisms. These can be divided into two distinct groups: REP27 orthologs (Os01g0358300, rice; At1g02910, Arabidopsis; and CAL55849, Ostreococcus) contain the chloroplast transit peptide and two TPR motifs (Fig. 7A), while REP27 paralogs (Os04g0507100 for rice; At2g28740 for Arabidopsis; CAL58275 for Ostreococcus; and C_142189 for Chlamydomonas) are devoid of both a transit peptide and the TPR domains (data not shown). REP27 had about a 35% amino acid sequence identity with its orthologs (CAL55849, Os01g0358300, and At1g02910). However, it had limited similarity and that was only in the C-terminal half of the protein with the paralogs, which were devoid of transit peptide and TPR motifs.

The REP27 protein appears to exist only in grana-containing organisms of oxygenic photosynthesis. The phylogenetic comparison diagram in Figure 7B shows that REP27, CAL55849, Os01g0358300, and At1g02910 are grouped together and, therefore, closely related. Likewise, REP27 paralog proteins Os04g0507100, At2g28740, CAL58275, and C_142189 are closely related among them and distantly related to the former. This may suggest a distant phylogenetic relationship between the two groups of genes and proteins and points to the possibility that REP27-like genes in photosynthetic eukaryotes exist in pairs, one copy encoding a putative chloroplast-targeted protein, the other encoding a nonplastid counterpart.

Induction of REP27 Gene Expression by Irradiance and Requirement for D1 Protein Turnover But Not for de Novo PSII Biogenesis/Assembly

To test whether expression of the REP27 gene is constitutive or induced by irradiance, steady-state REP27 mRNA levels were measured before and after a shift in light intensity. Northern-blot analysis with a probe specific for the REP27 gene showed that 1,000 µE-treated wild-type cells had about 5 times more transcript accumulation than that of 50 µE-acclimated control cells (Fig. 8A ). This observation is consistent with the well-documented, irradiance-induced increase in repair gene expression, including ELIP/Cbr (Fig. 8B) and HSP70B (Yokthongwattana et al., 2001). Such increase in gene expression is though to be a meaningful response of the cells to the increased rates of photodamage and the need for enhanced rates of repair with increasing irradiance (Melis, 1999; Yokthongwattana and Melis, 2006).

View larger version (45K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 8. A, Northern-blot analysis probed with C. reinhardtii REP27-specific DNA. Wild-type cells, grown under 50-µE conditions (L), were incubated under high light (1,000 µE, H) for 1 h. Agarose gel lanes were loaded with 4 or 8 µg of total RNA from the 50 µE-grown (L) and 1,000 µE-exposed (H) cells, transferred to nylon membrane, and probed with a radiolabeled full-size REP27 cDNA probe. A (bottom), rRNA loading control. B, Northern-blot analysis probed with C. reinhardtii ELIP-specific DNA. Wild-type and rep27 mutant grown under 50-µE conditions were incubated under high light (1,000 µE) for 1 h. Agarose gel lanes were loaded with 4 µg of total RNA from the 50 µE-grown (L) and 1,000 µE-exposed (H) cells, transferred to nylon membrane, and probed with a radiolabeled full-size ELIP cDNA probe. Ribosomal RNA loading controls are shown at the bottom.

	DISCUSSION

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

Due to incomplete annotation of the C. reinhardtii genomic DNA sequencing in the REP27 locus, the true transcription initiation site for this gene was not available. 5' RACE PCR was performed in this work, resulting in the proper identification of the transcription initiation site and translation start locus of REP27, which is 261 bp upstream from the tentative translation start site reported by the JGI. A search of the GenBank database identified a pair of REP27 homologs in photoautotrophic eukaryotes, including Chlamydomonas, Arabidopsis, rice, and Ostreococcus (Fig. 7). REP27 orthologs contained both the transit peptide for chloroplast targeting of the protein, the two apparently conserved TPR motifs, and the two transmembrane domains. REP27 paralogs lacked both the transit peptide for chloroplast targeting of the protein and the two apparently conserved TPR motifs and are apparently cytosolic proteins.

An Arabidopsis T-DNA mutant was isolated in which the REP27 ortholog gene was interrupted by the T-DNA insertion. This mutant, termed lpa1 for low PSII accumulation (Peng et al., 2006), had many characteristics similar to those reported in this work for the rep27 mutant. However, contrary to the conclusions reached in this work, Peng et al. (2006) assigned a PSII biogenesis function to the LPA1 protein in Arabidopsis, as opposed to the specific D1 turnover function of the REP27 gene in this work.

TPR motif-containing proteins are widely encountered among a variety of organisms, including nonphotosynthetic bacteria, cyanobacteria, yeast (Saccharomyces cerevisiae), fungi, plants, animals, and humans (Blatch and Lassle, 1999). The number of TPR motifs is also variable, and no position preference exists with respect to their location along the primary polypeptide sequence. TPR domains are highly degenerate 34-amino acid repeats that are often arranged in tandem arrays, known to mediate protein-protein interactions (Lamb et al., 1995). Since the discovery of a TPR motif in soybean (Glycine max), several cases of TPR-containing proteins in eukaryotic chloroplasts have been reported and characterized (Hernandez Torres et al., 1995). For example, the subunits of the translocation machinery in the chloroplast envelope (Tic40 and Toc64) contain a single and three TPR motifs, respectively (Sohrt and Soll, 2000; Chou et al., 2003). Recent studies revealed that TPR domains in Toc64 are responsible for the recognition of precursor proteins targeted to the chloroplast (Qbadou et al., 2006). Moreover, a TPR motif in Tic40 is believed to form a cochaperone with HSP70B and/or ClpC (Chou et al., 2003), possibly helping in the translocation of proteins into the chloroplast and/or cleavage of the transit peptide sequence from the imported precursor protein.

The work presented in this article suggests that the REP27 protein is essential for the D1 reaction center protein turnover, probably facilitating translation and/or insertion of the nascent D1 in the vacated PSII reaction center template. It is of interest to speculate about the mechanistic role of TPR motifs in this process. TPR motifs are thought to be important factors in both transcription and translation processes. For example, Chlamydomonas Mbb1 and its Arabidopsis ortholog, HCF107, contains 10 and 11 TPR motifs, respectively, thought to be responsible for the mRNA stability and translation initiation of the plastidic psbH (Vaistij et al., 2000; Sane et al., 2005). NAC2, which has nine TPR motifs, is required for stable accumulation of the psbD mRNA in Chlamydomonas (Boudreau et al., 2000). A regulator of Chl biosynthesis, FLU, harbors two TPR motifs in its C terminus, which are required for interaction with glutamyl-tRNA reductase (Meskauskiene et al., 2001; Meskauskiene and Apel, 2002). A novel chloroplast protein, TCP34, with three TPR motifs, was localized in the fraction of transcriptionally active chloroplast chromosome, indicating that TPR motifs possessed the ability to bind plastid DNA (Weber et al., 2006). The Ycf3 mutant analysis also showed that TPR motifs are involved in the PSI stability via a direct interaction with PsaA and PsaD (Naver et al., 2001).

It is well known that molecular chaperones, such as the cytoplasmic HSP70 and HSP90, interact with a number of cochaperones that contain TPR motifs (for review, see Blatch and Lassle, 1999). In the chloroplast, Tic40 may bind to chloroplast ClpC and HSP70B (Chou et al., 2003). In the green algae Dunaliella salina, the presence of chloroplast-localized HSP70B was detected as a component of the transiently forming 320-kD PSII repair intermediate (Kim et al., 1993; Melis and Nemson, 1995; Yokthongwattana et al., 2001). It is possible (currently under investigation) that REP27 is also a component of this PSII repair intermediate, in a structure that may serve to preserve the conformation of the disassembled PSII core complex, from which the D1 protein has been temporarily vacated. Therefore, a working hypothesis is that the TPR motifs contained by the REP27 protein act as a receptor of the nascent D1 and are required for the proper guidance and insertion of the de novo-synthesized D1 protein in the existing PSII template. The REP27 and HSP70 proteins may act coordinately in the scaffold of the PSII repair intermediate in a process that facilitates the stability of the D1-less PSII complex and guides psbA cotranslational insertion of the de novo-synthesized D1 protein in the PSII template.

Figure 9 shows a preliminary schematic, aiming to illustrate the step(s) in the PSII repair process and the possible mechanism of action for the REP27 protein. Consistent with the evidence presented in this work, de novo biogenesis/assembly of PSII in the presence of acetate is possible in C. reinhardtii, leading to the formation of functional PSII. Photodamage by excess irradiance leads to irreversible inhibition in the function of the D1 protein, occurring in the appressed thylakoid membranes of the chloroplast. PSII disassembly, followed by degradation of the inactive D1, takes place in stroma-exposed thylakoids (Melis, 1991, 1999; Ossenbuhl et al., 2002), leading to a D1 vacancy from the PSII reaction center complex. The latter serves as a template for the insertion of a de novo-synthesized nascent D1 protein, a process catalyzed by the REP27 protein. According to this working hypothesis, the REP27 protein is essential for the incorporation of the nascent D1 but not for the de novo biogenesis/assembly of the PSII holocomplex. This model is consistent with the psbA mRNA association with thylakoid membranes, which is accentuated under conditions of enhanced photodamage and repair (Kettunen et al., 1997), underlining a cotranslational assembly of the D1 protein during the PSII repair (Zhang et al., 1999, 2000). In the rep27 mutant, incorporation of the nascent D1 in the PSII template during the D1 turnover process is inhibited, leading to the phenomenology described in this work.

View larger version (22K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 9. Schematic of the putative function of the REP27 protein in the D1 protein turnover and PSII repair process. REP27 is shown to play a role in the cotranslational insertion of a nascent D1 (pD1) in the D1-less PSII template during the PSII repair cycle. This step follows the PSII disassembly and specific degradation of photodamaged D1 in the thylakoid membrane.

	MATERIALS AND METHODS

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

Chlamydomonas reinhardtii mutants were generated by transformation (Kindle, 1990; Tam and Lefebvre, 1993) of an Arg auxotroph, strain CC-425 (arg7-8 cw15 mt + sr-u-2-60; Chlamydomonas Center, Duke University), with pJD67 plasmid DNA (linearized with HindIII) containing the complementing argininosuccinate lyase gene (ARG7), as described by Davies and Grossman (1994) and Davies et al. (1996). Procedures for the screening, isolation, and maintenance of putative repair mutants, including the rep27 strain, have also been described (Zhang et al., 1997). Wild type and rep27 of the green alga C. reinhardtii were grown mixotrophically in a TAP medium (Gorman and Levine, 1965), either in liquid cultures or on 1% agar plates. To test photoautotrophic growth of wild-type and complemented strains, cells were grown on TBP minimal media, in which sodium bicarbonate (25 mM, pH 7.4) replaced the acetate as the growth carbon source (Polle et al., 2003).

Culture density was measured by cell counting using a Neubauer ultraplane hemacytometer and a BH-2 light microscope (Olympus). Cells were grown to the early exponential growth phase (about 1–2 x 10⁶ cells/mL) prior to harvesting and measurements of photosynthesis.

Chlamydomonas BAC genomic DNA library filters and clones were acquired from the Clemson University Genomics Institute (https://www.genome.clemson.edu/).

Nucleic Acid Isolation and Analyses

To purify the genomic DNA of C. reinhardtii, cells were grown in liquid cultures, harvested by centrifugation, and resuspended in a cetyl-trimethyl-ammonium bromide buffer containing 2% cetyl-trimethyl-ammonium bromide, 100 mM Tris-HCl, pH 8.0, 1.4 M NaCl, 20 mM EDTA, and 2% -mercaptoethanol. The cell suspension was incubated at 65°C for 2 h, extracted twice with phenol-chloroform-isoamylalcohol (25:24:1), and precipitated with isopropanol (Chen and Melis, 2004).

Total RNA was isolated from the isopropanol pellet of the cell extract using Invitrogen's Trizol Reagent and by following the manufacturer's recommended procedure. 5' RACE by PCR was performed using FirstChoice RNA ligase mediated-RACE kit (Ambion) by following the manufacturer's recommended procedure.

Southern- and northern-blot analyses were carried out according to standard protocol (Sambrook et al., 1989). The high light induction of REP27 gene expression was tested upon shifting cultures from 50 to 1,000 µmol photons m^–2 s^–1 for 1 h prior to RNA isolation and by using the full size of the cDNA fragment as a probe in the measurement of transcript abundance.

Northern-blot analysis with early light-inducible protein (ELIP)-specific DNA was performed with a radiolabeled, full-size ELIP cDNA probe, which was amplified from C. reinhardtii with primer sets P02F = (GGGGGGATCCTTCGCTGCCTTTCGCGTTAC) and P03R = (GGGGGGATCCGGAACTTGTGTGTCGTTTAG).

Cloning of the Flanking Regions of the pJD67 Insertion Site

C. reinhardtii genomic DNA flanking the plasmid insertion site was amplified using a TAIL-PCR procedure, optimized for Chlamydomonas genomic DNA, by a modification of the method described (Dent et al., 2005). The primers used for the TAIL-PCR are listed in Table II. Briefly, flanking genomic DNA was amplified by PCR from the region adjacent to the inserted pJD67 plasmid that was used for DNA insertional mutagenesis (Zhang et al., 1997). For HindIII-digested pJD67 transformants, specific primers for primary, secondary, and tertiary reactions were designed and named TPB1, TPB2, and TPB3, respectively (Table II). Two arbitrary degenerate primers were tested for amplification, TPdeg1 and TPdeg2, as previously described (Dent et al., 2005). The general TAIL-PCR protocol of Liu et al. (1995) was used with some minor modifications for the various PCR amplification reactions. Nucleotide sequences of the resulting PCR products were obtained via an ABI3100 sequencer. Chlamydomonas genomic sequence information was obtained from the Chlamydomonas Genome Project Web site (http://genome.jgi-psf.org/Chlre3/Chlre3.home.html).

Insertional Mutagenesis and Chlamydomonas Transformation

Generation of a C. reinhardtii insertional mutagenesis library and screening for the identification of specific PSII repair mutants was implemented as previously described (Zhang et al., 1997). Complementation of the rep27 putative repair mutant was achieved by cotransformation of the mutant with BAC clone 10A5 and with subclones derived from this BAC with plasmid pSL18 (Depege et al., 2003), using the conventional glass bead transformation method (Kindle, 1990). pSL18 contains the paromomycin resistance gene (selectable marker) operated under the control of the C. reinhardtii Hsp70A and RbcS2 promoters (Sizova et al., 2001) and linked to the PsaD promoter and terminator that can be used to express ORFs in C. reinhardtii (Depege et al., 2003). C. reinhardtii transformants carrying the above-mentioned BAC clone(s) were selected on TAP (acetate-containing) or TBP (minimal media) plates containing 5 µg mL^–1 paromomycin (Sigma Chemical).

Photosynthesis Measurements

Procedures for the measurement of the F_v/F_m variable-to-maximal fluorescence yield ratio and for the Pmax have been described (Zhang et al., 1997). To test for the effect of high light exposure on photosynthesis and PSII parameters, cw15, rep27, and rep27-comp strains were incubated under 1,000 µE for variable periods of time. The photosynthetic activity of strains cw15, rep27, and rep27-comp lines was estimated from the light-saturation curve of photosynthesis, measured as the oxygen evolution activity of the cells at different actinic intensities. Measurements of the light-saturation curve of photosynthesis commenced with the registration of dark respiration in the cell suspension and were followed by measurements of the rate of oxygen evolution at 500, 1,000, 1,500, 2,000, and 2,500 µE. Registration of the rate (slope) of oxygen evolution at each light intensity step was recorded for about 5 min. Therefore, in the 30-min duration of these measurements, samples were exposed to progressively higher light intensities (0–2,500 µE).

Protein Analysis

For the isolation of total cellular protein, C. reinhardtii strains were grown in liquid TAP media under continuous illumination (50 µE). Cell biomass equivalent to 100 µg Chl were collected by centrifugation (5,000g) and resuspended in 400 µL of 0.1 M dithiothreitol and 0.1 M Na₂CO₃. Following incubation for 5 min, 400 µL of 2x sample solubilization buffer containing 10% SDS, 10% glycerol, and 10% -mercaptoethanol was added and incubated for 30 min at room temperature. To enhance the solubilization efficiency of SDS, the mix was incubated in boiling water for 2 min. Unsolubilized material was removed by centrifugation at 15,000g for 5 min prior to loading samples onto the SDS-PAGE.

The Chl concentration of the various suspensions was measured as previously described (Lichtenthaler, 1987). Aliquots corresponding to an equal amount of Chl were loaded in the wells of the stacking gel and electrophoresed through 12.5% SDS-polyacrylamide running gels as described by Tetali et al. (2007). The electrophoretically separated proteins were transferred onto nitrocellulose (Immobilon-NC, Millipore) and probed sequentially with primary specific polyclonal antibodies and horseradish peroxidase conjugated secondary antibodies (Bio-Rad).

Antibodies to D1, PetC, and AtpA subunit were described in Park and Rodermel (2004), and Hsp70b was described in Yokthongwattana et al. (2001). Antisera to PsaK, CytF, and PsbO were obtained as a kind gift from Dr. Paraq Chitnis. Specific polyclonal antibodies against D2 and CP47 were also described (Kim et al., 1993; Yokthongwattana et al., 2001). Cross-reactions between protein bands and antibodies were visualized by use of the Supersignal ECL (Pierce) detection kit following the manufacturer's specifications. Quantification of northern- and western-blot bands was made through application of the Imagej 1.37v software (http://rsb.info.nih.gov/ij/).

In Vivo (Pulse) Labeling with [³⁵S]-Sulfate

Radioactivity-labeling procedures were performed as previously described (Vasilikiotis and Melis, 1994; Preiss et al., 2001). Exponential growth phase cells of C. reinhardtii, equivalent to 60 µg Chl, were harvested by centrifugation at 5,000g for 5 min at room temperature. Pelleted cells were resuspended in 300 µL sulfur-deprived TAP to yield 0.2 µg Chl/µL and incubated for 2 h at room temperature under 50 µE. Cycloheximide (10 µg/mL) was added to block cytoplasmic protein synthesis and cells were incubated for 15 min prior to radioactive [³⁵S]-sulfate pulse treatment. The pulse was initiated upon addition of 100 µCi/mL [³⁵S]-sodium sulfate. At the end of a 10-min labeling period, 100 µg ml^–1 lincomycin and cold sulfate (1 mM final concentration) were added to terminate the labeling reaction. Radioactivity-labeled samples were collected by centrifugation, solubilized (as described above), and subjected to SDS-PAGE. Polyacrylamide gels were fixed in 20% methanol, 7% acetic acid for 30 min, vacuum dried, exposed to a phosphor screen, and analyzed by a Storm PhosphorImager (Molecular Dynamics).

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number EF127650.

	ACKNOWLEDGMENTS

 
Authors wish to thank Dr. Krishna Niyogi for a gift of the pSL18 plasmid.

Received January 23, 2007; accepted February 22, 2007; published March 2, 2007.

	FOOTNOTES

 
¹ This work was supported by the U.S. Department of Agriculture National Research Initiative (grant no. FD–2004–35100–14904).

² Present address: Department of Biochemistry, Faculty of Science Mahidol University, Rama VI Road, Bangkok 10400, Thailand.

³ Present address: Institute of Chemistry, Umea University, SE–901 87, Umea, Sweden.

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Anastasios Melis (melis{at}nature.berkeley.edu).

^[OA] Open Access articles can be viewed online without a subscription.

www.plantphysiol.org/cgi/doi/10.1104/pp.107.096396

^* Corresponding author; e-mail melis{at}nature.berkeley.edu; fax 510–642–4995.

	LITERATURE CITED

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 
Anderson JM (1986) Photoregulation of the composition, function and structure of thylakoid membranes. Annu Rev Plant Physiol 37: 93–136[CrossRef][Web of Science]

Aro EM, Virgin I, Andersson B (1993) Photoinhibition of photosystem II: inactivation, protein damage and turnover. Biochim Biophys Acta 1143: 113–134[Medline]

Baena-Gonzalez E, Allahverdiyeva Y, Svab Z, Maliga P, Josse EM, Kuntz M, Maenpaa P, Aro EM (2003) Deletion of the tobacco plastid psbA gene triggers an upregulation of the thylakoid-associated NAD(P)H dehydrogenase complex and the plastid terminal oxidase (PTOX). Plant J 35: 704–716[CrossRef][Web of Science][Medline]

Barber J (1994) Molecular basis of the vulnerability of PSII to damage by light. Aust J Plant Physiol 22: 201–208[Web of Science]

Baroli I, Melis A (1996) Photoinhibition and repair in Dunaliella salina acclimated to different growth irradiances. Planta 198: 640–646[Web of Science]

Bennoun P, Spierer-Herz M, Erickson J, Girard-Bascou J, Pierre Y, Delosme M, Rochaix JD (1986) Characterization of photosystem II mutants of Chlamydomonas reinhardtii lacking the psbA gene. Plant Mol Biol 6: 151–160[CrossRef][Web of Science]

Blatch GL, Lassle M (1999) The tetratricopeptide repeat: a structural motif mediating protein-protein interactions. Bioessays 21: 932–939[CrossRef][Web of Science][Medline]

Boudreau E, Nickelsen J, Lemaire SD, Ossenbuhl F, Rochaix JD (2000) The Nac2 gene of Chlamydomonas encodes a chloroplast TPR-like protein involved in psbD mRNA stability. EMBO J 19: 3366–3376[CrossRef][Web of Science][Medline]

Chen HC, Melis A (2004) Localization and function of SulP, a nuclear-encoded chloroplast sulfate permease in Chlamydomonas reinhardtii. Planta 220: 198–210[CrossRef][Web of Science][Medline]

Chou ML, Fitzpatrick LM, Tu SL, Budziszewski G, Potter-Lewis S, Akita M, Levin JZ, Keegstra K, Li HM (2003) Tic40, a membrane-anchored co-chaperone homolog in the chloroplast protein translocon. EMBO J 22: 2970–2980[CrossRef][Web of Science][Medline]

Cohen A, Yohn CB, Mayfield SP (2001) Translation of the chloroplast-encoded psbD mRNA is arrested post-initiation in a nuclear mutant Chlamydomonas reinhardtii. J Plant Physiol 158: 1069–1075[CrossRef][Web of Science]

Davies JP, Grossman AR (1994) Sequences controlling transcription of the Chlamydomonas reinhardtii beta 2-tubulin gene after deflagellation and during the cell cycle. Mol Cell Biol 14: 5165–5174[Abstract/Free Full Text]

Davies JP, Yildiz FH, Grossman A (1996) Sac1, a putative regulator that is critical for survival of Chlamydomonas reinhardtii during sulfur deprivation. EMBO J 15: 2150–2159[Web of Science][Medline]

Dent RM, Haglund CM, Chin BL, Kobayashi MC, Niyogi KK (2005) Functional genomics of eukaryotic photosynthesis using insertional mutagenesis of Chlamydomonas reinhardtii. Plant Physiol 137: 545–556[Abstract/Free Full Text]

Depege N, Bellafiore S, Rochaix JD (2003) Role of chloroplast protein kinase Stt7 in LHCII phosphorylation and state transition in Chlamydomonas. Science 299: 1572–1575[Abstract/Free Full Text]

Derelle E, Ferraz C, Rombauts S, Rouze P, Worden AZ, Robbens S, Partensky F, Degroeve S, Echeynie S, Cooke R, et al (2006) Genome analysis of the smallest free-living eukaryote Ostreococcus tauri unveils many unique features. Proc Natl Acad Sci USA 103: 11647–11652[Abstract/Free Full Text]

Emanuelsson O, Nielsen H, von Heijne G (1999) ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci 8: 978–984[Web of Science][Medline]

Erickson JM (1986) Lack of the D2 protein in a Chlamydomonas reinhardtii psbD mutant affects PSII stability and D1 expression. EMBO J 5: 1745–1754[Web of Science][Medline]

Gorman DS, Levine RP (1965) Cytochrome f and plastocyanin: their sequence in the photosynthetic electron transport chain of Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 54: 1665–1669[Free Full Text]

Guenther JE, Melis A (1990) The physiological significance of photosystem II heterogeneity in chloroplasts. Photosynth Res 23: 105–109[CrossRef][Web of Science]

Guenther JE, Nemson JA, Melis A (1990) Development of PSII in dark grown Chlamydomonas reinhardtii: a light-dependent conversion of PSII-, Q_B-nonreducing centers to the PSII-, Q_B-reducing form. Photosynth Res 24: 35–46[CrossRef][Web of Science]

Gumpel NJ, Purton S (1994) Playing tag with Chlamydomonas. Trends Cell Biol 4: 299–301[CrossRef][Medline]

Hakala M, Tuominen I, Keranen M, Tyystjarvi T, Tyystjarvi E (2005) Evidence for the role of the oxygen-evolving manganese complex in photoinhibition of photosystem II. Biochim Biophys Acta 1706: 68–80[Medline]

Hernandez Torres J, Chatellard P, Stutz E (1995) Isolation and characterization of gmsti, a stress-inducible gene from soybean (Glycine max) coding for a protein belonging to the TPR (tetratricopeptide repeats) family. Plant Mol Biol 27: 1221–1226[CrossRef][Web of Science][Medline]

Higgins DG, Thompson JD, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighing, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680[Abstract/Free Full Text]

Kettunen R, Pursiheimo S, Rintamaki E, van Wijk KJ, Aro EM (1997) Transcriptional and translational adjustments of psbA gene expression in mature chloroplasts during photoinhibition and subsequent repair of photosystem II. Eur J Biochem 247: 441–448[Web of Science][Medline]

Kim JH, Nemson JA, Melis A (1993) Photosystem II reaction center damage and repair in Dunaliella salina (green alga): analysis under physiological and irradiance-stress conditions. Plant Physiol 103: 181–189[Abstract]

Kindle KL (1990) High-frequency nuclear transformation of Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 87: 1228–1232[Abstract/Free Full Text]

Kitajima M, Butler WL (1975) Quenching of chlorophyll fluorescence and primary photochemistry in chloroplasts by dibromothymoquinone. Biochim Biophys Acta 376: 105–115[Medline]

Kok B (1956) On the inhibition of photosynthesis by intense light. Biochim Biophys Acta 21: 234–244[Medline]

Lamb JR, Tugendreich S, Hieter P (1995) Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci 20: 257–259[CrossRef][Web of Science][Medline]

Lichtenthaler HK (1987) Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol 148: 350–382[CrossRef][Web of Science]

Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J 8: 457–463[CrossRef][Web of Science][Medline]

Mattoo AK, Edelman M (1987) Intramembrane translocation and posttranslational palmitoylation of the chloroplast 32-kD herbicide-binding protein. Proc Natl Acad Sci USA 84: 1497–1501[Abstract/Free Full Text]

Melis A (1989) Spectroscopic methods in photosynthesis: photosystem stoichiometry and chlorophyll antenna size. Philos Trans R Soc Lond B Biol Sci 323: 397–409[Abstract/Free Full Text]

Melis A (1991) Dynamics of photosynthetic membrane composition and function. Biochim Biophys Acta 1058: 87–106

Melis A (1999) Photosystem-II damage and repair cycle in chloroplasts: what modulates the rate of photodamage? Trends Plant Sci 4: 130–135[CrossRef][Web of Science][Medline]

Melis A, Nemson JA (1995) Characterization of a 160 kD photosystem-II reaction center complex isolated from photoinhibited Dunaliella salina thylakoids. Photosynth Res 46: 207–211[CrossRef][Web of Science]

Meskauskiene R, Apel K (2002) Interaction of FLU, a negative regulator of tetrapyrrole biosynthesis, with the glutamyl-tRNA reductase requires the tetratricopeptide repeat domain of FLU. FEBS Lett 532: 27–30[CrossRef][Web of Science][Medline]

Meskauskiene R, Nater M, Goslings D, Kessler F, op den Camp R, Apel K (2001) FLU: a negative regulator of chlorophyll biosynthesis in Arabidopsis thaliana. Proc Natl Acad Sci USA 98: 12826–12831[Abstract/Free Full Text]

Minai L, Wostrikoff K, Wollman FA, Choquet Y (2006) Chloroplast biogenesis of photosystem II cores involves a series of assembly-controlled steps that regulate translation. Plant Cell 18: 159–175[Abstract/Free Full Text]

Naver H, Boudreau E, Rochaix JD (2001) Functional studies of Ycf3: its role in assembly of photosystem I and interactions with some of its subunits. Plant Cell 13: 2731–2745[Abstract/Free Full Text]

Neidhardt J, Benemann JR, Zhang L, Melis A (1998) Photosystem-II repair and chloroplast recovery from irradiance stress: relationship between chronic photoinhibition, light-harvesting chlorophyll antenna size and photosynthetic productivity in Dunaliella salina (green algae). Photosynth Res 56: 175–184[CrossRef][Web of Science]

Ohad I, Kyle DJ, Arntzen CJ (1984) Membrane protein damage and repair: removal and replacement of inactivated 32-kilodalton polypeptides in chloroplast membranes. J Cell Biol 99: 481–485[Abstract/Free Full Text]

Ohnishi N, Allakhverdiev SI, Takahashi FS, Higashi S, Watanabe M, Nishiyama Y, Murata N (2005) Two-step mechanism of photodamage to photosystem II: step 1 occurs at the oxygen-evolving complex and step 2 occurs at the photochemical reaction center. Biochemistry 44: 8494–8499[CrossRef][Medline]

Ossenbuhl F, Hartmann K, Nickelsen J (2002) A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5' untranslated region of the psbA mRNA. Eur J Biochem 269: 3912–3919[Web of Science][Medline]

Park S, Rodermel SR (2004) Mutations in ClpC2/Hsp100 suppress the requirement for FtsH in thylakoid membrane biogenesis. Proc Natl Acad Sci USA 101: 12765–12770[Abstract/Free Full Text]

Peng L, Ma J, Chi W, Guo J, Zhu S, Lu Q, Lu C, Zhang L (2006) LOW PSII ACCUMULATION 1 is involved in efficient assembly of photosystem II in Arabidopsis thaliana. Plant Cell 18: 955–969[Abstract/Free Full Text]

Polle JE, Kanakagiri SD, Melis A (2003) tla1, a DNA insertional transformant of the green alga Chlamydomonas reinhardtii with a truncated light-harvesting chlorophyll antenna size. Planta 217: 49–59[Web of Science][Medline]

Powles SB (1984) Photoinhibition of photosynthesis induced by visible light. Annu Rev Plant Physiol Plant Mol Biol 35: 15–44[CrossRef][Web of Science]

Preiss S, Schrader S, Johanningmeier U (2001) Rapid, ATP-dependent degradation of a truncated D1 protein in the chloroplast. Eur J Biochem 268: 4562–4569[Web of Science][Medline]

Qbadou S, Becker T, Mirus O, Tews I, Soll J, Schleiff E (2006) The molecular chaperone Hsp90 delivers precursor proteins to the chloroplast import receptor Toc64. EMBO J 25: 1836–1847[CrossRef][Web of Science][Medline]

Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N, Apweiler R, Lopez R (2005) InterProScan: protein domains identifier. Nucleic Acids Res 33: 116–120

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning. A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Sane AP, Stein B, Westhoff P (2005) The nuclear gene HCF107 encodes a membrane-associated R-TPR (RNA tetratricopeptide repeat)-containing protein involved in expression of the plastidial psbH gene in Arabidopsis. Plant J 42: 720–730[CrossRef][Web of Science][Medline]

Sizova I, Fuhrmann M, Hegemann P (2001) A Streptomyces rimosus aphVIII gene coding for a new type phosphotransferase provides stable antibiotic resistance to Chlamydomonas reinhardtii. Gene 277: 221–229[CrossRef][Web of Science][Medline]

Sohrt K, Soll J (2000) Toc64, a new component of the protein translocon of chloroplasts. J Cell Biol 148: 1213–1221[Abstract/Free Full Text]

Sundby C, McCaffery S, Anderson JM (1993) Turnover of the photosystem II D1 protein in higher plants under photoinhibitory and nonphotoinhibitory irradiance. J Biol Chem 268: 25476–25482[Abstract/Free Full Text]

Tam LW, Lefebvre PA (1993) Cloning of flagellar genes in Chlamydomonas reinhardtii by DNA insertional mutagenesis. Genetics 135: 375–384[Abstract]

Tetali SD, Mitra M, Melis A (2007) Development of the light-harvesting chlorophyll antenna in the green alga Chlamydomonas reinhardtii is regulated by the novel Tla1 gene. Planta 225: 813–829[CrossRef][Web of Science][Medline]

Tusnady GE, Simon I (2001) The HMMTOP transmembrane topology prediction server. Bioinformatics 17: 849–850[Abstract/Free Full Text]

Tyystjarvi E, Aro EM (1996) The rate constant of photoinhibition, measured in lincomycin-treated leaves, is directly proportional to light intensity. Proc Natl Acad Sci USA 93: 2213–2218[Abstract/Free Full Text]

Vaistij FE, Goldschmidt-Clermont M, Wostrikoff K, Rochaix JD (2000) Stability determinants in the chloroplast psbB/T/H mRNAs of Chlamydomonas reinhardtii. Plant J 21: 469–482[CrossRef][Web of Science][Medline]

Vasilikiotis C, Melis A (1994) Photosystem II reaction center damage and repair cycle: chloroplast acclimation strategy to irradiance stress. Proc Natl Acad Sci USA 91: 7222–7226[Abstract/Free Full Text]

Weber P, Fulgosi H, Piven I, Muller L, Krupinska K, Duong VH, Herrmann RG, Sokolenko A (2006) TCP34, a nuclear-encoded response regulator-like TPR protein of higher plant chloroplasts. J Mol Biol 357: 535–549[CrossRef][Web of Science][Medline]

Wollman FA, Minai L, Nechushtai R (1999) The biogenesis and assembly of photosynthetic proteins in thylakoid membranes. Biochim Biophys Acta 1411: 21–85[Medline]

Yokthongwattana K, Chrost B, Behrman S, Casper-Lindley C, Melis A (2001) Photosystem II damage and repair cycle in the green alga Dunaliella salina: involvement of a chloroplast-localized HSP70. Plant Cell Physiol 42: 1389–1397[Abstract/Free Full Text]

Yokthongwattana K, Melis A (2006) Photoinhibition and recovery in oxygenic photosynthesis: mechanism of a photosystem II damage and repair cycle. In B Demmig-Adams, WW Adams III, AK Mattoo, eds, Photoprotection, Photoinhibition, Gene Regulation and Environment. Springer, Dordrecht, The Netherlands, pp 175–191

Zhang L, Niyogi KK, Baroli I, Nemson JA, Grossman A, Melis A (1997) DNA insertional mutagenesis for the elucidation of a PSII repair process in the green alga Chlamydomonas reinhardtii. Photosynth Res 53: 173–184[CrossRef][Web of Science]

Zhang L, Paakkarinen V, van Wijk KJ, Aro EM (1999) Co-translational assembly of the D1 protein into photosystem II. J Biol Chem 274: 16062–16067[Abstract/Free Full Text]

Zhang L, Paakkarinen V, van Wijk KJ, Aro EM (2000) Biogenesis of the chloroplast-encoded D1 protein: regulation of translation elongation, insertion, assembly into photosystem II. Plant Cell 12: 1769–1782[Abstract/Free Full Text]

This Article Free via Open Access: OA OA Abstract Full Text (PDF) A correction has been published OA All Versions of this Article: 143/4/1547    most recent pp.107.096396v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via CrossRef Citing Articles via ISI Web of Science (2) Citing Articles via Google Scholar Google Scholar Articles by Park, S. Articles by Melis, A. Search for Related Content PubMed PubMed Citation Articles by Park, S. Articles by Melis, A. Agricola Articles by Park, S. Articles by Melis, A.