|
|
||||||||
|
First published online February 2, 2007; 10.1104/pp.106.094631 Plant Physiology 143:1841-1852 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Cytokinin Import Rate as a Signal for Photosynthetic Acclimation to Canopy Light Gradients1,[W],[OA]Plant Ecophysiology Group, Institute of Environmental Biology, Utrecht University, 3584 CA, Utrecht, The Netherlands (A.B., A.J.M.P., L.A.C.J.V., T.L.P.); Department of Biology, Laboratory for Plant Biochemistry and Physiology, University of Antwerpen, B2020 Antwerpen, Belgium (E.P.); and Institute for Phytosphere Research, Forschungszentrum Jülich, 52425 Juelich, Germany (F.G., U.S.)
Plants growing in dense canopies are exposed to vertical light gradients and show photosynthetic acclimation at the whole-plant level, resulting in efficient photosynthetic carbon gain. We studied the role of cytokinins transported through the transpiration stream as one of probably multiple signals for photosynthetic acclimation to light gradients using both tobacco (Nicotiana tabacum) and Arabidopsis (Arabidopsis thaliana). We show that substantial variation in leaf transpiration parallels the light gradient in tobacco canopies and experimental reduction of the transpiration rate of a leaf, independent of light, is sufficient to reduce photosynthetic capacity in both species, as well as transcript levels of the small subunit of Rubisco (rbcS) gene in Arabidopsis. Mass spectrometric analysis of xylem sap collected from intact, transpiring tobacco plants revealed that shaded leaves import less cytokinin than leaves exposed to high light. In Arabidopsis, reduced transpiration rate of a leaf in the light is associated with lower cytokinin concentrations, including the bioactive trans-zeatin and trans-zeatin riboside, as well as reduced expression of the cytokinin-responsive genes ARR7 and ARR16. External application of cytokinin to shaded leaves rescued multiple shade effects, including rbcS transcript levels in both species, as did locally induced cytokinin overproduction in transgenic tobacco plants. From these data, we conclude that light gradients over the foliage of a plant result in reduced cytokinin activity in shaded leaves as a consequence of reduced import through the xylem and that cytokinin is involved in the regulation of whole-plant photosynthetic acclimation to light gradients in canopies.
Photosynthetic acclimation of leaves to their local light environment in canopies contributes to increased whole-plant carbon gain and fitness (Anten, 2005
Although the process of photosynthetic acclimation to light gradients has been extensively studied, little is known about the signaling mechanisms regulating it, except that multiple mechanisms are likely to be involved (Bailey et al., 2001
Among the compounds carried in the xylem sap, the hormone cytokinin is likely to have a regulatory role in photosynthetic acclimation for two reasons. First, import of root-synthesized cytokinin into the shoot depends on shoot transpiration rate (Letham et al., 1990
In this article, we investigate the role of cytokinin as a signal for canopy light gradients using a variety of approaches in tobacco (Nicotiana tabacum) and Arabidopsis (Arabidopsis thaliana). Tobacco was used to measure density effects on E and photosynthetic acclimation in plants growing in canopies. This species was also used for the collection of xylem sap for cytokinin analysis by advanced mass spectrometry to obtain estimates of cytokinin delivery rates to leaves with different transpiration rates. Furthermore, transgenic tobacco plants were used that contain a locally inducible cytokinin biosynthesis gene. Both species showed similar photosynthetic acclimation when single leaves were shaded or treated with humid air, which could be rescued by externally applied cytokinin. By demonstrating in this manner that Arabidopsis is a suitable model for leaf level responses to light gradients, we were able to make use of the substantial knowledge of cytokinin signal transduction in this species that has been gathered in recent years (Hwang and Sheen, 2001
Photosynthetic Acclimation to Light Gradients in Tobacco Canopies To quantify leaf transpiration rates and illustrate photosynthetic acclimation to canopy light gradients in canopies, tobacco was grown at two contrasting densities, with a much steeper vertical light gradient developing in the dense stand compared to the more open stand (Fig. 1A ). Self-shading reduced irradiance incident on the lower leaves in open-stand plants, but shading was far more severe in the dense stand. Consequently, stomatal conductance (gs) and E also declined more strongly from the top of the canopy downward in the dense stand compared to the open stand (Fig. 1, B and C). Because there were no apparent gradients in leaf temperature or relative air humidity in either stand, E was determined by gs. In dense-stand plants, there was a greater decline in LMA (Fig. 1D), photosynthetic capacity (Amax; Fig. 1E), and small subunit of Rubisco (rbcS) transcript level (Fig. 1F) from the top of the canopy downward than in open-stand plants. Differences between densities were most pronounced in midcanopy leaves. Lower leaves of the open canopy were already senescing, causing also low gs, E, Amax, and, to some extent, rbcS transcript levels. All of the parameters mentioned above showed significant effects of relative height, density, and the height x density interaction when leaves in top and intermediate positions were compared or when all heights were analyzed (P < 0.05; analysis of covariance). Thus, plants had acclimated to the steeper light gradient at high-canopy density by concomitant changes in allocation of dry matter, photosynthetic capacity, and rbcS transcription, and this was accompanied by parallel changes in E.
Cytokinin Delivery to Tobacco Leaves and Regulation of Photosynthetic Acclimation Low E of shaded leaves will result in reduced cytokinin delivery through the xylem, provided there is no compensatory increase in cytokinin concentration. To investigate whether transpiration rate controls the delivery of cytokinins, we measured the concentration of cytokinins in xylem sap collected from a shaded leaf and a light-exposed leaf on an intact, transpiring tobacco plant with a pressurized root system (Table I ). Average E of the control leaf was 3.09 versus 1.95 for the shaded leaf. Care was taken that E was minimally affected by the sampling and that the collected xylem sap was representative of in vivo xylem sap delivered to the respective leaves. Advanced mass spectrometry analyses detected three isopentenyl (iP)-type cytokinins in low amounts in the xylem sap of shaded and control leaves (Table I). Concentrations of these cytokinins were not significantly different between the shaded and control leaves. Because cytokinin delivery rates are the product of their concentration in the xylem sap and E, it follows that shaded leaves received less iP-type cytokinins than light-exposed leaves.
Canopy light gradients can be mimicked by shading a leaf on a plant while the rest of the plant remains exposed to light (e.g. Pons and Pearcy, 1994
When cytokinin was exogenously applied to the shaded leaves, all the effects of shade were significantly counteracted (Table II). Furthermore, leaf dry mass and LMA also increased when cytokinin overproduction was locally induced in shaded leaves of transgenic TFM-isopentenyl transferase (Ipt) plants (Table II). In these plants, a dexamethasone (dex)-inducible ipt gene, encoding a cytokinin biosynthesis enzyme, allows strong localized cytokinin overproduction (Böhner and Gatz, 2001
To assess the importance of cytokinin delivery rates, it is necessary to demonstrate that this affects the cytokinin concentration and action in the receiving leaf, as well as its influence on photosynthetic acclimation. Whereas tobacco is a suitable species for the analysis of cytokinin delivery and canopy density effects, quantification of cytokinin activity is better achieved in Arabidopsis because cytokinin-responsive genes have been characterized in this species. As a first step, we needed to establish that Arabidopsis can be used in the study of photosynthetic acclimation to light gradients because it is naturally not exposed to vertical light gradients like erect plants in dense vegetation are. Figure 2 shows that, also in Arabidopsis, partial shading resulted in photosynthetic acclimation and this was mimicked by humid air treatment of a leaf remaining in the light. Shading of a leaf had no effect on the leaf-to-air vapor pressure difference (VPD; Fig. 2A), but decreased gs (Fig. 2B) and therefore E (Fig. 2C). When very low VPD was applied in the leaf chamber through flushing with humid air (Fig. 2A), a compensatory increase in gs (Fig. 2B) was observed, but E was significantly decreased nonetheless (Fig. 2C). Both treatments resulted in significant decreases in LMA (Fig. 2D) and Amax (Fig. 2E), similar to the response in tobacco. Chlorophyll and total nitrogen levels per unit area were not changed as a result of shading, but were reduced due to the humid air treatment (Table III ). However, a separate experiment under identical conditions revealed that nitrate accumulated in shaded leaves (14.86 ± 2.55 mmol m2 and 1.61 ± 0.68 mmol m2 nitrate in LL and HL leaves, respectively; n = 6) so organic nitrogen levels were reduced, as would be expected.
A continuously reduced delivery of cytokinin to shaded leaves should result in decreased cytokinin concentrations and lower expression of cytokinin-responsive genes, including those encoding photosynthetic enzymes. The total concentration of cytokinins in shaded Arabidopsis leaves was reduced compared to leaves that remained in the light (Table IV ). In leaves remaining in the light, treatment with humid air also significantly reduced the concentration of cytokinins relative to a normal air control. Cytokinins showing significant change due to the shading treatment were not the same as those changed by the humid air treatment. The most abundant cytokinins, isopentenyl riboside monophosphate (iPRP) and trans-zeatin (Z) riboside monophosphate (ZRP), did not show consistent significant effects between treatments and cis-zeatin riboside (ZR) was increased due to shading only. Nevertheless, both shading and humid air caused reductions to some extent in iPRP and trans-ZRP concentrations. Moreover, the concentration of the bioactive trans-Z and trans-ZR was reduced below or close to the detection limit due to both treatments (Table IV). The observed reduction in bioactive cytokinin concentration was accompanied by reduced transcript levels of cytokinin-responsive ARR16 and ARR7 (D'Agostino et al., 2000
Transcript levels of the negatively light-regulated PHYTOCHROME (PHY) A gene (Canton and Quail, 1999
In Arabidopsis, shading led to a rapid decrease within 3 d of the maximum electron transport rate (ETRmax; Fig. 4A
), a measure for photosynthetic capacity that can be monitored noninvasively over time and is closely correlated to Amax. After 3 d, ETRmax of shaded leaves declined further, but more slowly. Control leaves remaining in the light also showed a gradual decline in ETRmax, but levels after 12 d were still 3-fold higher than in the shaded leaves. Whereas humid air treatment also reduced ETRmax within 3 d compared to the normal air control, the initial decline was less strong than the shade effect. After 9 d, however, humid air treatment did result in an effect of similar magnitude to shade on photosynthetic capacity (Fig. 4A). This is consistent with the decline in chlorophyll of these leaves after 7 d (Table III), which also indicated the induction of senescence. When cytokinin was applied to shaded leaves, the initial decline in ETRmax could not be prevented, although ETRmax of cytokinin-treated leaves remained higher between 6 and 12 d compared to controls (Fig. 4B). Furthermore, humid air treatment resulted in extensive yellowing and leaf death in most leaves by 12 d (Fig. 5
). Shading for 12 d did not induce senescence, contrary to a previous report on completely darkened Arabidopsis leaves (Weaver and Amasino, 2001
The results presented here suggest that, in tobacco and Arabidopsis, cytokinin delivery through the xylem is dependent on E. Moreover, cytokinin mediates photosynthetic acclimation to light gradients in canopies by regulation of gene expression and consequently photosynthetic capacity. Because E is controlled by the direct effect of irradiance on stomatal aperture, this simple mechanism provides plants with a reliable signal to sense a light gradient over their foliage.
We have found substantial variation in transpiration rates in the tobacco leaf canopies. In the dense stand, transpiration of intermediately positioned leaves was 87% lower than of leaves at the top of the canopy (Fig. 1C), whereas photosynthetic photon flux density (PPFD) was 71% lower (Fig. 1A). Such differences in transpiration rate are sufficient to induce photosynthetic acclimation without any change in irradiance, as demonstrated by experimental manipulation using humid air for tobacco (Table II), Arabidopsis (Fig. 2), and several other species (Pons and Bergkotte, 1996
Several studies have shown that, at the whole-shoot level, transpiration rate controls the import of root-borne cytokinins (Beck and Wagner, 1994
For the cytokinin delivery rate to be effective as a signal for leaves, it should control the concentration of active cytokinin at the site of action and elicit cytokinin-specific responses in proportion to the delivery rate. Many other factors may control active cytokinin concentrations, including local synthesis, breakdown, interconversions, compartmentation, and export through the phloem (Brzobohat
Our time-course data of photosynthetic capacity (Fig. 4) showed that reduced cytokinin import cannot fully explain the effect of shading on photosynthetic acclimation. First, a reduction in transpiration rate independent of light reduced photosynthetic capacity, but not as strongly and several days later than partial shading did. The initial rapid decline in capacity induced by shade therefore does not appear to depend only on the reduction in transpiration rate and is apparently also regulated through an alternative mechanism. It should be noted, though, that humid air treatment reduced transpiration rate to a lesser extent than shading (Fig. 2C), proportional to its smaller effect on photosynthetic capacity (Fig. 2E). Second, application of cytokinins counteracted the effect of partial shading on capacity, but did not completely rescue it to the level of leaves remaining in growth light in both Arabidopsis (Fig. 4B) and tobacco (Table II). These observations suggest that, besides cytokinin, other signal transduction pathways are involved, too. Other compounds carried in the xylem sap, such as nitrate, might be delivered to leaves proportional to their transpiration rates and act as a signal. Nitrate is known to stimulate its own assimilation and incorporation into amino acids and may mimic certain cytokinin effects as well (Stitt, 1999
In further support of a function for cytokinin, our data on Arabidopsis leaves treated with humid air showed that a decline in cytokinin concentration and activity is associated with reductions in LMA, photosynthetic capacity (Fig. 2), and rbcS and type A ARR transcript levels (Fig. 3), and ultimately senescence (Fig. 5). Cytokinin application counteracted all these effects. Also in tobacco, application of cytokinin or induced overproduction of cytokinin in shaded leaves counteracted shade effects (Table II), as has been reported for several other species as well (Pons and Jordi, 1998
The delivery of xylem-carried cytokinins to shaded leaves of plants growing in dense canopies is reduced compared to light-exposed leaves as a result of their lower transpiration rates. Both shading and reduction of E in light-exposed leaves are sufficient to reduce photosynthetic capacity, which is associated with consistent reduction in the concentration of bioactive cytokinins and cytokinin activity. From these data, we conclude that the delivery of cytokinins is involved in the regulation of whole-plant photosynthetic acclimation to light gradients in canopies.
Tobacco Density Experiment
Tobacco (Nicotiana tabacum L. cv Wisconsin 38) was grown in a greenhouse under natural daylight during the spring. Seeds were sown on potting soil mixed with sand (16:1 [v/v]), and after 6 weeks plants were transferred to 3-L pots filled with a mixture of soil, sand, and clay (16:1:1; by volume), supplemented with 7 g of slow-release complete fertilizer (Osmocote mini plus, release time 34 months; Scotts) and 7 g of 17% CaMg carbonate (Vitasol BV) per pot. An open stand with 3.6 plants m2 and a dense stand with 35 plants m2 were established. To reduce border effects in the dense stand, the outer plants were transgenic PSAG12-IPT tobacco that retained their lower leaves (Gan and Amasino, 1995
Tobacco (cv SNN) seeds were germinated in moist sand in a climate-controlled growth room. After 3 weeks, seedlings were transferred to an aeroponics system and grown for a further 5 weeks as described previously (Herdel et al., 2001
Tobacco and Arabidopsis (Arabidopsis thaliana) were grown in a climate-controlled growth chamber with a 20°C light/16°C dark cycle, a 16-h light period for tobacco, and a 9-h light period (short days) for Arabidopsis at a PPFD of 200 µmol m2 s1, except during the humidity experiments with tobacco when PPFD was 300 µmol m2 s1. Growth chamber PPFD is designated as HL. Tobacco was grown in 1.5-L pots on a mixture of soil and perlite (1:1 [v/v]) containing 3 g L1 slow-release complete fertilizer (Osmocote mini plus, release time 34 months; Scotts), 0.3 g L1 micronutrient fertilizer (Micromax; Scotts Europe BV), 2 g L1 17% CaMg carbonate, and 5 mL L1 75 mM KH2PO4. With this nutrient dose, nitrogen was mildly limiting, but all other nutrients were sufficiently available as tests revealed. Surplus nitrogen availability may inhibit the response to partial shading, which involves nitrogen reallocation. Pots were placed in a tub covered with a glass plate for a period of 10 d and then placed on an irrigation mat that was automatically watered daily. Tobacco cv SNN was used for the humidity experiments and the fourth true leaf counted from below was used. Tobacco cv Wisconsin 38 was used in the experiment with partial shade and cytokinin application and the sixth leaf was used. Plants of both cultivars responded similarly to partial shade and were 30 d old when treatments started.
Arabidopsis accession Columbia-0 seeds were stratified for 3 d at 4°C on moist filter paper in sealed petri dishes and subsequently sown on a mixture of soil and perlite (1:1 [v/v]) in 220-mL plastic pots containing 150 mg of slow-release complete fertilizer (Osmocote mini plus, release time 34 months; Scotts Europe BV), 150 mg of micronutrient fertilizer (Micromax; Scotts Europe BV), 600 mg of 17% (w/w) CaMg carbonate (Vitasol BV), and 1.4 mL of 125 mM K2HPO4 per pot. Again, tests showed that nitrogen was mildly limiting under these conditions. Total nitrogen was determined on homogenized dry material with an elemental analyzer (Carlo Erba; model EA NA 1110) and nitrate was analyzed using salicylic acid as a reagent (Cataldo et al., 1975
Partial shade was applied to both species using layers of paper as described above. Transpiration rate of an attached leaf was reduced independent of light by enclosing the leaf in a transparent leaf chamber flushed with humid air, as described earlier (Pons and Bergkotte, 1996 The synthetic cytokinin benzyl adenine (BA) was dissolved in dimethyl sulfoxide (DMSO) and diluted in water to the indicated concentration, with a final DMSO concentration of 0.1% (v/v) and 0.02% (v/v) Silwet L77. The BA solution or the same solution without BA as a vehicle control was applied with a brush to both sides of the leaf. For cytokinin and gene transcript level analyses, leaves were immediately frozen in liquid nitrogen and stored at 80°C until analysis. Leaf area was measured using a leaf area meter (LI-3100; LI-COR) and dry mass after oven drying at 70°C for at least 24 h.
Transgenic TFM-Ipt tobacco cv SNN (Böhner et al., 1999
A portable gas-exchange meter (LI-6400; LI-COR) was used to measure gs. In the tobacco density experiment, two positions per leaf were measured on three leaves per plant on six plants in each tobacco stand. Average leaf T in the measuring chamber was 25°C and VPD was 1 kPa. Measurements were taken under sunny conditions when gs readings had stabilized and were always completed within 60 s, which was well before gs was affected by enclosing the leaf in the measuring chamber. In the same experiment, E was measured as weight loss in situ per unit time and leaf area, also under sunny conditions. It was measured on six different plants in each stand and on three leaves per plant. Leaves were cut off, immediately weighed, put back in the original position and orientation, and weighed again after 2 min for open canopy leaves and upper leaves in the dense canopy, or 6 min for lower leaves in the dense canopy. Cut leaves were held in position in the canopies by means of metal frames clamped on the stem. Separate measurements using a gas-exchange system showed that, after the leaf was cut, E remained stable for longer periods than those chosen for incubation (Supplemental Table S1). Therefore, stomatal closure did not influence the measurements. Leaf area was measured afterward. During gs measurements on Arabidopsis leaves in the growth chamber, average leaf temperature in the measuring chamber was 20.7°C and VPD was approximately 1.3 kPa. Efforts were made to reduce the accumulation of CO2 in the growth room as much as possible during the measurements by using a mouthpiece connected to a column containing CO2-absorbing material (Sodasorb; Grace). Measurement of gs on a leaf commenced directly after the shade mitten or leaf chamber, if present, was removed and was again completed within 60 s. The leaf area enclosed in the chamber was measured. For the calculation of E in situ, boundary layer conductance (gb) was assumed to be negligible, so gs was assumed to be equal to the total leaf conductance for water vapor. For comparison of E between humid and dry air treatments, this assumption is valid because any boundary layer effect should be small and comparable between treatments because of the high airflow rates used. Between the HL and LL treatment, gb was probably higher, but again comparable between treatments. E was calculated as E = gs x (wl wa), where wl and wa are the molar fraction (mol mol1) of water vapor in leaves and in the surrounding air, respectively. For tobacco, E was calculated in the same manner, but using a separately determined relationship between VPD and gs.
In both species, Amax was measured in the laboratory using a gas-exchange measuring system with leaf chambers with a 69- x 67-mm window that was described previously (Pons and Welschen, 2002
ETRmax of Arabidopsis leaves was measured in the growth room using a portable chlorophyll fluorometer (Mini-PAM; Waltz). Steady-state chlorophyll fluorescence (F') was measured under saturating PPFD (6001,000 µmol m2 s1, depending on expected capacity) and maximal fluorescence (Fm') in a saturating light pulse (approximately 5 mmol m2 s1). Lighting was provided by a halogen lamp. An air fan prevented any increase in leaf temperature. Photochemical yield (Y) was determined as Y = (F' Fm')/Fm' (Genty et al., 1989 To analyze senescence of Arabidopsis leaves induced by humid air treatment, the leaves were photographed and the fraction of yellow and green leaf area was determined using a custom-designed program in the software package KS400 (version 3.0; Carl Zeiss Vision).
Cytokinins were analyzed as previously described (Corbesier et al., 2003
Total RNA was extracted from 100 mg fresh leaf material with the RNeasy mini kit (Qiagen) and treated with DNAse (DNA-free; Ambion) to remove genomic DNA. RNA was electrophoresed on 1% agarose gel to confirm integrity. cDNA was synthesized from 2 µg of RNA with 100 units of SuperScriptIII RNase H reverse transcriptase (Invitrogen) and 100 ng of random hexamers in a 20-µL reaction. Quantitative real-time reverse transcription (RT)-PCR was performed in a 25-µL reaction containing 12.5 µL of 2 x SYBR Green Supermix (Bio-Rad), 100 pmol of the forward and reverse primer, and 10 ng of cDNA, except 0.1 ng of cDNA was used for Arabidopsis 18S rRNA. A Bio-Rad MyiQ single-color real-time PCR detection system (Bio-Rad) was used with the following thermal profile for all genes: 3 min at 95°C, followed by 40 cycles of 30 s at 95° s, 30 s at 62°C, and 60 s at 72°C. Melt curves were obtained after each PCR and confirmed the amplification of single products. Primer sequences (5'-3') for tobacco genes were ribosomal L25 (GenBank accession no. L18908) forward, ATTGTGGACATCAAGGCTGA; L25 reverse, GCAACGTCCAAAGCATCATA; rbcS (X02353) forward, TGGCCACCAATTAACAAGAA; and rbcS reverse, AAGCAAGGAACCCATCCA. Primers for Arabidopsis genes were 18S rRNA (GenBank accession no. X16077) forward, AAACGGCTACCACATCCAAG; 18S rRNA reverse, ACTCGAAAGAGCCCGGTATT; ARR7 (At1g19050) forward, GCCGGTGGAGATTTGACTGTTA; ARR7-reverse, AGCCCCTTTGCCTCCATCTA; ARR16 (At2g40670) forward, TCAGGAGGTTCTTGTTCGTCTT; ARR16 reverse, AACCCAAATACTCCAATGCTCTA; PHYA (At1g09570) forward, AAGCCCTTGGATTTGGAGATGTC; PHYA reverse, CTTTGGCAGCGAGCTTGTATGAT; rbcS (At1g67090) forward, ACCCGCAAGGCTAACAACGACAT; and rbcS reverse, GTGCAACCGAACAAGGGAAGC. Primers for the ARR genes were designed around an intron to confirm absence of genomic DNA. PCR products were resolved on 1% agarose gel, which showed single products of expected size in each case. All primers were designed with primer3 software (http://frodo.wi.mit.edu/primer3/primer3_code.html). Threshold cycle (CT) values for each gene were normalized to the CT value of the control gene. Transcript levels were then calculated using the
Analysis of covariance was used to study effects of stand density and relative height on the distribution of various parameters in the tobacco canopies. Two-way ANOVA with Tukey's honestly significant difference b test as a posthoc test and Student's t tests were used in the other experiments. Data were log-transformed when it improved homogeneity of variance.
The following materials are available in the online version of this article.
We thank Sevgi Öden for assistance with cytokinin analyses, and Rob van Drent, Bas Dingemans, Fred Siesling, Yvonne de Jong-van Berkel and Judith Koerselman-Kooij for help with plant growth and measurements. Members of the Plant Ecophysiology Department are acknowledged for fruitful discussions. Received December 12, 2006; accepted January 23, 2007; published February 2, 2007.
1 This work was supported by the Dutch Science Foundation (PIONIER grant no. 800.84.470 to L.A.C.J.V.).
2 Present address: Experimental Plant Systematics, Institute of Biodiversity and Ecosystem Dynamics, University of Amsterdam, P.O. Box 94062, 1090 GB Amsterdam, The Netherlands. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Thijs L. Pons (t.l.pons{at}uu.nl).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.094631 * Corresponding author; e-mail t.l.pons{at}uu.nl; fax 31302518366.
Aloni R, Langhans M, Aloni E, Dreieicher E, Ullrich CI (2005) Root-synthesized cytokinin in Arabidopsis is distributed in the shoot by the transpiration stream. J Exp Bot 56: 15351544 Anten NPR (2005) Optimal photosynthetic characteristics of individual plants in vegetation stands and implications for species coexistence. Ann Bot (Lond) 95: 495506 Anten NPR, Hikosaka K, Hirose T (2000) Nitrogen utilisation and the photosynthetic system. In B Marshall, JA Roberts, eds, Leaf Development and Canopy Growth. Sheffield Academic Press, Sheffield, UK, pp 171203 Bailey S, Walters RG, Jansson S, Horton P (2001) Acclimation of Arabidopsis thaliana to the light environment: the existence of separate low light and high light responses. Planta 213: 794801[CrossRef][ISI][Medline] Beck E, Wagner BM (1994) Quantification of the daily cytokinin transport from the root to the shoot of Urtica dioica. Bot Acta 107: 342348[ISI] Bieleski RL (1964) The problem of halting enzyme action when extracting plant tissues. Anal Biochem 9: 431442[CrossRef][ISI][Medline] Böhner S, Gatz C (2001) Characterisation of novel target promoters for the dexamethasone-inducible/tetracycline-repressable regulator TGV using luciferase and isopentenyl transferase as sensitive reporter genes. Mol Gen Genet 264: 860870[CrossRef][ISI][Medline] Böhner S, Lenk I, Rieping M, Herold M, Gatz C (1999) Transcriptional activator TGV mediates dexamethasone-inducible and tetracycline-inactivatable gene expression. Plant J 19: 8795[CrossRef][ISI][Medline] Boonman A (2006) Plant acclimation to the light gradient in canopies; functional significance and regulation by cytokinin. PhD thesis. Utrecht University, Utrecht, The Netherlands Boonman A, Anten NPR, Dueck TA, Jordi WJRM, van der Werf A, Voesenek LACJ, Pons TL (2006) Functional significance of shade-induced leaf senescence: an experimental test using transgenic tobacco. Am Nat 168: 597607[CrossRef][ISI][Medline] Brzobohat Canton FR, Quail PH (1999) Both phyA and phyB mediate light-imposed repression of PHYA gene expression in Arabidopsis. Plant Physiol 121: 12071215 Cataldo DA, Haroon M, Schrader LE, Youngs VL (1975) Rapid colorimetric determination of nitrate in plant tissue by nitration of salicylic acid. Commun Soil Sci Plant Anal 6: 7180[ISI] Chory J, Reinecke D, Sim S, Washburn T, Brenner M (1994) A role for cytokinins in de-etiolation in Arabidopsis (det mutants have an altered response to cytokinins). Plant Physiol 104: 339347[Abstract] Corbesier L, Prinsen E, Jacqmard A, Lejeune P, Van Onckelen H, Périlleux C, Bernier G (2003) Cytokinin levels in leaves, leaf exudate and shoot apical meristem of Arabidopsis thaliana during floral transition. J Exp Bot 54: 25112517 D'Agostino IB, Deruère J, Kieber JJ (2000) Characterization of the response of the Arabidopsis response regulator gene family to cytokinin. Plant Physiol 124: 17061717 Dieleman JA, Verstappen FWA, Nicander B, Kuiper D, Tillberg E, Tromp J (1997) Cytokinins in Rosa hybrida in relation to bud break. Physiol Plant 99: 456464[CrossRef] Emery RJ, Ma Q, Atkins CA (2000) The forms and sources of cytokinins in developing white lupine seeds and fruits. Plant Physiol 123: 15931604< | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||