|
|
||||||||
|
First published online March 16, 2007; 10.1104/pp.107.097154 Plant Physiology 144:793-805 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Cowpea Chloroplastic ATP Synthase Is the Source of Multiple Plant Defense Elicitors during Insect Herbivory1,2,[W],[OA]Center of Medical, Agricultural, and Veterinary Entomology, United States Department of Agriculture, Agricultural Research Service, Chemistry Research Unit, Gainesville, Florida 32608
In cowpea (Vigna unguiculata), fall armyworm (Spodoptera frugiperda) herbivory and oral secretions (OS) elicit phytohormone production and volatile emission due to inceptin [Vu-In; +ICDINGVCVDA], a peptide derived from chloroplastic ATP synthase -subunit (cATPC) proteins. Elicitor-induced plant volatiles can function as attractants for natural enemies of insect herbivores. We hypothesized that inceptins are gut proteolysis products and that larval OS should contain a mixture of related peptides. In this study, we identified three additional cATPC fragments, namely Vu-GE+In [+GEICDINGVCVDA], Vu-E+In [+EICDINGVCVDA], and Vu-InA [+ICDINGVCVD]. Leaf bioassays for induced ethylene (E) production demonstrated similar effective concentration50 values of 68, 45, and 87 fmol leaf1 for Vu-In, Vu-E+In, and Vu-GE+In, respectively; however, Vu-InA proved inactive. Shortly following ingestion of recombinant proteins harboring cATPC sequences, larval OS revealed similar concentrations of the three elicitors with 80% of the potential inceptin-related peptides recovered. Rapidly shifting peptide ratios over time were consistent with continued proteolysis and preferential stability of inceptin. Likewise, larvae ingesting host plants with inceptin precursors containing an internal trypsin cleavage site rapidly lost OS-based elicitor activity. OS containing inceptin elicited a rapid and sequential induction of defense-related phytohormones jasmonic acid, E, and salicylic acid at 30, 120, and 240 min, respectively, and also the volatile (E)-4,8-dimethyl-1,3,7-nonatriene. Similar to established peptide signals such as systemin and flg22, amino acid substitutions of Vu-In demonstrate an essential role for aspartic acid residues and an unaltered C terminus. In cowpea, insect gut proteolysis following herbivory generates inappropriate fragments of an essential metabolic enzyme enabling plant non-self-recognition.
Plant responses to biotic and abiotic perturbation often reduce the severity of future damage through complex changes, including increased cell wall lignification, hypersensitive responses that limit pathogen mobility, production of direct defenses toxic to the offending organism, or volatile emissions that act indirectly in the attraction of natural enemies of the pests (Hiraga et al., 2001
Mechanistic knowledge detailing how plants specifically recognize biotic attack comes primarily from pathology research and includes the established role of small peptides, derived from both plants and pathogens, as critical signals. In Arabidopsis (Arabidopsis thaliana), the isolated 23-amino acid peptide AtPep1 is produced from the 92-amino acid PROPEP1 protein and is both up-regulated by JA/E and requires functional JA/E signaling for defense gene (PDF1.2) expression (Huffaker et al., 2006
Despite advances in our understanding of pathogen-derived and endogenous peptide signals, the production of bioactive peptides specifically during insect herbivory has only recently been demonstrated. We utilized an induced E production bioassay in cowpea (Vigna unguiculata) leaves to guide the biochemical fractionation of elicitors from oral secretions (OS) of fall armyworm (Spodoptera frugiperda) larvae and isolated an 11-amino acid protein fragment. This peptide, termed inceptin, is derived from the proteolytic cleavage of chloroplastic ATP synthase To better understand how legumes recognize insect herbivores via peptide signals derived from plant metabolic proteins, we further examined components of armyworm larval OS and their role in eliciting cowpea responses. In this study, we investigated: (1) the range of inceptin-related peptides present in larval OS and their comparative biological activity; (2) the progressive pattern of peptide abundance and activity in larval OS following ingestion of proteins containing cATPC sequences; (3) the importance of leaf-derived OS containing inceptin-related peptides in triggering the rapid and dynamic production of phytohormone and volatile metabolites; and (4) structural features and amino acid residues of inceptin required for biological activity in cowpea, with a focus on induced E, SA, and DMNT volatile production. Consistent with the predicted proteolytic complexity of insect guts, we identify three additional inceptin-related peptides present in larval OS. We then demonstrate that peptides with additional N-terminal amino acids retain full elicitor activity, while C-terminal deletions abolish activity. Additionally, we show that inceptin-related peptides are rapidly generated in OS upon larval consumption of cATPC proteins and, consistent with gut proteolysis, exhibit preferential losses of larger peptide elicitors over time. Furthermore, we show that 1 µL of shoot-derived larval OS containing inceptin-related peptides initiates a rapid, sequential, and maximal induction of JA, E, and SA/DMNT in cowpea leaves at 30, 120, and 240 min, respectively. Comparatively, wounding plus cowpea root-derived OS lacking inceptins promotes only moderate JA increases. Finally, we demonstrate that the activity of modified inceptins in cowpea can vary slightly depending upon the induced biochemical marker selected but overall is highly sensitive to select modifications near the C terminus and relatively tolerant to numerous changes at the N terminus.
cATPC Is the Source of Multiple Active Elicitors
Lepidoptera larvae contain a diverse array of digestive proteases capable of converting plant proteins into complex peptide mixtures (Bown et al., 1997
The Inceptin C Terminus Is Required for Elicitor Activity To address how the differential proteolysis of inceptin-related peptides influences activity, we compared the Vu-In-induced E responses of cowpea leaves to the peptides containing additional N-terminal (Vu-E+In, Vu-GE+In) and cleaved C-terminal amino acids (Vu-InA). Peptides sharing the same C terminus, namely Vu-In, Vu-E+In, and Vu-GE+In, displayed similar effective concentration (EC)50 values for induced E production in cowpea leaves of 68, 45, and 87 fmol leaf1, respectively (Fig. 3 ). In contrast, Vu-InA proved inactive at all concentrations tested (Fig. 3). These results demonstrate the occurrence of at least three active peptide elicitors in the OS of armyworm and also identify proteolytic sites resulting in peptide inactivation.
Time-Dependent Changes in the Composition of Active Elicitors Cowpea-derived armyworm OS contain a mixture of active and inactive inceptin-related peptides, yet it was unknown how the levels of these peptides vary over time following larval ingestion of cATPC. To quantify the production and dynamics of inceptin-related peptides, we generated an Escherichia coli-expressed recombinant protein derived from eight repeated sequences of the chloroplast-specific region of soybean (Glycine max) atpC (termed glutathione S-transferase [GST]-GmIn8H), fed this protein to larvae, and collected OS either 2 or 6 h after the initiation of feeding. In the 2-h sample, the final NP-HPLC purification step resulted in two distinct regions of strong E-inducing activity eluting between 20 and 24 min (Fig. 4A ). In contrast, the 6-h sample produced only a single fraction with predominant E-inducing activity (Fig. 4C). In both samples, early (20.5 min) and late (2224 min) eluting activity closely corresponded with the relative amounts of [M + H]+ m/z 1,105.5 (Gm-In; +ICDVNGVCVDA), 1,234.5 (Gm-E+In), and 1,291.5 (Gm-GE+In; Fig. 4, B and D). The relatively poor elution behavior and fmol activity level of the inceptin-related peptides harboring an additional acidic group (E+In and GE+In) resulted in chromatographic tailing and a broad range of HPLC fractions promoting E induction (Figs. 1C and 4, A and C). These results indicate that levels and ratios of inceptin-related peptides in OS change over time following ingestion of cATPC.
OS Levels of Inceptin Display Preferential Stability over Related Peptides To better understand the dynamics and relative contribution of inceptin-related peptides to OS elicitor activity after ingestion of cATPC, we quantitatively analyzed a time course of selected peptides present in armyworm OS. Within 15 min of complete GST-GmIn8H protein consumption by larvae, defined here as time zero, Gm-In, Gm-E+In, and Gm-GE+In constituted a nearly equal mixture representing 36%, 38%, and 26% of the total active peptides, respectively (Fig. 5 ). Two hours after consumption of the GST-GmIn8H protein, the relative abundance of active peptides Gm-In, Gm-E+In, and Gm-GE+In shifted dramatically to 80%, 17%, and 3%, respectively. Rapid loss of the larger peptides Gm-GE+In and Gm-E+In follows predictions of continued gut proteolysis over time. Despite trace abundance, levels of Gm-InA increased 3.6-fold from 3.1 ± 0.6 to 11.3 ± 1.8 pmol larvae1 between 0 and 2 h, then declined back to 3.7 ± 1.1 pmol larvae1 at 6 h. While Gm-InA levels do not quantitatively account for the loss of active elicitors, this pattern is consistent with catabolism concordant with the dramatic loss of Gm-GE+In and Gm-E+In. Of the 492 pmol of inceptin-related peptides contained within the GST-GmIn8H protein consumed by each larva, 80.8% ± 1.9%, 42.2% ± 3.0%, 24.5% ± 5.5%, 11.1% ± 1.4%, and 4.9% ± 1.3% was recovered in the OS at times designated as 0, 2, 4, 6, and 8 h, respectively. These results demonstrate: (1) the rapid and efficient proteolysis of cATPC proteins into inceptin-related peptides; (2) the preferential stability of inceptin; and (3) the gradual loss of all inceptin-related peptides over time.
A Trypsin Cleavage Site within Inceptin Promotes the Loss of OS Elicitor Activity
The composition of armyworm OS during feeding is a rich combination of both plant and insect biochemicals and their reciprocal postingestive enzymatic products (Paulillo et al., 2000
Inceptins in Larvae OS Induce Sequential Increases in JA, E, SA, and Volatiles
We previously demonstrated that repeated applications of synthetic Vu-In promote increases in E, JA, SA, and volatile pools of DMNT in cowpea leaves at a single sampling time point; however, the temporal coordination of these events was unknown. To address the phytohormone dynamics elicited by a natural mixture of inceptin-related peptides, we analyzed and bioassayed OS collected from larvae actively feeding on either cowpea roots or shoots. Root-derived OS lacked inceptins (<10 fmol µL1), while shoot-derived OS contained Vu-In, Vu-E+In, and Vu-GE+In at concentrations of 616 ± 59, 170 ± 17, and 150 ± 15 fmol µL1, respectively (n = 4, ±SEM). Wounding plus root-derived OS-induced increases in JA levels above unwounded control leaves at 30 min (Fig. 7A
); however, shoot-derived OS induced the highest JA accumulations at 30, 60, and 90 min. Root-derived OS treatments failed to result in significant increases in E, SA, or DMNT (Fig. 7, BD), while shoot-derived OS induced a sequential maximal production of JA, E, and SA at 30, 120, and 240 min, respectively (Fig. 7, AC). A similar yet delayed sequential activation of phytohormones has been described during Xanthomonas pathogen infection of tomato (O'Donnell et al., 2003
Ala Substitution of Inceptin Reveals Roles for Asp, Cys, and the C Terminus Of all the potential peptides present in the OS of actively feeding larvae, inceptin-related fragments are hypothesized to possess a unique sequence that promotes activity. Here, we consider the cyclic structure, the role of individual Vu-In residues via Ala substitutions, and flexibility (via additions and deletions) of both termini in the elicitation of E, SA, and DMNT as different markers for activity. Peptides and their abbreviations considered in this experiment are detailed in Figure 8 . In the E bioassay, replacement of the penultimate C-terminal Asp (Vu-In-A10) completely abolished activity (Fig. 8A). Surprisingly, replacement of the Cys proximal to the N terminus (Vu-In-A2) resulted in statistically insignificant reduction of activity, suggesting a nonessential role of the disulfide bridge and cyclized peptide. Significant reductions in E-inducing activity were detected in Vu-In-A3, Vu-In-A8, and Vu-In-A10, demonstrating important functions for both Asp residues and the Cys proximal to the C terminus. Both removal (Vu-InA) and addition (Vu-In+A) of Ala to the C terminus significantly reduced activity (Fig. 8A), whereas additions (Vu-E+In; Fig. 3) and truncations (Vu-IIn; Fig. 8A) at the N terminus had no significant effect on E production. The only substitutions, additions, or truncations that abolished induced E activity were within the last four amino acids of the C terminus.
Similar to the E responses, SA production was significantly lower in response to modifications at the C terminus, including Vu-In-A10, Vu-InA, and Vu-In+A (Fig. 8B). However, amino acid sequence modifications proximal to the N terminus (Vu-In-A3) and substitution of either Cys residue (Vu-In-A2 and Vu-In-A8) failed to significantly reduce SA accumulation compared to Vu-In (Fig. 8B). This contrasts the pattern established for E production and suggests that the SA responses may occur at either lower elicitor concentrations or have different ligand-binding requirements. Accumulation of tissue levels of DMNT more closely mirrored elicitor-induced changes in E production. Substitution of both Asp residues (Vu-In-A3 and Vu-In-A10) significantly reduced DMNT accumulation compared to Vu-In (Fig. 8C). Likewise, removal or addition of Ala to the C terminus in peptides Vu-InA and Vu-In+A also suppressed DMNT levels. Substitution of either Cys (Vu-In-A2 and Vu-In-A8) produced weak intermediate DMNT responses not statistically different from numerous active and inactive peptides. JA levels were also measured at 4 h but, as expected, did not display strong patterns, in part due to the relaxation of the response at this time point (Fig. 7A; E.A. Schmelz, unpublished data). These activity assays demonstrate a significant role for Asp residues, relative flexibility of additions or truncations at the N but not at the C terminus, and a nonessential role of the Vu-In disulfide bridge for phytohormone activity.
As a model, we propose that herbivory by armyworm larvae on cowpea leaves generates three active peptide elicitors, namely Vu-In, Vu-E+In, and Vu-GE+In, during gut proteolysis of ingested cATPC proteins (Fig. 9 ). During herbivory, larval OS contact the feeding sites (Truitt and Pare, 2004 -ocimene, MeSA, indole, (E)- -farnesene, (E,E)- -farnesene, and (3E,7E)-4,8,12-trimethyl-1,3,7,11-tridecatetraene (Schmelz et al., 2006
Peptides regulate numerous processes, including rapid responses to biotic and abiotic stress. Biochemically characterized endogenous peptides include systemins, AtPep1, phytosulfokine, S-locus Cys-rich protein, and the rapid alkalinization factor, which are involved in wound-induced defenses, Pythium resistance, somatic embryogenesis, self-incompatibility, and root growth inhibition, respectively (Huffaker et al., 2006
In contrast to previously described plant peptide signals, prior to proteolysis, inceptin functions in planta as a critical dithiol region and redox switch that controls ATPase activity (Samra et al., 2006
Unlike pathogens, receptor-ligand pairs mediating specific nematode and insect resistance in plants remain unknown. Over a dozen nematode and insect R genes have been either cloned or mapped in close association with NBS-LRR gene clusters, yet no corresponding ligands have been identified (Rossi et al., 1998
For elicitors derived from variable length polypeptides, understanding the exact size of predominant native ligands is often not trivial. For example, despite considerable research, the actual contribution to elicitation in planta caused by prosystemin (23 kD) and flagellin (33 kD) relative to their respective active core peptides remains unclear. Comparatively, both intact proteins display 100-fold lower EC50s for alkalinization responses than the corresponding core peptides, yet still retain potent activity in the picomolar to nanomolar range (Dombrowski et al., 1999
To assess the production of bioactive peptides, we fed larvae recombinant GST-GmIn8H proteins derived from the soybean cATPC gene. This sequence encodes inceptin-related peptides identical to maize, established to have activity in cowpea equivalent to Vu-In (Schmelz et al., 2006
Peptide signals are known to mediate complex reorganizations in transcription and metabolite production, in part through phytohormone signaling pathways (Navarro et al., 2004
Inceptin activity depends on a limited number of conserved amino acid residues. As with systemin and flg22 deletion studies (Pearce et al., 1993
Through the overexpression of precursor proteins, plant-derived peptide signals have been used to elevate the expression of plant defenses and resistance to biotic attack (McGurl et al., 1994
Plant and Insect Material
Armyworm (Spodoptera frugiperda) eggs were obtained from Dr. R. Meagher (U.S. Department of Agriculture-Agricultural Research Service, Gainesville, FL) and reared on a pinto bean (Phaseolus vulgaris) diet (Schmelz et al., 2003a
All experiments used 2- to 3-week-old plants containing two fully expanded pairs of trifoliate leaves. For all induction assays, the adaxial sides of new fully expanded leaves were superficially scratched with a razor in three areas, removing approximately 5% of the total waxy cuticle. The damage sites (2 cm2 each) included the central leaf tip spanning both sides of the midrib and two midbasal sections on opposite sides of the midrib. Test solutions in 5 µL water were immediately applied and dispersed over the damage sites. Leaves remained on the intact plants for specified lengths of time prior to E and leaf metabolite sampling. Large-scale collection of OS from the sixth instar larvae was as previously described (Turlings et al., 1993
As previously reported, a 100-mL sample of cowpea-derived armyworm OS was initially fractionated using RP-C18 and strong anion exchange Discovery solid phase extraction columns (Supelco; Schmelz et al., 2006
Edmund chemical N-terminal sequencing was performed as previously described (Schmelz et al., 2006
Synthetic Vu-GE+In, Vu-E+In, Vu-In, and Vu-InA peptides were HPLC purified, dissolved into water, and applied (n = 4) at 1.3, 4, 12, 45, 130, 430, 1,280, 4,300, and 12,800 fmol leaf1 to a total of 144 cowpea leaves. Immediately prior to the construction of these dilutions, peptide concentrations in stock solutions were analyzed by LC/MS and adjusted. Compared to Vu-In, natural and synthetic Vu-GE+In and Vu-E+In consistently displayed greater losses of these peptides in solution suggesting lower aqueous solubility.
Primers CTCGAGATGGCTGATGATGTTTTCTCAC and GCGGCCGCATAGATCTATCCCTCTCCACAGTCAAC, which contain XhoI and NotI sites, respectively, were used to amplify cDNA from soybean leaves with the resulting 253-bp PCR product cloned into a TOPO pCRII vector (Invitrogen). The soybean chloroplastic atpC partial sequence generated was deposited in GenBank (EF185283). This fragment contains a BamHI site 95 bp downstream of the XhoI site and a BglII site 34 bp upstream of the NotI site. The 230-bp XhoI-BglII fragment and the 145-bp BamHI-NotI fragment were ligated together with pBluescript SK+ cut with XhoI and NotI to create a construct with two inceptin fragments. This SK+ GmIn2 construct was cut with BglII + NotI and BamHI + NotI, and then the gel-purified 3.2-kb and 145-bp fragments were ligated to create SK+ GmIn4. This process was repeated once more to generate the SK+ GmIn8 construct. To introduce a polyhistidine tag, primers Bgl2HIS-F (GATCACCACCACCACCACCAC CACCAC) and Blg2HIS-R (GATCGTGGTGGTGGTGGTGGTGGTGGT) were phosphorylated with T4 polynucleotide kinase (Invitrogen), annealed with one another to create BglII-compatible overhangs, and ligated with BglII-cut SK+ GmIn8. The 1.2-kb XhoI-NotI GmIn8H fragment was then ligated to SalI-NotI cut pET41b(+) (Novagen). This construct was transformed into BL21DE3pLysS Escherichia coli (Novagen) and was used to express GST-GmIn8H upon the addition of 1 mM isopropylthio- To estimate the amount of GST-GmIn8H fed to armyworm larvae, a dilution series containing the equivalent of 0.1, 0.3, 1.0, and 3.0 µL of protein was subject to SDS-PAGE next to known concentrations of pure His-tagged GST. Duplicate gels were either stained with Coomassie Blue or transferred to polyvinylidene difluoride membrane for western blot with mouse monoclonal anti-6x His antibody (Sigma) followed by peroxidase conjugated antimouse (Sigma). Reactive proteins were visualized by chemiluminescent staining followed by exposure to x-ray film. Both films and stained gels were photographed with the Bio-Rad Gel-Doc system and quantified with Quantity One software (Bio-Rad). The slope of the line for the GST standard was used to calculate the concentration of GST-GmIn8H in each lane and average molecules/microliter was determined based on the molecular mass of GST and GST-GmIn8H.
To examine inceptin-related peptide production in armyworm OS, we allowed 24 individual larva to consume 10-mm2 pieces of cellulose filter paper saturated with 20 µL of 20% Suc solution containing 9.6 µg GST-GmIn8H for either 2 or 6 h. Amounts of filter paper consumed varied greatly, and larval OS were pooled into single 280-µL samples at each time point. The 2- and 6-h samples were purified using a combination of RP-C18/strong anion exchange SPE and RP-C18 HPLC with all active fractions combined for the final NP-HPLC separation. To aid in reproducibility of diet consumption by larvae and quantitatively explore the dynamics of inceptin production, isolated sixth instar armyworm were deprived of artificial diet for 12 h, then allowed to consume a 5-mm2 piece of cellulose filter paper saturated with 10 µL of 20% Suc solution containing 4.8 µg GST-GmIn8H. All larvae completed consumption of the protein between 45 and 60 min after initial access to the filter paper diet. Within 15 min of completed diet consumption (
Quantification of inceptin-related peptides was achieved using ubiquitously labeled 13C and 15N Val-N-FMOC (V*; Cambridge Isotope Laboratories) incorporated into the synthetic peptide [Vu-I; +ICDING-V*-CVDA]. Aliquots of crude OS (typically 50100 µL) were sequentially spiked with 50 ng of the internal standard peptide, 5 µL HCOOH, vortexed, and centrifuged at 12,000g for 5 min. The aqueous phase was mixed with an equal volume of ethanol, stored at 70°C for 30 min, and centrifuged 12,000g for 2 min. Samples were diluted to 5% ethanol, loaded on 100-mg RP-C18 SPE columns, washed with 2 mL of water, and eluted with 9:1 CH3CN:water. Samples were then concentrated to dryness under vacuum, brought up in 50 µL 5:95 CH3CN:water containing 10 mM HCO2NH4 and 10 µL analyzed by LC-MS as described. Quantification was based on peak retention times (9.710.2 min) and monitoring of [M + H]+ ions with a m/z of 1,125.5 (ISTD), 1,034.5 (Gm-InA), 1,105.5 (Gm-In), 1,234.5 (Gm-E+In), 1,291.5 (Gm-GE+In), 1,048.5 (Vu-InA), 1,119.5 (Vu-In), 1,248.5 (Vu-E+In), and 1,305.5 (Vu-GE+In). The identity of each peptide was confirmed with MS2 daughter ion spectra.
Gas chromatography-based quantification of elicitor-induced E production followed from Schmelz et al. (2006)
To consider amino acid residues important for inceptin signaling, peptides with additional and deleted amino acids at both the N and C termini were examined along with an Ala substitution series of Vu-In. These peptides were synthesized by Genosys (Sigma-Aldrich) and subsequently HPLC purified using RP-C18 to >90%. Significant solubility differences in these peptides necessitated estimation of actual aqueous concentrations using LC/MS and selected [M + H]+ m/z ion monitoring to determine peak areas. Analysis of dilutions resulted in a final concentration of 4 pmol leaf1 for all peptides assayed. Based on the timing of the dynamics of induced phytohormone changes (Fig. 7, AD), we focused on E production between 60 and 120 min and SA/DMNT pools at 240 min. In this experiment, the cowpea leaf tip (n = 4) was excised at 1 h for E analysis while the treated basal leaf section remained attached and was harvested at 4 h for metabolite analysis. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number EF185283.
The following materials are available in the online version of this article.
We thank R.L. Meagher, N. Lowman, and C. Dillard for supplying armyworm larvae, A.Y. Chung for peptide synthesis, G. Pearce and G. Munske for amino acid sequencing, T. Davis and J. Meredith for experimental assistance, H.J. Klee and A.R. Zangerl for useful editorial feedback, and two anonymous reviewers for improving the manuscript. Received January 31, 2007; accepted March 5, 2007; published March 16, 2007.
1 This work was supported by the U.S. Department of Agriculture, Agricultural Research Service (base funds directed to project no. 66152243000200D).
2 The use of trade, firm, or corporation names in this publication (or page) is for the information and convenience of the reader. Such use does not constitute an official endorsement or approval by the United States Department of Agriculture or the Agricultural Research Service of any product or service to the exclusion of others that may be suitable. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Eric A. Schmelz (eschmelz{at}gainesville.usda.ufl.edu).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.097154 * Corresponding author; e-mail eschmelz{at}gainesville.usda.ufl.edu; fax 3523745707.
Abramovitch RB, Anderson JC, Martin GB (2006) Bacterial elicitation and evasion of plant innate immunity. Nat Rev Mol Cell Biol 7: 601611[CrossRef][Web of Science][Medline] Alghali AM (1991) Integrated pest-management strategy for cowpea production under residual soil-moisture in the Bida area of Northern Nigeria. Trop Pest Manage 37: 224227 Axtell MJ, Staskawicz BJ (2003) Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112: 369377[CrossRef][Web of Science][Medline] Boland W, Hopke J, Donath J, Nuske J, Bublitz F (1995) Jasmonic acid and coronatin induce odor production in plants. Angew Chem Int Ed Engl 34: 16001602[CrossRef][Web of Science] Boller T (2005) Peptide signalling in plant development and self/non-self perception. Curr Opin Cell Biol 17: 116122[CrossRef][Web of Science][Medline] Bottenberg H, Tamo M, Singh BB (1998) Occurrence of phytophagous insects on wild Vigna sp. and cultivated cowpea: comparing the relative importance of host-plant resistance and millet intercropping. Agric Ecosyst Environ 70: 217229[CrossRef] Bown DP, Wilkinson HS, Gatehouse JA (1997) Differentially regulated inhibitor-sensitive and insensitive protease genes from the phytophagous insect pest, Helicoverpa armigara, are members of complex multigene families. Insect Biochem Mol Biol 27: 625638[CrossRef][Web of Science][Medline] Brotman Y, Silberstein L, Kovalski I, Perin C, Dogimont C, Pitrat M, Klingler J, Thompson GA, Perl-Treves R (2002) Resistance gene homologues in melon are linked to genetic loci conferring disease and pest resistance. Theor Appl Genet 104: 10551063[CrossRef][Web of Science][Medline] Calabrese EJ, Baldwin LA (2003) Peptides and hormesis. Crit Rev Toxicol 33: 355405[Web of Science][Medline] Chapman RF (2003) Contact chemoreception infeeding by phytophagous insects. Annu Rev Entomol 48: 455484[CrossRef][Web of Science][Medline] Chen H, Wilkerson CG, Kuchar JA, Phinney BS, Howe GA (2005) Jasmonate-inducible plant enzymes degrade essential amino acids in the herbivore midgut. Proc Natl Acad Sci USA 102: 1923719242 Clark RJ, Fischer H, Dempster L, Daly NL, Rosengren KJ, Nevin ST, Meunier FA, Adams DJ, Craik DJ (2005) Engineering stable peptide toxins by means of backbone cyclization: stabilization of the alpha-conotoxin MII. Proc Natl Acad Sci USA 102: 1376713772 Cooper LD, Doss RP, Price R, Peterson K, Oliver JE (2005) Application of Bruchin B to pea pods results in the up-regulation of CYP93C18, a putative isoflavone synthase gene, and an increase in the level of pisatin, an isoflavone phytoalexin. J Exp Bot 56: 12291237 Dangl JL, Jones JDG (2001) Plant pathogens and integrated defence responses to infection. Nature 411: 826833[CrossRef][Medline] De Boer JG, Dicke M (2004) The role of methyl salicylate in prey searching behavior of the predatory mite Phytoseiulus persimilis. J Chem Ecol 30: 255271[CrossRef][Web of Science][Medline] Degenhardt J, Gershenzon J, Baldwin IT, Kessler A (2003) Attracting friends to feast on foes: engineering terpene emission to make crop plants more attractive to herbivore enemies. Curr Opin Biotechnol 14: 169176[CrossRef][Web of Science][Medline] Dicke M, Gols R, Ludeking D, Posthumus MA (1999) Jasmonic acid and herbivory differentially induce carnivore-attracting plant volatiles in lima bean plants. J Chem Ecol 25: 19071922[CrossRef][Web of Science] Dodds PN, Lawrence GJ, Catanzariti AM, Teh T, Wang CIA, Ayliffe MA, Kobe B, Ellis JG (2006) Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc Natl Acad Sci USA 103: 88888893 Dombrowski JE, Pearce G, Ryan CA (1999) Proteinase inhibitor-inducing activity of the prohormone prosystemin resides exclusively in the C-terminal systemin domain. Proc Natl Acad Sci USA 96: 1294712952 Doss RP, Oliver JE, Proebsting WM, Potter SW, Kuy SR, Clement SL, Williamson RT, Carney JR, DeVilbiss ED (2000) Bruchins: insect-derived plant regulators that stimulate neoplasm formation. Proc Natl Acad Sci USA 97: 62186223 Felix G, Boller T (1995) Systemin induces rapid ion fluxes and ethylene biosynthesis in Lycopersicon-peruvianum cells. Plant J 7: 381389[CrossRef][Web of Science] Felix G, Duran JD, Volko S, Boller T (1999) Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. Plant J 18: 265276[CrossRef][Web of Science][Medline] Ferreira C, Capella AN, Sitnik R, Terra WR (1994) Digestive enzymes in midgut cells, endoperitrophic and ectoperitrophic contents, and peritrophic membranes of Spodoptera frugiperda (Lepidoptera) larvae. Arch Insect Biochem Physiol 26: 299313[CrossRef][Web of Science] Gomez SK, Cox MM, Bede JC, Inoue K, Alborn HT, Tumlinson JH, Korth KL (2005) Lepidopteran herbivory and oral factors induce transcripts encoding novel terpene synthases in Medicago truncatula. Arch Insect Biochem Physiol 58: 114127[CrossRef][Web of Science][Medline] Gomez-Gomez L, Bauer Z, Boller T (2001) Both the extracellular leucine-rich repeat domain and the kinase activity of FLS2 are required for flagellin binding and signaling in Arabidopsis. Plant Cell 13: 11551163 Greenberg JT, Yao N (2004) The role and regulation of programmed cell death in plant-pathogen interactions. Cell Microbiol 6: 201211[CrossRef][Web of Science][Medline] Hightower KE, McCarty RE (1996) Proteolytic cleavage within a regulatory region of the gamma subunit of chloroplast coupling factor 1. Biochemistry 35: 48464851[CrossRef][Medline] Hiraga S, Sasaki K, Ito H, Ohashi Y, Matsui H (2001) A large family of class III plant peroxidases. Plant Cell Physiol 42: 462468 Horton DA, Bourne GT, Smythe ML (2000) Exploring privileged structures: the combinatorial synthesis of cyclic peptides. Mol Divers 5: 289304[CrossRef] Howe GA (2004) Jasmonates as signals in the wound response. J Plant Growth Regul 23: 223237 Howe GA, Lightner J, Browse J, Ryan CA (1996) An octadecanoid pathway mutant (JL5) of tomato is compromised in signaling for defense against insect attack. Plant Cell 8: 20672077[Abstract] Huffaker A, Pearce G, Ryan CA (2006) An endogenous peptide signal in Arabidopsis activates components of the innate immune response. Proc Natl Acad Sci USA 103: 1009810103 Jackai LEN, Padulosi S, Ng Q (1996) Resistance to the legume pod borer, Maruca vitrata Fabricius, and the probable modalities involved in wild Vigna. Crop Prot 15: 753761[CrossRef] James DG (2005) Further field evaluation of synthetic herbivore-induced plant volatiles as attractants for beneficial insects. J Chem Ecol 31: 481495[CrossRef][Web of Science][Medline] Jones DA, Thomas CM, Hammondkosack KE, Balintkurti PJ, Jones JDG (1994) Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science 266: 789793 Jones JDG, Dangl JL (2006) The plant immune system. Nature 444: 323329[CrossRef][Medline] Kappers IF, Aharoni A, van Herpen T, Luckerhoff LLP, Dicke M, Bouwmeester HJ (2005) Genetic engineering of terpenoid metabolism attracts, bodyguards to Arabidopsis. Science 309: 20702072 Keil B (1992) Specificity of Proteolysis. Springer-Verlag, Berlin Kessler A, Baldwin IT (2002) Plant responses to insect herbivory: the emerging molecular analysis. Annu Rev Plant Biol 53: 299328[CrossRef][Medline] Klingler J, Creasy R, Gao LL, Nair RM, Calix AS, Jacob HS, Edwards OR, Singh KB (2005) Aphid resistance in Medicago truncatula involves antixenosis and phloem-specific, inducible antibiosis, and maps to a single locus flanked by NBS-LRR resistance gene analogs. Plant Physiol 137: 14451455 Mackey D, Belkhadir Y, Alonso JM, Ecker JR, Dangl JL (2003) Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 112: 379389[CrossRef][Web of Science][Medline] Maffei M, Bossi S, Spiteller D, Mithofer A, Boland W (2004) Effects of feeding Spodoptera littoralis on lima bean leaves. I. Membrane potentials, intracellular calcium variations, oral secretions, and regurgitate components. Plant Physiol 134: 17521762 Martin JS, Martin MM, Bernays EA (1987) Failure of tannic-acid to inhibit digestion or reduce digestibility of plant protein in gut fluids of insect herbivores: implications for theories of plant defense. J Chem Ecol 13: 605621[CrossRef][Web of Science] Matsubayashi Y, Sakagami Y (2006) Peptide hormones in plants. Annu Rev Plant Biol 57: 649674[CrossRef][Medline] McGurl B, Orozcocardenas M, Pearce G, Ryan CA (1994) Overexpression of the prosystemin gene in transgenic tomato plants generates a systemic signal that constitutively induces proteinase-inhibitor synthesis. Proc Natl Acad Sci USA 91: 97999802 Meindl T, Boller T, Felix G (1998) The plant wound hormone systemin binds with the N-terminal part to its receptor but needs the C-terminal part to activate it. Plant Cell 10: 15611570 Meindl T, Boller T, Felix G (2000) The bacterial elicitor flagellin activates its receptor in tomato cells according to the address-message concept. Plant Cell 12: 17831794 Miki J, Maeda M, Mukohata Y, Futai M (1988) The gamma-subunit of ATP synthase from spinach-chloroplastsprimary structure deduced from the cloned cDNA sequence. FEBS Lett 232: 221226[CrossRef][Web of Science][Medline] Mithofer A, Wanner G, Boland W (2005) Effects of feeding Spodoptera littoralis on lima bean leaves. II. Continuous mechanical wounding resembling insect feeding is sufficient to elicit herbivory-related volatile emission. Plant Physiol 137: 11601168 Mohan S, Ma PWK, Pechan T, Bassford ER, Williams WP, Luthe DS (2006) Degradation of the S. frugiperda peritrophic matrix by an inducible maize cysteine protease. J Insect Physiol 52: 2128[CrossRef][Web of Science][Medline] Navarro L, Zipfel C, Rowland O, Keller I, Robatzek S, Boller T, Jones JDG (2004) The transcriptional innate immune response to flg22 interplay and overlap with Avr gene-dependent defense responses and bacterial pathogenesis. Plant Physiol 135: 11131128 O'Donnell PJ, Schmelz E, Block A, Miersch O, Wasternack C, Jones JB, Klee HJ (2003) Multiple hormones act sequentially to mediate a susceptible tomato pathogen defense response. Plant Physiol 133: 11811189 Paulillo L, Lopes AR, Cristofoletti PT, Parra JRP, Terra WR, Silva MC (2000) Changes in midgut endopeptidase activity of Spodoptera frugiperda (Lepidoptera: Noctuidae) are responsible for adaptation to soybean proteinase inhibitors. J Econ Entomol 93: 892896[Web of Science][Medline] Pearce G, Johnson S, Ryan CA (1993) Structure-activity of deleted and substituted systemin, an 18-amino acid polypeptide inducer of plant defensive genes. J Biol Chem 268: 212216 Pearce G, Moura DS, Stratmann J, Ryan CA (2001) Production of multiple plant hormones from a single polyprotein precursor. Nature 411: 817820[CrossRef][Medline] Pearce G, Ryan CA (2003) Systemic signaling in tomato plants for defense against herbivores: isolation and characterization of three novel defense-signaling glycopeptide hormones coded in a single precursor gene. J Biol Chem 278: 3004430050 Pearce G, Strydom D, Johnson S, Ryan CA (1991) A polypeptide from tomato leaves induces wound-inducible proteinase-inhibitor proteins. Science 253: 895898 Ren F, Lu YT (2006) Overexpression of tobacco hydroxyproline-rich glycopeptide systemin precursor A gene in transgenic tobacco enhances resistance against Helicoverpa armigera larvae. Plant Sci 171: 286292 Rossi M, Goggin FL, Milligan SB, Kaloshian I, Ullman DE, Williamson VM (1998) The nematode resistance gene Mi of tomato confers resistance against the potato aphid. Proc Natl Acad Sci USA 95: 97509754 Ryan CA, Pearce G (2003) Systemins: a functionally defined family of peptide signal that regulate defensive genes in Solanaceae species. Proc Natl Acad Sci USA 100: 1457714580 Samra HS, Gao F, He F, Hoang E, Chen ZG, Gegenheimer PA, Berrie CL, Richter ML (2006) Structural analysis of the regulatory dithiol-containing domain of the chloroplast ATP synthase gamma subunit. J Biol Chem 281: 3104131049 Scheer JM, Ryan CA (2002) The systemin receptor SR160 from Lycopersicon peruvianum is a member of the LRR receptor kinase family. Proc Natl Acad Sci USA 99: 95859590 Schmelz EA, Alborn HT, Banchio E, Tumlinson JH (2003a) Quantitative relationships between induced jasmonic acid levels and volatile emission in Zea mays during Spodoptera exigua herbivory. Planta 216: 665673[Web of Science][Medline] Schmelz EA, Alborn HT, Engelberth J, Tumlinson JH (2003b) Nitrogen deficiency increases volicitin-induced volatile emission, jasmonic acid accumulation, and ethylene sensitivity in maize. Plant Physiol 133: 295306 Schmelz EA, Alborn HT, Tumlinson JH (2003c) Synergistic interactions between volicitin, jasmonic acid and ethylene mediate insect-induced volatile emission in Zea mays. Physiol Plant 117: 403412[CrossRef][Medline] Schmelz EA, Carroll MJ, LeClere S, Phipps SM, Meredith J, Chourey PS, Alborn HT, Teal PEA (2006) Fragments of ATP synthase mediate plant perception of insect attack. Proc Natl Acad Sci USA 103: 88948899 Schmelz EA, Engelberth J, Tumlinson JH, Block A, Alborn HT (2004) The use of vapor phase extraction in metabolic profiling of phytohormones and other metabolites. Plant J 39: 790808[CrossRef][Web of Science][Medline] Shao F, Golstein C, Ade J, Stoutemyer M, Dixon JE, Innes RW (2003) Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science 301: 12301233 Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner J, Wang B, Zhai WX, Zhu LH, et al (1995) A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270: 18041806 Stratmann JW, Ryan CA (1997) Myelin basic protein kinase activity in tomato leaves is induced systemically by wounding and increases in response to systemin and oligosaccharide elicitors. Proc Natl Acad Sci USA 94: 1108511089 Sun WX, Dunning FM, Pfund C, Weingarten R, Bent AF (2006) Within-species flagellin polymorphism in Xanthomonas campestris pv campestris and its impact on elicitation of Arabidopsis FLAGELLIN SENSING2-dependent defenses. Plant Cell 18: 764779 Truitt CL, Pare PW (2004) In situ translocation of volicitin by beet armyworm larvae to maize and systemic immobility of the herbivore elicitor in planta. Planta 218: 9991007[CrossRef][Web of Science][Medline] Truitt CL, Wei HX, Pare PW (2004) A plasma membrane protein from Zea mays binds with the herbivore elicitor volicitin. Plant Cell 16: 523532 Turlings TCJ, McCall PJ, Alborn HT, Tumlinson JH (1993) An elicitor in caterpillar oral secretions that induces corn seedlings to emit chemical signals attractive to parasitic wasps. J Chem Ecol 19: 411425[CrossRef][Web of Science] Williamson VM, Kumar A (2006) Nematode resistance in plants: the battle underground. Trends Genet 22: 396403[CrossRef][Web of Science][Medline] Yamaguchi Y, Pearce G, Ryan CA (2006) The cell surface leucine-rich repeat receptor for AtPep1, an endoaenous peptide elicitor in Arabidopsis, is functional in transgenic tobacco cells. Proc Natl Acad Sci USA 103: 1010410109 Zhao J, Davis LC, Verpoorte R (2005) Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol Adv 23: 283333[CrossRef][Web of Science][Medline] Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JDG, Boller T, Felix G (2006) Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125: 749760[CrossRef][Web of Science][Medline] Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JDG, Felix G, Boller T (2004) Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428: 764767[CrossRef][Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|