Plant Physiol. Journal of Pharmacology and Experimental Therapeutics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online March 9, 2007; 10.1104/pp.106.090365

Plant Physiology 144:18-31 (2007)
© 2007 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/1/18    most recent
pp.106.090365v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mazier, M.
Right arrow Articles by Lucas, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mazier, M.
Right arrow Articles by Lucas, H.
Agricola
Right arrow Articles by Mazier, M.
Right arrow Articles by Lucas, H.
BREAKTHROUGH TECHNOLOGIES

Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco

Marianne Mazier*, Emmanuel Botton, Fabrice Flamain, Jean-Paul Bouchet, Béatrice Courtial1, Marie-Christine Chupeau, Yves Chupeau, Brigitte Maisonneuve and Hélène Lucas

Unité de Génétique et d'Amélioration des Fruits et Légumes, UR1502, Institut National de la Recherche Agronomique (INRA), F–84143 Montfavet cedex, France (M.M., E.B., F.F., J.-P.B., B.M.); and Laboratoire de Biologie Cellulaire, UR501, INRA, F–78026 Versailles cedex, France (B.C., M.-C.C., Y.C., H.L.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3beta-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome.


Continuous advances in whole-genome sequencing have resulted in important breakthroughs in plant science. Current data obtained on a few model species (Arabidopsis [Arabidopsis thaliana] and rice [Oryza sativa]) demonstrate that the degree of collinearity is rather low at the level of the whole genome and ongoing genome projects in other plant species might not be able to rely on the information obtained from already sequenced genomes to the extent that had been expected (Aert et al., 2004Go). Consequently, the importance of individual genome projects in higher organisms should not be underestimated. Unfortunately, traditional sequencing approaches are time consuming and expensive, and the time and cost increase proportionally with the size of the genome, which is a major obstacle in the accumulation of sequences and in the discovery of genes and nongenic functional elements in many agriculturally and industrially important plant genomes. Methods that allow rapid identification of the sequence involved in an interesting character (or a particular alteration of a phenotype) in a plant are promising, especially in plants for which genomic and whole-genome sequencing are not available. In this context, reverse-genetics tools such as insertional mutagenesis play an important role. Transposable elements provide attractive tools for constructing mutant collections and for gene tagging. Among these transposable elements, retrotransposons have unique features that give them several advantages over traditional insertion elements (Hirochika, 1997Go; Kumar and Bennetzen, 1999Go; Kumar and Hirochika, 2001Go). Because they transpose via a replicative mode, the mutations they induce are stable. As they transpose via an RNA intermediate that is reverse transcribed into extrachromosomal DNA, transposition target sites are not linked with the site of the original copy. Their transposition is regulated and most of the retrotransposons used for mutagenesis until now are activated by tissue culture, enabling large-scale generation of mutated populations. Retrotransposons have already been used successfully as mutagens in plants: Tos17, an endogenous retrotransposon of rice, is used for gene tagging in rice (Yamazaki et al., 2001Go). Moreover, it was shown that Tto1 and Tnt1 transpose in Arabidopsis (Okamoto and Hirochika, 2000Go; Courtial et al., 2001Go), and Tnt1 from tobacco (Nicotiana tabacum) is used in Medicago truncatula (d'Erfurth et al., 2003Go; Tadege et al., 2005Go). These studies revealed another important advantage of the use of retrotransposons over more traditional DNA-type elements: They can be highly mutagenic because some of them prefer to transpose into gene-rich regions. This last feature could make them ideal genetic tools for gene tagging in plants with a large genome.

Our purpose was to explore the opportunities of developing a retrotransposon mutagenesis strategy in lettuce (Lactuca sativa) using the heterologous element Tnt1. Lettuce is an important crop species belonging to the large Compositae family. The Compositae Genome Initiative (http://cgpdb.ucdavis.edu) has generated an enormous amount of DNA sequence data, especially ESTs, from the two major representatives of this family: lettuce and sunflower (Helianthus annuus). However, lettuce has a genome of 2.65 pg/1C, corresponding to 2,600 Mb per haploid genome, approximately 18, 6, and 5 times larger than Arabidopsis, rice, and Medicago, respectively (Arumuganathan and Earle, 1991Go). It is the largest genome tested so far for retrotransposon mutagenesis. Lettuce is amenable to most in vitro culture techniques and is easy to transform via Agrobacterium tumefaciens (Michelmore et al., 1987Go; Chupeau et al., 1994Go; Mazier et al., 2004Go; Lelivelt et al., 2005Go). Interestingly, Yang et al. (1993aGo, 1993bGo) already tested transposon mutagenesis using the well-known DNA transposable activator/dissociation (Ac/Ds) elements from maize (Zea mays) in lettuce. Despite demonstrating that the elements were functional in this plant, these authors showed that the frequency of germinal transposition provided was too low for practical use.

In this article, we show that Tnt1 transposes efficiently in lettuce during in vitro culture and that the insertions are stable and genetically unlinked. We also demonstrate the feasibility of gene tagging in lettuce by identifying and isolating an insertion of Tnt1 into a GA beta-hydroxylase gene that gives rise to a dwarf phenotype.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Transposition of Tnt1 during in Vitro Transformation of Lettuce Occurred Simultaneously with T-DNA Integration

Tnt1 is an active 5.3-kb-long copia-like long-terminal repeat (LTR) retroelement isolated from tobacco (Grandbastien et al., 1989Go). To investigate whether Tnt1 transposes in lettuce, leaf fragments from two different varieties of butterhead lettuce, ‘Mariska’ and ‘Jessy,’ were cocultivated with an Agrobacterium strain carrying the tnk23 plasmid (Fig. 1A ) containing in its T-DNA an autonomous copy of Tnt1 (Lucas et al., 1995Go). After 2 d of cocultivation, leaf explants were transferred to an in vitro selective regeneration medium until a number of transformed bushes appeared, as described by Dinant et al. (1997)Go. Fourteen independent bushes from 14 different leaf fragments (nine from ‘Mariska’ and five from ‘Jessy’) were transplanted onto selective rooting medium. Each bush is generally composed of several buds that subsequently have to be planted individually to obtain healthy plants in the greenhouse. In previous lettuce transformation experiments, it was verified that all the buds from one bush were clones resulting from the same transformation event (Dinant et al., 1997Go; Dubois et al., 2005Go).


Figure 1
View larger version (73K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Southern-blot analysis of primary transformant genotypes (T0) obtained with the tnk23 binary vector. Ten micrograms of total DNA from different T0 transformants were digested with HincII and analyzed by Southern blot using a Kana or R-U5 probe. A, Structure of the tnk23 T-DNA introduced in lettuce showing HincII restriction enzyme sites and positions of probes. The Kana and R-U5 probes are represented under the T-DNA scheme. RB, Right border; LB, left border. B, Hybridization with a R-U5 probe. The expected position (sizes 0.63 and 1.5 kb) of the two hybridizing fragments from the T-DNA is indicated. C, Hybridization with a Kana probe. Blot 1, 1 = MarTnt53b; 2 = MarTnt53a; 3 = MarTnt28c; 4 = MarTnt28b; 5 = MarTnt28a; 6 = MarTnt27a; 7 = MarTnt21a; 8 = MarTnt14b; 9 = MarTnt13b; 10 = MarTnt13a; 11 = MarTnt10a; 12 = MarTnt8a; 13 = MarTnt4b; 14 = MarTnt4a; 15 = ‘Mariska’ wild type. Blot 2, 1 = JesTnt8a; 2 = JesTnt7c; 3 = JesTnt7a; 4 = JesTnt6b; 5 = JesTnt6a; 6 = JesTnt2a; 7 = JesTnt1a; 8 = ‘Jessy’ wild type.

 
Figure 1B shows the results of the Southern hybridization on T0 genotypes (primary transformants) derived from six bushes. Buds from the same bush are designated by the same number and differ by the letter placed just after. Each blot was successively hybridized with two probes, namely, R-U5 (fragment of Tnt1 localized in the LTR) and Kana (fragment of the nptII gene). When T-DNA inserts were complete, hybridization with the R-U5 probe on HincII-digested genomic DNA revealed two internal fragments of 630 and 1,500 bp (Fig. 1A). Of the 21 buds analyzed, three (MarTnt21a and two buds from the same bush, JesTnt7) did not reveal the two internal fragments and thus probably contained a truncated version of the T-DNA without Tnt1. Two buds, MarTnt27a and JesTnt2a, revealed only the 630-bp fragment, indicating a longer truncated version of the T-DNA containing only the 3'-LTR from Tnt1. Thus, although the Kana probe revealed that all the buds analyzed contained the right part of the T-DNA, four bushes out of the 14 analyzed (30%) contained only a truncated version of the T-DNA in which at least the 5'-part of Tnt1 was missing. Two buds (MarTnt14b and MarTnt10a) of the 21 analyzed displayed only the two expected fragments when the blots were hybridized with the R-U5 probe. The 14 remaining buds (corresponding to eight different bushes of the 14 analyzed) revealed the presence of multiple bands in addition to the 630- and 1,500-bp expected fragments. The high degree of intensity observed specifically at 1,500 bp corresponded to the internal fragment localized inside Tnt1, whereas no such intensity was visible for the 630-bp fragment that corresponded to an internal fragment specific to the T-DNA. The other fragments probably corresponded to transposed copies of Tnt1, although some of them could be due to methylation of some Tnt1 HincII sites (J. Perez, F. Potet, B. Courtial, and H. Lucas, unpublished data). Multiple transposed copies of Tnt1 were thus inserted in the genome of 14 buds originating from the two varieties of lettuce. Hybridization with the Kana probe confirmed the differences between the number of T-DNA inserts and the number of Tnt1 copies. Whereas the number of T-DNA inserts varied between one and three, the number of Tnt1 insertions was very high and difficult to estimate accurately on the blots.

Hybridization with the Kana probe confirmed previous observations that buds from the same bush possess the same T-DNA inserts and derive from the same transformation event (Fig. 1C). The multiple-band patterns obtained with the R-U5 probe appeared to be identical for buds from the same bush, suggesting that transposition of Tnt1 occurred very early during the in vitro culture and transformation process, concomitant with the T-DNA transfer process.


Tnt1 Insertions Are Stable, Genetically Independent, and Can Be Easily Separated by Crossing to Wild-Type Lettuces

When using Tnt1 for insertion mutagenesis in lettuce, it is important to be able to isolate plants carrying only one or a few insertions of Tnt1 to identify the insertions responsible for the useful mutant phenotypes. Transposed copies of the element should also be genetically unlinked to cover the whole genome. In addition, it is important that new rounds of transposition do not happen in subsequent generations. To investigate the genetic independence of the Tnt1 insertions, their segregation was studied in progenies of the MarTnt53a transformant. T1 plants obtained by self-pollination of the MarTnt53a primary transformant were backcrossed to the wild-type genotype ‘Mariska.’ Seventy-seven different BC1 genotypes, originating from 51 different T1 plants, were analyzed by Southern blot. Twenty-eight BC1 plants each containing between nine and 16 different Tnt1 insertions, but together including all the insertions present in the MarTnt53a primary transformant genotype, were selected and again backcrossed to ‘Mariska.’ Southern-blot analysis was performed on 104 different BC2 plants. Twenty-one of 104 BC2 plants analyzed are presented in Figure 2B . At least 28 different Tnt1 insertions were clearly identified. Provided that, among the different T0 genotypes showing transposed insertions, the MarTnt53a genotype was the one containing the lowest number of Tnt1 copies (Fig. 1), it can be assumed that the number of Tnt1 insertions exceeded 28 for the other genotypes obtained in the transformation experiment. For all 28 insertions, it was possible to detect segregation events by Southern-blot analysis. Four BC2 genotypes, each containing two to five Tnt1 insertions and together representing 11 different Tnt1 transposition events, were self-pollinated and 39 to 44 progenies per BC2 line were analyzed by Southern blot. The 12 different progenies presented in Figure 3 show these 11 Tnt1 insertions in different combinations of two or isolated (lanes 2, 3, 4, and 7). We looked for new fragments indicative of germinal transposition events of Tnt1 in the different progenies analyzed, but did not find any, indicating that Tnt1 does not transpose at a high frequency in the germ cells of lettuce. Taken together, the results showed no evidence of linkage between any of the Tnt1 inserts studied, but rather showed Mendelian segregation of the insertions.


Figure 2
View larger version (52K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Southern-blot analysis of the progeny of one transformant (MarTnt53a) after two successive backcrosses with the wild-type parent ‘Mariska’ showing the genetic independence of the different insertions. Ten micrograms of total DNA from different BC2 plants were digested with NcoI and analyzed by Southern blot using a RT probe. A, Structure of the tntk23 T-DNA introduced in lettuce showing NcoI restriction enzyme sites and probe position. The RT probe is represented under the T-DNA scheme. RB, Right border, LB, left border. B, Hybridization with a RT probe. L = 1-kb ladder; 1 = MarTnt53a-11-2-3; 2 = MarTnt53a-22-2-2; 3 = MarTnt53a-22-2-4; 4 = MarTnt53a-25-1-1; 5 = MarTnt53a-38-2-5; 6 = MarTnt53a-38-2-7; 7 = MarTnt53a-39-2-5; 8 = MarTnt53a-40-2-4; 9 = MarTnt53a-40-2-5; 10 = MarTnt53a-40-2-7; 11 = MarTnt53a-44-2-4; 12 = MarTnt53a-45-2-1; 13 = MarTnt53a-46-2-1; 14 = MarTnt53a-46-2-6; 15 = MarTnt53a-51-2-3; 16 = MarTnt53a-51-2-4; 17 = MarTnt53a-52-2-4; 18 = MarTnt53a-55-1-1; 19 = MarTnt53a-57-2-2; 20 = MarTnt53a-57-2-6; 21 = MarTnt53a-57-2-8.

 

Figure 3
View larger version (104K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Southern-blot analysis of the progeny of some selfed BC2 plants selected for possession of few Tnt1 copies. Ten micrograms of total DNA from the plants were digested with NcoI and analyzed by Southern blot using a RT probe. L = 1-kb ladder; 1 = MarTnt53a-44-2-2-5; 2 = MarTnt53a-44-2-2-11; 3 = MarTnt53a-22-2-4-1; 4 = MarTnt53a-22-2-4-34; 5 = MarTnt53a-51-2-4-6; 6 = MarTnt53a-51-2-4-15; 7 = MarTnt53a-51-2-4-22; 8 = MarTnt53a-51-2-4-24; 9 = MarTnt53a-51-2-3-7; 10 = MarTnt53a-51-2-3-17; 11 = MarTnt53a-51-2-3-26; 12 = MarTnt53a-51-2-3-31; C = ‘Mariska’ wild type.

 

Tnt1 Is Transcriptionally Active in the Early Stage of Regeneration

To analyze Tnt1 transcriptional regulation in lettuce, we introduced the pHLV5501 construct, a translational fusion between Tnt1 LTR and the GUS reporter gene (Courtial et al., 2001Go), into the ‘Mariska’ genome by transgenesis. T0 plants, corresponding to independent transformation events, were transferred in the greenhouse to obtain T1 seeds by self-pollination. One hundred T1 seeds from each T0 plant were sown on rooting medium containing 75 mg/L kanamycin. Three genotypes were selected that had a 3:1 ratio of kanamycin resistance consistent with one functional nptII locus. Homozygous T2 lines were selected on kanamycin. Histochemical staining of 2-week-old T2 seedlings revealed moderate blue staining localized only in roots, with more intense staining in the youngest parts (Fig. 4A ). In vitro regeneration experiments were performed with leaf explants taken from 2-week-old sterile T2 seedlings of each of the selected genotypes. The expression of the LTR-GUS fusion was followed by histochemical staining of explant samples at 2 d, 6 d, 9 d, 13 d, 16 d, 20 d, 2 months, and 3 months after the beginning of the regeneration experiment. Figure 4 shows the results obtained with one of the selected genotypes (Mariska-LTR17a-5). The expression pattern of the LTR-GUS construct over time was the same for the three genotypes studied. The strongest GUS expression was observed 2 d after the beginning of the regeneration experiment (Fig. 4A, 1). All the explants from the transgenic T2-selected transformants showed uniform dark-blue staining at this time point. Four and 7 d later, dark-blue staining was observed, but only at the periphery of the explants, whereas the center of the explants became uncolored (Fig. 4A, 2 and 3). GUS expression was never detected in untransformed control explants during the experiment (Fig. 4B, 1–8). Sixteen to 20 d after the beginning of the regeneration experiment, calli started to develop from the explants mainly on the perimeter. Tnt1-GUS expression was mainly localized in certain parts of the calli and decreased over time (Fig. 4A, 4–6). Two months after the beginning of the regeneration experiments, newly regenerated shoots and leaves were clearly visible on the explants. Whereas a low level of Tnt1-GUS expression was still visible in some parts of the explants, no staining was observed in regenerated plantlets. Three months after the beginning of regeneration, GUS expression was reduced and hardly visible. These results showed that Tnt1 was transcriptionally activated early in the in vitro regeneration process (2 d after the beginning of the experiments).


Figure 4
View larger version (115K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Histochemical GUS staining of ‘Mariska-LTR-17a-5’ T2 plants obtained with the LTR-GUS construct and their leaf explants at different times during the in vitro culture regeneration protocol. A, ‘Mariska-LTR-17a-5’ genotype. B, Control ‘Mariska’ genotype. 0, Fifteen-day-old seedlings. 1, 2, 3, 4, 5, and 6, Leaf explants, respectively, 2, 6, 9, 13, 16, and 20 d after placing on in vitro regeneration medium; 7 and 8, leaf explants at, respectively, 2 and 3 months after placing on in vitro regeneration medium.

 

Tnt1 Transposition Can Be Reactivated in Lettuce

Activation of Tnt1 transposition by in vitro regeneration of lettuce genotypes containing one Tnt1 element could be an easy way to increase the size of a tagged population. To test the ability of several Tnt1 copies present in the lettuce genome to be activated for transposition, we used the 12 genotypes possessing one or two Tnt1 insertions issued from the MarTnt53a genotype by several backcrosses with the wild-type ‘Mariska,’ as presented previously (Fig. 3). Leaf explants taken from the 12 genotypes were submitted to in vitro regeneration with or without preliminary Agrobacterium coculture. As verified by Southern blot with a kanamycin probe (data not shown), all 11 Tnt1 inserts covered by the 13 studied genotypes were previously transposed copies without T-DNA.

One to 15 independently regenerated shoots from each genotype were used for DNA extraction and Southern analysis. Figure 5 shows a Southern blot for the 14 regenerated shoots originating from MariskaTnt53a-51-2-4-6, obtained after cocultivation with an empty Agrobacterium followed by regeneration. Each new fragment indicates a transposition event of Tnt1, and seven of the 14 segregated shoots contained new transposition events. As summarized in Table I , all genotypes, except one (MarTnt53a-51-2-4-24), gave at least one regenerated plantlet with new Tnt1 transposed copies. It was not possible to find an obvious correlation between the frequency of transposition in the regenerated shoots and Tnt1 copy number or a specific insertion locus in the starting material. When Tnt1 transposition occurred, it generally gave rise to a large number of new insertion events (data not shown). Cocultivation of explants with an empty Agrobacterium strain prior to regeneration did not result in a significant increase in the frequency of Tnt1 transposition (Table I). Overall, around 40% of the regenerated plantlets contained new transposition events of Tnt1.


Figure 5
View larger version (84K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Southern-blot analysis of in vitro-regenerated plantlets and the donor plant from which the leaf explants were taken showing new transposed Tnt1 copies. Ten micrograms of total DNA from the plants were digested with NcoI and analyzed by Southern blot using a RT probe. Newly regenerated plants were obtained from leaves taken from the donor plant MarTnt53a-51-2-4-6 (called 2-4-6). 1, Donor plant 2-4-6 (MarTnt53a-51-2-4-6); 2 to 15, independently regenerated plants.

 

View this table:
[in this window]
[in a new window]

 
Table I. Induction of Tnt1 transposition in lettuce after regeneration

 

Transgenic Lettuces Containing Tnt1 Insertions: A Small Highly Mutagenic Population

No phenotypic variation was observed in the T0 plants acclimated in the greenhouse from transformed bushes. However, phenotypic variants were found in four of eight T1 families studied.

Three different genotypes (JesTnt1, JesTnt6, and JesTnt8) showed abnormal phenotype at the seedling stage in their T1 progenies. They were blocked at the cotyledon stage or the cotyledons showed a pigmentation defect (white for JesTnt1a-7 and yellow for JesTnt6a and JesTnt8a), and the roots were shorter than those of the wild type (Fig. 6A ). Segregation analysis of the mutant phenotypes observed in JesTnt6a and JesTnt8a T1 and T2 families indicated that they corresponded to a single recessive mutation (Table II ). Segregation analysis of the mutant phenotype in the JesTnt1a-7 T2 family suggested that this phenotype could be due to recessive mutations in two unlinked genes (the ratio of white to green seedlings was between those expected for one and two recessive mutations).


Figure 6
View larger version (115K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. Phenotypic variations observed on the progeny of lettuce genotypes containing transposed copies of Tnt1 at the seedling stage (A) or at the flowering stage (B and C). A1, JesTnt6a-8 seedlings; A2, JesTnt8a-7 seedlings; A3, JesTnt1a-7 seedlings. B1, JesTnt1a mutant (left) and wild-type (right) compound inflorescences; B2, stereomicroscope view (10x) of one JesTnt1a mutant (left) and wild-type (right) compound inflorescence. C, JesTnt6 dwarf mutants (left and right) and wild-type (center) at early (C1) and late (C2) flowering stages. D1, Southern-blot analysis of selected JesTnt6 dwarf mutants obtained after two backcrosses and self-pollination.

 

View this table:
[in this window]
[in a new window]

 
Table II. Segregation of mutations in progenies of Tnt plants

 
Other phenotypic variations were observed in the greenhouse at later stages of development in the T1 progeny of three genotypes. Dwarf plants appeared in JesTnt6 progeny with a very short internodal stem (Fig. 6C). Marked modification in the structure of the flower (absence of ligules and stamens) was observed in JesTnt1 progeny (Fig. 6B) and in the color of the ligule (light yellow) in MarTnt53 progeny. Segregation analysis of these mutant phenotypes in T1, T2, and T3 families suggested that all three corresponded to single recessive mutations (Table II). The high number of Tnt1 insertions in the genotypes presenting phenotypic alterations associated with the recessive character of those mutations did not allow identification of the inserts involved, except for the dwarf mutation for which several rounds of backcrosses were performed. Consequently, we cannot exclude the involvement of some endogenous transposable elements or other mutations in addition to Tnt1 to generate these phenotypic alterations.


Tnt1 Transposes into Coding Regions in the Lettuce Genome

One significant advantage of using retrotransposons for gene tagging in plants with large genomes is the preference some display to transpose into gene-rich regions. To test Tnt1 mutagenic activity in lettuce, 25 different lettuce Tnt1 insertion sites longer than 100 nucleotides were isolated by sequence-specific amplification polymorphism (S-SAP) and then sequenced (Table III ). Sequences were processed to obtain lettuce DNA fragments corresponding to the 5'-Tnt1 flanking sequence. The cleaned sequenced DNA fragments varied in size from 114 to 557 nucleotides. Sequences were compared with four of The Information for Genomic Research (TIGR) databases (lettuce, sunflower, tomato [Solanum lycopersicon], and potato [Solanum tuberosum]) using the BLASTN program. We also compared the translated sequences of the sequenced DNA fragments with these translated databases and with two protein databases (Arabidopsis and Swiss-Prot TrEmbl) using the BLASTX program to see whether we could detect any homology with known or hypothetical proteins. Of the 25 sequences analyzed by BLASTN, eight sequences (32%) showed no homology. Fourteen sequences (56%) showed some similarities with ESTs or known mRNAs, with E values between 7.8e-103 (perfect match, i.e. certain) and 5.7e-05 (probable but not certain). E values above 1e-05 were regarded as not significant and not included in Table III. Apart from sequence HEL185 (which perfectly matched lettuce Ls3h1 mRNA coding for the GA 3beta-hydroxylase), the other 13 highest sequence similarities found showed scores between 703 (highly probable) and 222 (probable but not certain). Among these 13 sequences, eight matched lettuce ESTs (HEL131, HEL143, HEL207, HEL189, HEL195, HEL191, HEL193, and HEL102), two matched sunflower ESTs (HEL150 and HEL198), and the last three matched Solanaceae ESTs (HEL132, HEL210, and HEL128). The remaining three sequences (12%) showed no homology with BLASTN, but some homology with hypothetical proteins from Arabidopsis (HEL115, HEL204, and HEL205), with E values between 1.6e-11 and 1.9e-06 and scores between 127 and 115. Taken together, the results of the analysis of 25 Tnt1 flanking sequences are not in favor of random insertion of Tnt1 in the lettuce genome, but rather could indicate a preference of Tnt1 to insert into expressed regions, even if this still has to be proved statistically by obtaining more sequence data.


View this table:
[in this window]
[in a new window]

 
Table III. Characterization of Tnt1 integration sites by S-SAP

 

Tnt1 Insertion into a GA beta-Hydroxylase Gene Induces a Dwarf Phenotype in Lettuce

To demonstrate that Tnt1 was responsible for the mutant phenotype observed, we decided to study the dwarf mutant in more detail. The mutant phenotype was detectable at an early stage of development, and, despite the absence of a flower stem, the plants were partially fertile and generated 100% mutant progenies after self-pollination. Southern-blot analysis of 60 T3 JesTnt6a plants showed that the Tnt1 copy number was too high to allow correlation with the presence of a specific fragment with the dwarf mutation (data not shown). One T3 mutant plant was backcrossed with the wild type. Five BC1 plants selected to posses the lowest Tnt1 copy number (between 25 and 30) among the 100 analyzed were grown in the greenhouse and self-pollinated. Dwarf plants were selected from among these BC1 progenies and the Tnt1 copy number was assessed by Southern blot for 100 of them. The plant that contained the lowest copy number of Tnt1 (between eight and 10) was backcrossed to the wild type and five BC2 plants out of the 50 analyzed by Southern blot, containing four to five Tnt1 inserts, were allowed to grow in the greenhouse for self-pollination. Fifteen to 25 progenies per BC2 plant were allowed to grow in the greenhouse for detection of the mutant phenotype and mutant genotypes were analyzed by Southern blot. The mutant plant containing the smallest copy number (two) was then self-pollinated, giving 100% mutant progenies with some containing only one Tnt1 copy (Fig. 6D, 1).

The S-SAP fragment corresponding to a Tnt1 insertion site in the lettuce GA beta-hydroxylase (sequence HEL185; Table III) was detected only in JesTnt6a progenies harboring the dwarf mutation (data not shown). Treatment of JesTnt6a progenies harboring the mutant phenotype with GA allowed complete reversion of the phenotype, suggesting that, indeed, disruption of the GA beta-hydroxylase gene by Tnt1 results in the dwarf phenotype. PCR amplification of plants previously characterized for their mutant phenotype (and its segregation in their progeny), using one oligonucleotide specific for the Tnt1 5'-end and two oligonucleotides specific for the GA beta-hydroxylase gene (upstream and downstream of the Tnt1 insertion site), demonstrated that, indeed, the mutant dwarf phenotype was due to transposition of Tnt1 into this gene (Fig. 7 ).


Figure 7
View larger version (30K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. PCR analysis of 16 T2 plants derived from the JesTnt6a genotype (T1 plant JesTnt6a-5) segregating for the dwarf mutation. T3 progeny obtained from each plant were also analyzed for the mutation segregation. PCR was performed using the three oligonucleotides LTR1R (complementary to Tnt1), Gi1F, and Gi3R (complementary to GA beta-hydroxylase, amplifying a 663-bp fragment). C, ‘Jessy’ wild type. L, One-kilobase ladder. According to the S-SAP sequence of the Tnt1 insertion into the GA beta-hydroxylase, the expected fragment amplified with LTR1R and GI3R characteristic of this insertion is 441 bp.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
In this article, we have shown that the tobacco retrotransposon Tnt1 transposes in lettuce. Molecular analysis of several individuals isolated from a common regenerated ancestor bush demonstrated that the transposition of Tnt1 occurred very early during the lettuce transformation process, concomitantly to T-DNA transfer. Of the 10 different bushes containing a complete version of the T-DNA analyzed, two bushes contained only the T-DNA insert, whereas the remaining eight contained multiple transposed copies of Tnt1. The number of transposed copies per plant was particularly high and difficult to estimate accurately on the T0 Southern blots. Whereas in Arabidopsis the number of transposed Tnt1 copies fluctuated between 0 and 26 (Courtial et al., 2001Go) and in Medicago between four and more than 30 (d'Erfurth et al., 2003Go), the number of Tnt1 insertions obtained in lettuce was estimated by molecular analysis performed on successive backcrosses to be 28 for one genotype and much higher for the seven remaining T0 genotypes, revealing a highly efficient rate of transposition. This high copy number per plant will be an advantage for lettuce mutagenesis because it reduces the number of transgenic lines that have to be produced to saturate the genome, although the time needed to segregate these elements afterward to show that the mutant phenotype is tagged could be a limiting factor. Based on the equation of Krysan et al. (1999)Go and assuming an average gene length of 3.5 kb and that Tnt1 insertions are random, we estimate that 2,225,400 insertions would be required to have a 95% probability of tagging any given gene in the 2,600 Mb lettuce genome. With a postulate that a Tnt1 average copy number of 50 insertions per line inserted into unlinked loci in lettuce, the same level of saturation could be obtained in 44,508 lines.

Contrary to results obtained with Medicago showing plants containing transposed Tnt1 copies without T-DNA insertions, the four different regenerated lettuce bushes containing only truncated versions of the T-DNA did not show any transposed copies of Tnt1.

The study conducted on two consecutive backcrosses and one self-pollination performed with a given T0 transformant demonstrated the genetic independence of the different Tnt1 copies and the Mendelian segregation of the insertions. Furthermore, several different single-copy insert plants were easily obtained after only three backcrosses and one self-pollination, starting with a plant containing 28 copies of Tnt1, demonstrating the feasibility of separating a given Tnt1 insertion from the others even from a genotype containing large numbers of transposed copies. No new transposition events were observed in any of the progenies studied, as already observed in Arabidopsis and Medicago (Lucas et al., 1995Go; d'Erfurth et al., 2003Go). Thus, the insertions of Tnt1 are stable and the element does not transpose at a detectable frequency in the germ cells of lettuce under standard growth conditions in the greenhouse.

Using LTR-GUS fusion, we demonstrated that transcription of the element, driven by its LTR promoter, is highly regulated. LTR-GUS products are poorly expressed in most intact lettuce leaf tissues of transgenic plants, except roots. However, Tnt1 transcription is strongly induced in lettuce by in vitro culture regeneration experiments. Transcription activation occurs very early, 2 d after the beginning of the experiments, and then decreases to no transcription at all in newly regenerated plantlets. Thus, the absence of germinal transposition events in the progeny of transgenic plants carrying Tnt1 and the early occurrence of transposed copies obtained in transgenic lettuce after in vitro regeneration and transformation are in keeping with the element's transcription pattern. Tnt1 transcription has previously been shown to be strongly regulated and induced by different biotic or abiotic stress factors, such as treatment with herbicides, microbial elicitors, wounding, and 2,4-dichlorophenoxyacetic acid (Pouteau et al., 1991Go, 1994Go; Grandbastien et al., 1994Go; Pauls et al., 1994Go; Moreau-Mhiri et al., 1996Go; Mhiri et al., 1999Go) and during in vitro transformation of Arabidopsis (Courtial et al., 2001Go) and Medicago (d'Erfurth et al., 2003Go). Thus, transcriptional regulation of Tnt1 (at least in intact plants and during in vitro culture) appears to be conserved in the heterologous host lettuce.

We also showed that transposition of integrated copies of Tnt1 in the lettuce genome can be reactivated by tissue culture. As already observed for T0 genotypes obtained after transformation, when transposition occurred, the number of Tnt1 copies was particularly high. Whereas transposition was obtained for all Tnt1 insertions studied, showing their functional integrity, only 38% of the regenerated plantlets studied showed transposition events. Cocultivation of explants with an empty Agrobacterium strain prior to regeneration did not result in a significant increase in the frequency of Tnt1 transposition compared to simple regeneration experiments. Thus, Agrobacterium does not seem to particularly induce Tnt1 transposition, contrary to the in vitro culture regeneration. The absence of transposed copies observed in some of the regenerated plantlets, as well as in some of the regenerated bushes obtained after the transformation experiment, might be due to the lettuce regeneration protocol used. Indeed, lettuce is a plant that is easily regenerated in in vitro culture and thus does not need large quantities of growth regulators in the regeneration medium (0.15 mg/L benzyladenine acid and 0.3 mg/L indole acetic acid) to obtain 100% regeneration of the leaf explants placed on the medium. Modification of this regeneration protocol by using higher amounts of growth regulators or 2,4-dichlorophenoxyacetic acid, previously shown to induce Tnt1 transposition (Pauls et al., 1994Go), instead of indole acetic acid, would probably increase the percentage of regenerated bushes containing transposed copies of Tnt1 without seriously decreasing the percentage of regeneration. Improvement of the in vitro protocol for obtaining regenerated plants all containing new transposition events have to be performed before to be used for large-scale mutagenesis in lettuce. Using a lettuce genotype containing an inserted Tnt1 copy as starting material drastically reduces the cost and complexity of the experiments (no antibiotic needed, no need to transplant the explants grown on regeneration medium before the isolation of newly regenerated plantlets) and eliminates the risk of Agrobacterium in the regenerated plants.

To obtain efficient mutagenesis in plants with large genomes, it is important to use a transposable element that prefers to insert in genes rather than in noncoding regions. The genome of most crop plants is large compared to the plant model Arabidopsis (145 Mb). The size of the lettuce genome is 2,639 Mb (i.e. similar to that of higher plants like maize or sunflower; Arumuganathan and Earle, 1991Go). Despite differences in genome size, the number of genes in higher plants is expected to be similar, although increases due to ploidy changes are to be expected (Sidhu and Gill, 2004Go). The estimated gene number for Arabidopsis is 25,000 (Arabidopsis Genome Initiative, 2000Go). In all eukaryotes, genes are interspersed with gene-empty regions and the size of such regions seems to be related to the genome size (Sidhu and Gill, 2004Go). Genes in the majority of plants appear to be clustered; the main change from plants with smaller genomes (Arabidopsis and rice) to larger genomes (barley [Hordeum vulgare], maize, and wheat [Triticum aestivum]) is the overall reduction in size of the gene cluster and expansion of the interspersed gene-empty regions (Aert et al., 2004Go; Sidhu and Gill, 2004Go). Whereas in the smaller genome of Arabidopsis, about 45% of the chromosomal DNA contains genes, the gene space is believed to occupy only about 12% to 24% of the large genomes (Barakat et al., 1997Go). For Medicago, genes are believed to be clustered in the euchromatic regions, representing only 25% of the complete genome (Kulikova et al., 2001Go). As a result, transcribed regions are expected to represent less than 15% of the Medicago genome (d'Erfurth et al., 2003Go). Accordingly, in the lettuce genome, which is 5 times larger than Medicago, we would expect to find an even lower percentage of transcribed sequences than in Medicago. Analysis of 25 different lettuce Tnt1 flanking sequences showed that the element was inserted close to transcribed regions in one-half of the sequences analyzed. This Tnt1 preference to transpose into coding regions was also observed in Medicago and Arabidopsis (Courtial et al., 2001Go; d'Erfurth et al., 2003Go; Tadege et al., 2005Go) and also in the two other retroelements Tto1 and Tos17 (Okamoto and Hirochika, 2000Go; Yamazaki et al., 2001Go; Miyao et al., 2003Go), even if some bias and insertion site specificity have been shown for Tos17. Thus, retrotransposon elements such as Tnt1 have great potential as tools for insertional mutagenesis in crop plants with large genomes like lettuce. The probability of finding a Tnt1 insertion within a given gene, in the case of insertions restricted to coding sequences, could be calculated using the following formula: P = 1 – (1 – [x/30,000y])n, where P = the probability of finding one Tnt1 insert within a given gene, x = the length of the gene, y = the average length of the genes in the plant studied, and n = the number of Tnt1 inserts present in the population. This calculation assumes that the transcriptome is represented by 30,000 genes and that the Tnt1 insertions are randomly distributed inside expressed sequences. Based on this equation and an average gene length of 3.5 kb, we can estimate that 89,871 insertions (instead of 2,225,400 if insertions are randomly distributed in the whole genome) would be required to have a 95% probability of tagging any given gene. With a postulate of 10 such Tnt1 insertions per line in lettuce, the same level of saturation could be obtained in 8,987 lines (95% probability).

In addition, we demonstrated the feasibility of using Tnt1 as a gene-tagging tool in lettuce by isolating the Tnt1 insertion responsible for dwarf mutation. Even if the involvement of Tnt1 insertions was not demonstrated for the other mutant phenotypes observed in the progeny of the T0 plants, their surprising number with respect to the small starting T0 population generated provides indirect additional proof of Tnt1 preference for insertion in transcribed regions and its potentially highly mutagenic characteristics.

Several transposon systems have already been constructed for the functional analysis of genes (reverse-genetics analysis) and gene tagging in plants (for review, see Parinov and Sundaresan, 2000Go; Walbot, 2000Go; Srinivasan and Sundaresan, 2001Go). Although these systems have been successfully used to isolate genes and identify mutants, some problems associated with their use have also been reported. First, DNA transposons generally jump to locations near the original insertion site, often to linked positions (Parinov and Sundaresan, 2000Go). Second, these types of transposable elements transpose by a cut-and-paste mechanism, causing unstable mutations or imprecise excisions that are difficult to detect. In lettuce, for instance, imprecise excision of a Ds element produced mutants that were not tagged with the element (Okubara et al., 1997Go). Because they transpose by a copy-and-paste mechanism, no such problems can occur with retrotransposons, making them especially suitable for obtaining flanking plant sequences as well as for facilitating PCR-based reverse-genetics screening of DNA pools. At this time, only two retrotransposons have been used as insertion mutagens in plants: Tos17 from rice and Tnt1 from tobacco (Yamazaki et al., 2001Go; d'Erfurth et al., 2003Go). Interestingly, Tos17 has been successfully used in rice to generate more than 47,000 mutant lines and has already proven to be a useful tool for functional genomics in this plant (Miyao et al., 2003Go; Kaneko et al., 2004Go; Nonomura et al., 2004Go), and collaborative efforts are under way in Europe and the United States to generate around 20,000 Tnt1-tagged Medicago lines in the next 3 years (Tadege et al., 2005Go).

In this article, we showed that insertional mutagenesis and gene tagging using the retrotransposon Tnt1 is also feasible in lettuce, despite its large genome, 5 to 6 times bigger than that of rice or Medicago. The results obtained show that retrotransposons should not be underestimated as alternative tools especially in plants amenable to tissue culture but in which classical genomics and whole-genome sequencing are not easy to achieve. In the future, this could help to identify the similarities or differences in coding sequences or coded functions existing between well-studied model species and a crop plant with agronomical useful traits or between plants belonging to distant families.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material and Plant Growth Conditions

Two butterhead lettuce plants (Lactuca sativa) were used: ‘Mariska’ from Numhems and ‘Jessy’ from Caillard. For germination, seeds were sown in petri dishes containing filter paper moistened with water and exposed to 4°C in the dark for 48 h before being placed in a growth room (24°C, 16-h photoperiod, 60 µE m–2 s–1) for 5 to 10 d. Seedlings were first grown on compost in 7-cm pots in a greenhouse for 3 weeks before being transplanted in 3-L compost pots and watered with nutritive solution.

Mutant plants whose stems failed to elongate in the greenhouse were treated by applying 5 mL of a solution containing 0.02% (w/v) of GA3 (C19H2206; catalog no. G 0907; Duchefa) to the top of the plants in the greenhouse at the heading stage.


T-DNA Vectors and Bacterial Strain

The Tntk23 vector (Fig. 1A) is a derivative of the pBin19 vector carrying the autonomous Tnt1 retroelement (Lucas et al., 1995Go). The pHLV55501 vector is also derived from pBin19 and carries a translational LTR-GUS-intron fusion (Courtial et al., 2001Go).

Plasmids were introduced in Agrobacterium tumefaciens strain C58 pGV2260 (Deblaere et al., 1985Go).


In Vitro Culture Regeneration and Genetic Transformation

Lettuce genetic transformation procedures are described by Dinant et al. (1997)Go and the regeneration medium used is described by Mazier et al. (2004)Go. Leaves excised from 10-d-old seedlings (cultivated aseptically) were inoculated with A. tumefaciens strain C58 pGV2260 carrying the constructs to be introduced. Transformant buds were selected on 200 mg L–1 kanamycin-containing regeneration medium and transplanted individually onto rooting medium with 50 mg L–1 kanamycin. Vigorous plantlets were transplanted to pots with peat soil in a growth chamber (22°C day/16°C night, 16-h photoperiod) before transfer to a greenhouse for flowering and self-pollination.

Newly in vitro-regenerated plantlets (without transformation) were produced from true leaves taken from sterile seedlings grown in vitro or from selected plants growing in the greenhouse, surface sterilized by immersing in a disinfecting solution for 30 min (Mazier et al., 2004Go), followed by three rinses with sterilized deionized water. In vitro regeneration procedures were performed as described by Mazier et al. (2004)Go.


Molecular Analysis

Genomic DNA was extracted from leaf tissues using a modified cetyltrimethylammonium bromide method (Bernatzky and Tanksley, 1986Go). For Southern blots, 12 µg of DNA were digested with the appropriate restriction enzyme as recommended by the manufacturer. After separation on a 0.8% (w/v) Tris-acetate EDTA 1x agarose gel and denaturation and neutralization using standard procedures (Sambrook et al., 1989Go), the DNA was transferred onto a Hybond N+ membrane (Amersham). The Kana probe (805-bp HindIII fragment from the pABDI plasmid [Paszkowski et al., 1984Go]) containing the nptII gene was labeled by random priming. The gag and reverse transcription (RT) probes were generated by PCR using Tnt613+ (5'-TGGTATCAGAGCACAGGTT-3') and Tnt1239– (5'-TCATTGAGTAGAAGAGCCGA-3') primers for gag and Tnt3084+ (5'-CTTCCACAGAGTATGTCCTCATCAGT-3') and Tnt4523– (5'-CATCAATGTGTTTGGTCCTTGC-3') primers for RT.

Hybridization with 32P-labeled probes was performed at 65°C in hybridization buffer (750 mM NaCl, 125 mM sodium citrate, 0.6% SDS, 50 mM Na2HPO4/NaH2PO4, pH 7.5, 5x Denhart, 2.5 mM EDTA, 5% dextran sulfate, 2.5 mg DNA salmon sperm) for 16 to 24 h. The filters were then washed one time in 2x SSC; 0.1% SDS at 65°C for 20 min followed by one wash in 1x SSC; 0.05% SDS at 65°C for 20 min and a final wash in 0.5x SSC; 0.05% SDS at 65°C for 10 to 20 min. Filters were exposed and analyzed by autoradiography.

PCR analysis of the Tnt1 insertion responsible for the dwarf mutation was performed using primers LTR1R, 5'-GGCTACCAATCCAACAAGGA-3' (complementary to Tnt1); Gi1F, 5'-CAAACGCCATGAAGCTTGT-3' (GA beta-hydroxylase nucleotide positions 210–229); and Gi3R, 5'-GGTGCAGCACACTTGGATAC-3' (complementary to GA beta-hydroxylase nucleotide positions 852–872).


Isolation of Insertion Sites

The sequences flanking Tnt1 integration sites were isolated by S-SAP and sequenced as described by Courtial et al. (2001)Go. The genomic DNA was digested with Csp6I (Fermentas).


Sequence Analysis

Sequence chromatograms were analyzed using phred software (Ewing et al., 1998Go; Ewing and Green, 1998Go) with the following parameters: -trim_alt "" -trim_cutoff 0.10. This step produced the corresponding nucleotide sequences and quality data files. The sequences were then cleaned using local software to remove the retransposon sequence (X13777.1) and the primer sequences (CTGGACGATGAGTCCTGAGA and TATCTCAGGACT). Homologies of the resulting cleaned sequences with different databases were then searched for using Washington University BLAST (WU BLAST) Version 2 (W. Gish, 1996–2003, http://blast.wustl.edu). Both BLASTN and TBLASTX analysis were performed with four TIGR Gene Indices databases (http://www.tigr.org/tdb/tgi/index.shtml): Lettuce 2.0, Sunflower 3.0, Tomato 10.1, and Potato 10.0. BLASTX analyses were performed with two protein sequences databases, MAtDB, the MIPS Arabidopsis (v090704 version) database (http://mips.gsf.de/proj/thal/db), and both Swiss-Prot and TrEMBL (10/11/2005 update) available on the ExPASy Proteomics Server (http://www.expasy.org).


GUS Assays

Histochemical staining for GUS activity was carried out according to Jefferson (1987)Go.

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers EF397531 to EF397555.


    ACKNOWLEDGMENTS
 
We are grateful to V. Sarnette for excellent plant care and backcrossings. We thank Y. Bellec and E. Martin for technical assistance during cultivation of T0 and T1 plants and their progenies. We wish to thank M. Pitrat, P. Ratet, and S. Muños for their advice and helpful comments, and J. Chadoeuf for help in calculations and probability formulas.

Received September 26, 2006; accepted January 30, 2007; published March 9, 2007.


    FOOTNOTES
 
1 Present address: Laboratoire National de la Protection des Végétaux, Unité de Détection des OGM, 93 Rue de Curembourg, 45404 Fleury-les-Aubrais cedex, France. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Marianne Mazier (mazier{at}avignon.inra.fr).

www.plantphysiol.org/cgi/doi/10.1104/pp.106.090365

* Corresponding author; e-mail mazier{at}avignon.inra.fr; fax 33–4–32–72–27–02.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Aert R, Sagi L, Volckaert G (2004) Gene content and density in banana (Musa acuminata) as revealed by genomic sequencing of BAC clones. Theor Appl Genet 109: 129–139[CrossRef][ISI][Medline]

Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796–815[CrossRef][Medline]

Arumuganathan K, Earle ED (1991) Nuclear DNA content of some important plant species. Plant Mol Biol Rep 9: 208–218[CrossRef]

Barakat A, Carels N, Bernardi G (1997) The distribution of genes in the genomes of Gramineae. Proc Natl Acad Sci USA 94: 6857–6861[Abstract/Free Full Text]

Bernatzky R, Tanksley SD (1986) Genetics of actin related sequences in tomato. Theor Appl Genet 72: 314–321[CrossRef][ISI]

Chupeau M-C, Maisonneuve B, Bellec Y, Chupeau Y (1994) A Lactuca universal hybridizer, and its use in creation of fertile interspecific somatic hybrids. Mol Gen Genet 245: 139–145[ISI][Medline]

Courtial B, Feuerbach F, Eberhard S, Rohmer L, Chiapello H, Camilleri C, Lucas H (2001) Tnt1 transposition events are induced by in vitro transformation of Arabidopsis thaliana and transposed copies integrate into genes. Mol Genet Genomics 265: 32–42[CrossRef][ISI][Medline]

Deblaere R, Butebier B, De Greve H, Deboeck F, Schell J, Van Montagu M, Leemans J (1985) Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer. Nucleic Acids Res 13: 4777–4788[Abstract/Free Full Text]

d'Erfurth I, Cosson V, Eschstruth A, Lucas H, Kondorosi A, Ratet P (2003) Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula. Plant J 34: 95–106[CrossRef][ISI][Medline]

Dinant S, Maisonneuve B, Albouy J, Chupeau Y, Chupeau M-C, Bellec Y, Gaudefroy F, Kusiak C, Souche S, Robaglia C, et al (1997) Coat protein gene-mediated protection in Lactuca sativa against lettuce mosaic potyvirus strains. Mol Breed 3: 75–86[CrossRef]

Dubois V, Botton E, Meyer C, Rieu A, Bedu M, Maisonneuve B, Mazier M (2005) Systematic silencing of a tobacco nitrate reductase transgene in lettuce (Lactuca sativa L.). J Exp Bot 56: 2379–2388[Abstract/Free Full Text]

Ewing B, Green P (1998) Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Res 8: 186–194[Abstract/Free Full Text]

Ewing B, Hillier L, Wendl MC, Green P (1998) Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res 8: 175–185[Abstract/Free Full Text]

Grandbastien M-A, Audeon C, Casacuberta JM, Grappin P, Lucas H, Moreau C, Pouteau S (1994) Functional analysis of the tobacco Tnt1 retrotransposon. Genetica 93: 181–189[CrossRef][ISI][Medline]

Grandbastien MA, Spielmann A, Caboche M (1989) Tnt1, a mobile retroviral-like transposable element of tobacco isolated by plant cell genetics. Nature 337: 376–380[CrossRef][Medline]

Hirochika H (1997) Retrotransposons of rice: their regulation and use for genome analysis. Plant Mol Biol 35: 231–240[CrossRef][ISI][Medline]

Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5: 387–405[CrossRef]

Kaneko M, Inukai Y, Ueguchi-Tanaka M, Itoh H, Izawa T, Kobayashi Y, Hattori T, Miyao A, Hirochika H, Ashikari M, et al (2004) Loss-of-function mutations of the rice GAMYB gene impair {alpha}-amylase expression in aleurone and flower development. Plant Cell 16: 33–44[Abstract/Free Full Text]

Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant Cell 11: 2283–2290[Free Full Text]

Kulikova O, Gualtieri G, Geurts R, Kim DJ, Cook D, Huguet T, de Jong JH, Fransz PF, Bisseling T (2001) Integration of the FISH pachytene and genetic maps of Medicago truncatula. Plant J 27: 49–58[CrossRef][ISI][Medline]

Kumar A, Bennetzen JL (1999) Plant retrotransposons. Annu Rev Genet 33: 479–532[CrossRef][ISI][Medline]

Kumar A, Hirochika H (2001) Applications of retrotransposons as genetic tools in plant biology. Trends Plant Sci 6: 127–134[CrossRef][ISI][Medline]

Lelivelt CLC, McCabe MS, Newell CA, de Snoo CB, van Dun KMP, Birch-Machin I, Gray JC, Mills KHG, Nugent JM (2005) Stable plastid transformation in lettuce (Lactuca sativa L.). Plant Mol Biol 58: 763–774[CrossRef][ISI][Medline]

Lucas H, Feuerbach F, Kunert K, Grandbastien MA, Caboche M (1995) RNA-mediated transposition of the tobacco retrotransposon Tnt1 in Arabidopsis thaliana. EMBO J 14: 2364–2373[ISI][Medline]

Mazier M, German-Retana S, Flamain F, Dubois V, Botton E, Sarnette V, Le Gall O, Candresse T, Maisonneuve B (2004) A simple and efficient method for testing Lettuce mosaic virus resistance in in vitro cultivated lettuce. J Virol Methods 116: 123–131[CrossRef][ISI][Medline]

Mhiri C, De Wit PJM, Grandbastien M-A (1999) Activation of the promoter of the Tnt1 retrotransposon in tomato after inoculation with the fungal pathogen Cladosporium fulvum. Mol Plant Microbe Interact 12: 592–603[CrossRef][ISI]

Michelmore R, Marsh E, Seely S, Landry B (1987) Transformation of lettuce (Lactuca sativa) mediated by Agrobacterium tumefaciens. Plant Cell Rep 6: 430–442

Miyao A, Tanaka K, Murata K, Sawaki H, Takeda S, Abe K, Shinozuka Y, Onosato K, Hirochika H (2003) Target site specificity of the Tos17 retrotransposon shows a preference for insertion within genes and against insertion in retrotransposon-rich regions of the genome. Plant Cell 15: 1771–1780[Abstract/Free Full Text]

Moreau-Mhiri C, Morel J-B, Audeon C, Ferault M, Grandbastien M-A, Lucas H (1996) Regulation of expression of the tobacco Tnt1 retrotransposon in heterologous species following pathogen-related stresses. Plant J 9: 409–419[CrossRef][ISI]

Nonomura K-I, Nakano M, Fukuda T, Eiguchi M, Miyao A, Hirochika H, Kurata N (2004) The novel gene HOMOLOGOUS PAIRING ABERRATION IN RICE MEIOSIS1 of rice encodes a putative coiled-coil protein required for homologous chromosome pairing in meiosis. Plant Cell 16: 1008–1020[Abstract/Free Full Text]

Okamoto H, Hirochika H (2000) Efficient insertion mutagenesis of Arabidopsis by tissue culture-induced activation of the tobacco retrotransposon Tto1. Plant J 23: 291–304[Medline]

Okubara PA, Arroyo-Garcia R, Shen KA, Mazier M, Meyers BC, Ochoa OE, Kim S, Yang C-H, Michelmore RW (1997) A transgenic mutant of Lactuca sativa (lettuce) with a T-DNA tightly linked to loss of downy mildew resistance. Mol Plant Microbe Interact 10: 970–977[ISI][Medline]

Parinov S, Sundaresan V (2000) Functional genomics in Arabidopsis: large-scale international mutagenesis complements the genome-sequencing project. Curr Opin Biotechnol 11: 157–161[CrossRef][ISI][Medline]

Paszkowski J, Shillito RD, Saul M, Mandak V, Hohn T (1984) Direct gene transfer to plants. EMBO J 3: 2717–2722[ISI][Medline]

Pauls PK, Kunert K, Huttner E, Grandbastien MA (1994) Expression of the tobacco Tnt1 retrotransposon promoter in heterologous species. Plant Mol Biol 26: 393–402[CrossRef][ISI][Medline]

Pouteau S, Grandbastien M-A, Boccara M (1994) Microbial elicitors of plant defence responses activate transcription of a retrotransposon. Plant J 5: 535–542[CrossRef][ISI]

Pouteau S, Huttner E, Grandbastien MA, Caboche M (1991) Specific expression of the tobacco Tnt1 retrotransposon in protoplasts. EMBO J 10: 1911–1918[ISI][Medline]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Sidhu D, Gill KS (2004) Distribution of genes and recombination in wheat and other eukaryotes. Plant Cell Tissue Organ Cult 79: 257–270

Srinivasan R, Sundaresan V (2001) Transposons as tools for functional genomics. Plant Physiol Biochem 39: 243–252[CrossRef][ISI]

Tadege M, Ratet P, Mysore S (2005) Insertional mutagenesis: a Swiss army knife for functional genomics of Medicago truncatula. Trends Plant Sci 10: 229–235[CrossRef][ISI][Medline]

Walbot V (2000) Saturation mutagenesis using maize transposons. Curr Opin Plant Biol 3: 103–107[CrossRef][ISI][Medline]

Yamazaki M, Tsugawa H, Miyao A, Yano M, Wu J, Yamamoto S, Matsumoto T, Sasaki T, Hirochika H (2001) The rice retrotransposon Tos17 prefers low-copy number sequences as integration targets. Mol Genet Genomics 265: 336–344[CrossRef][ISI][Medline]

Yang C-H, Carroll B, Scofield S, Jones J, Michelmore R (1993a) Transactivation of Ds elements in plants of lettuce (Lactuca sativa). Mol Gen Genet 241: 389–398[ISI][Medline]

Yang C-H, Ellis JG, Michelmore RW (1993b) Infrequent transposition of Ac in lettuce, Lactuca sativa. Plant Mol Biol 22: 793–805[CrossRef][ISI][