|
|
||||||||
|
First published online June 1, 2007; 10.1104/pp.107.099705 Plant Physiology 144:1292-1304 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Chemical Genetic Identification of Glutamine Phosphoribosylpyrophosphate Amidotransferase as the Target for a Novel Bleaching Herbicide in Arabidopsis[W],[OA]Dow AgroSciences, Discovery Research, Indianapolis, Indiana 46268 (T.A.W., T.B., R.N., A.O.M., P.R.S.); Exelixis, South San Francisco, California 940830511 (G.R.H., M.H.); and Exelixis Plant Sciences, Portland, Oregon 97224 (W.M., K.W., J.P.D.)
A novel phenyltriazole acetic acid compound (DAS734) produced bleaching of new growth on a variety of dicotyledonous weeds and was a potent inhibitor of Arabidopsis (Arabidopsis thaliana) seedling growth. The phytotoxic effects of DAS734 on Arabidopsis were completely alleviated by addition of adenine to the growth media. A screen of ethylmethanesulfonate-mutagenized Arabidopsis seedlings recovered seven lines with resistance levels to DAS734 ranging from 5- to 125-fold. Genetic tests determined that all the resistance mutations were dominant and allelic. One mutation was mapped to an interval on chromosome 4 containing At4g34740, which encodes an isoform of glutamine phosphoribosylamidotransferase (AtGPRAT2), the first enzyme of the purine biosynthetic pathway. Sequencing of At4g34740 from the resistant lines showed that all seven contained mutations producing changes in the encoded polypeptide sequence. Two lines with the highest level of resistance (125-fold) contained the mutation R264K. The wild-type and mutant AtGPRAT2 enzymes were cloned and functionally overexpressed in Escherichia coli. Assays of the recombinant enzyme showed that DAS734 was a potent, slow-binding inhibitor of the wild-type enzyme (I50 approximately 0.2 µM), whereas the mutant enzyme R264K was not significantly inhibited by 200 µM DAS734. Another GPRAT isoform in Arabidopsis, AtGPRAT3, was also inhibited by DAS734. This combination of chemical, genetic, and biochemical evidence indicates that the phytotoxicity of DAS734 arises from direct inhibition of GPRAT and establishes its utility as a new and specific chemical genetic probe of plant purine biosynthesis. The effects of this novel GPRAT inhibitor are compared to the phenotypes of known AtGPRAT genetic mutants.
The developing field of chemical genetics relies on the ability of certain small molecules to mimic the effect of genetic mutations by blocking, or otherwise modulating, specific cellular processes (Stockwell, 2000
Currently there are few small molecules that are known to act directly and specifically on purine biosynthesis, particularly in the early steps of the pathway. This important pathway in plant primary metabolism (Fig. 1A
) produces purine precursors for DNA and RNA synthesis, for the energy transfer and building block nucleotides ATP and GTP, and as components of important coenzymes such NAD, S-adenosyl-Met, and FMN (Moffatt and Ashihara, 2002
We found that treatment of plants with a simple but novel phenyltriazole acetic acid compound results in a phytotoxic phenotype of interest in several dicotyledonous plant species by producing distinctive bleaching of developing leaves. The compound is especially potent on Arabidopsis (Arabidopsis thaliana). A better understanding of the observed biological effects (phenotypes) of chemical genetic probes can be gained by knowledge of their specific target site(s). However, determination of the precise biochemical targets of effective compounds is often a difficult and rate-limiting step in the exploitation of new compounds for chemical genetic studies (Burdine and Kodadek, 2004
Phytotoxic Activity of DAS734 The phenyltriazole acetic acid [5-(4-chlorophenyl)-1-isopropyl-1H-[1,2,4]triazol-3-yl]-acetic acid (DAS734; Fig. 1B) exerted modest herbicidal activity on the seedlings of several dicotyledonous weed species in greenhouse postemergent applications. It was most active on morningglory (Ipomoea hederacea), field pansy (Viola arvensis), redroot pigweed (Amaranthus retroflexus), and buckwheat (Polygonum convolvulus). The phytotoxic symptoms were characterized by extensive bleaching of new growth such that newly emerging leaves turned white (Fig. 1C). Although greenhouse activity against commercially relevant weeds was modest, we found that DAS734 was very phytotoxic to Arabidopsis seedlings grown on agarose media containing the compound (Fig. 1D). The concentration of DAS734 required to inhibit root growth by 50% (RI50) was 200 nM. The ethyl ester of DAS734 was even more potent with an RI50 of 30 nM. It is likely that the neutral ethyl ester may have improved uptake relative to the free acid form. The high level of activity in Arabidopsis seedling assays approaches that of some potent commercial herbicides, such as acetolactate synthase inhibitors.
The phytotoxic effects of many inhibitors of primary metabolism can often be reversed by addition of the end product(s) of the affected pathway (Subramanian et al., 1999
Screen for Mutants Resistant to DAS734 To identify mutants resistant to DAS734, ethylmethanesulfonate-mutagenized M2 Arabidopsis seeds were germinated and grown in medium containing sublethal concentrations of the herbicide. Several pilot screens of approximately 42,000 seedlings were performed at DAS734 concentrations between 0.18 and 1.1 µM, and a concentration of 0.54 µM DAS734 was selected to perform a large-scale screen of 480,000 seedlings. At this concentration, seedlings formed purple cotyledons, did not produce true leaves, and had significantly inhibited root growth. Resistant mutants were identified as seedlings with green, fully expanded cotyledons, emerging true leaves, and normal root length. Sixteen mutants were recovered and confirmed as showing some level of resistance after rescreening M3 seed on media containing 0.54 µM DAS734. When assessed on a lower concentration of DAS734 (0.054 µM), nine mutants produced green cotyledons but had some inhibition of growth of roots and true leaf formation. Seven mutants (R01, R03, R04, R06, R07, R08, and R22) showed complete resistance with growth equivalent to control seedlings. These mutants were used in further analyses. To quantify the levels of resistance, the seven mutants were grown on media containing increasing concentrations of DAS734, and RI50 values were determined for each mutant (Fig. 2, B and C). The mutants could be readily classified into three distinct groups showing strong (>110-fold), moderate (approximately 60-fold), and weak (approximately 5-fold) resistance (Table I ) relative to wild-type Columbia (Col)-0 seedlings. All seven mutants were phenotypically normal, healthy, and fertile under our standard growth conditions on agarose media and in the greenhouse. The adult Arabidopsis mutant plants also showed significant resistance to DAS734 in greenhouse postemergent spray applications of the herbicide. The application rate of the compound giving a 50% reduction in growth relative to an untreated control was 80 g/ha for wild-type plants, whereas treatments of up to 2,000 g/ha had little or no effect on the strongly resistant R06 mutant line (Fig. 2D). This corresponds to >25-fold resistance for the adult plants.
Resistance to Other Herbicidal Chemistries
To ensure that the observed herbicide resistance was specific to DAS734, the seven mutant lines were tested for resistance to three other herbicidal chemistries (structures shown in Fig. 1B). DAS073 is a close structural analog of DAS734 and shares the same phytotoxic phenotype that can be alleviated by addition of adenine (data not shown). All of the DAS734-resistant mutants tested were cross-resistant to DAS073, consistent with a shared mode of action. DAS309 is an isomer of DAS734 differing only in the attachment position of the isopropyl group on the triazole ring. However, it produces a different phytotoxic phenotype (no bleaching) that is not alleviated by adenine. All of the DAS734-resistant mutants were sensitive to DAS309, suggesting that the resistance mechanism is specific to the mode of action rather than via recognition of similar chemical structures. This provided some reassurance that resistance could be due to mutations at the target site and not from serendipitous chemical recognition by mechanisms involving metabolism or pumping to another cell compartment. Hadacidin is structurally unrelated to DAS734 but is known to inhibit purine biosynthesis via inhibition of AdSS. Its phytotoxic symptoms can be alleviated by adenine (Heim et al., 1995
In four of the seven DAS734-resistant mutants tested (R01, R06, R07, and R08), M3 progeny segregated for resistance. The ratio of resistant to sensitive progeny was approximately 3:1, suggesting that these lines contained a dominant mutation and the M2 plants were heterozygous for the mutation. The progeny from the remaining three mutants were 100% resistant to DAS734, indicating that the mutations in these lines were homozygous for the mutation. Further test crosses with wild-type plants showed that these DAS734-resistant mutants also contained dominant mutations. To determine if the mutations in the DAS734-resistant mutants were allelic, M3 lines identified as homozygous for the resistance mutation were crossed with each other. In every case, all of the F2 seed was resistant to DAS734. This indicates that the DAS734-resistant phenotypes in all seven lines were caused by mutations in the same or closely linked genes. Because all the mutants appeared to have a mutation at the same locus, only one mutant line was used to map the resistance gene.
To identify the gene responsible for the mutant phenotype, the mutation in the strongly resistant line R03 was used for genetic mapping experiments. The wild-type allele was mapped to the lower arm of chromosome 4 between 1.26 x 107 bp and 1.58 x 107 bp using single nucleotide polymorphism markers (Supplemental Fig. S1). Genes in this region were inspected to identify if any were involved in purine biosynthesis or metabolism. One gene (At4g34740) was found with annotations matching these criteria and encodes GPRAT, the first committed enzyme in the purine biosynthetic pathway. There are three isoforms of GPRAT in the Arabidopsis genome, and At4g34740 encodes AtGPRAT2. To determine if mutant line R03 contained a mutation in At4g34740, the gene was PCR amplified from both the R03 mutant and wild-type genomic DNA and the PCR products were sequenced. A single transition mutation of G to A was detected at nucleotide 791 relative to the start codon. This mutation causes Lys-264 to be changed to Arg in the encoded polypeptide (Fig. 3 ). Because the mutations in the other DAS734-resistant mutants appeared to be allelic with the R03 mutation, the At4g34740 gene was PCR amplified and sequenced from the other mutant lines. All seven DAS734-resistant lines were found to contain mutations affecting the coding sequence of this gene (Fig. 3; Table I); thus, these mutations are likely to be responsible for conferring resistance to DAS734.
R06 (145-fold resistance to DAS734) contained the same mutation in AtGPRAT2 as R03, an Arg-to-Lys substitution at codon 264. R01, R07, and R08 (approximately 50-fold resistance to DAS734) all contain a Pro-to-Ser mutation at residue 476. These mutants do not appear to be siblings as R01 and R07 each contained another different mutation in AtGPRAT2. R01 contained a Thr-to-Ala mutation at residue 130, and R07 contained a silent A-to-G mutation at nucleotide 416 (relative to the start codon). The T130A mutation in R01 probably does not contribute to resistance as the two other phenotypically indistinguishable mutants that contain only the P476S mutation (R07 and R08) do not contain this mutation. The two mutants displaying the lowest level of resistance to DAS734, R04 and R22, contained unique mutations. R04 contained two mutations, a Pro-to-Ser mutation at amino acid 265 and a Tyr-to-Phe mutation at amino acid 494, whereas R22 contained a single Gly-to-Ser mutation at amino acid 371 (Fig. 3; Table I). The P265S mutation in R04 is perhaps a more likely candidate to confer resistance than Y494F as it is adjacent to the R264K mutation that gives high levels of resistance in R03 and R06.
GPRATs are highly regulated enzymes and they exert significant control over de novo purine biosynthesis via feedback inhibition by purine nucleotides (Chen et al., 1997
All eukaryotic and many microbial GPRATs possess a short N-terminal propeptide that is autocatalytically cleaved to yield a conserved N-terminal Cys. The
Inhibition of AtGPRAT2 by DAS734 The enzyme activity of AtGPRAT2 was potently inhibited by the addition of DAS734 to the assays (Fig. 4B). Initial Michaelis-Menten kinetic characterization showed that DAS734 behaved like a noncompetitive inhibitor with respect to Gln (Supplemental Fig. S2). However, this type of kinetic behavior can be manifested by slow, tight-binding inhibitors. To evaluate whether DAS734 exhibited slow, tight-binding characteristics, the enzyme reaction progress was monitored over time after simultaneous addition of substrates and inhibitor. The time course was clearly curved, indicating that inhibition of the enzyme increased with time (Fig. 4C). I50 curves generated by preincubating the inhibitor with enzyme over increasing time intervals also showed increasing potency (data not shown). Maximal inhibition could be achieved by a 10-min preincubation of DAS734 with AtGPRAT2 without any other substrate additions being required, yielding an average I50 value under our assay conditions of 0.2 µM. This suggests that DAS734 binds to GPRAT without requirement for Gln or PRPP binding. Enzyme that was fully inhibited by DAS734 was passed over a desalting column to remove unbound ligand. Forty-seven percent of the enzyme activity could be recovered relative to an untreated control, indicating that the dissociation rate of DAS734 from the enzyme is relatively slow but reversible and accounts for the slow, tight-binding behavior. Having established that DAS734 was a potent inhibitor of AtGPRAT2, we cloned the mutant enzyme AtGPRAT2 R264K from the resistant line R03, one of the two lines showing the highest levels of DAS734 resistance. The mutant enzyme was successfully overexpressed at high levels in E. coli. AtGPRAT2 R264K was exceptionally resistant to DAS734, showing >500-fold increase in I50 over that of the wild type (Fig. 4B). Also, DAS734 had no effect on the reaction time course catalyzed by the mutant enzyme (Fig. 4C), in marked contrast to the wild-type form. Although the mutant enzyme was uninhibited by DAS734 at 100 µM in biochemical assays of GPRAT activity, root growth of the Arabidopsis lines harboring this mutated GPRAT (R03 and R06) was somewhat inhibited at DAS734 concentrations above 20 µM (Fig. 2B). This could be due to additional nonspecific effects on root growth at these high levels of compound.
There are three expressed GPRAT homologs in the Arabidopsis genome that are differentially expressed in various plant tissues (Ito et al., 1994
The Bacillus subtilis and E. coli GPRAT protein sequences share 47.4% and 33.3% amino acid identity, respectively, with AtGPRAT2 (Supplemental Fig. S3). Using the available crystal structures of the microbial enzymes (Chen et al., 1997
Studies on other GPRATs from microbes and vertebrates show that the enzyme is allosterically inhibited by end products of the purine biosynthesis pathway (Chen et al., 1997
The Arabidopsis genetic mutant atd2 (amidotransferase-deficient2) has a T-DNA insertion within the AtGPRAT2 gene and was identified by its variegated bleached seedling phenotype and strong growth retardation. The wild-type phenotype could be restored by addition of 5 mM IMP (van der Graaff et al., 2004
Reversal of Phytotoxic Effects of DAS734 by Adenine
Through a combination of chemical and genetic techniques, we have determined the precise biochemical site of action of DAS734 as AtGPRAT, the first committed enzyme in de novo purine biosynthesis. This identification was facilitated by the observation that the purine adenine completely alleviated the phytotoxic symptoms from germination to formation of the first true leaves. The linear purine biosynthetic pathway splits after the formation of IMP to produce either AMP or GMP via different enzymes (Fig. 1A). Thus, it might be expected that alleviation of inhibition of purine biosynthesis prior to IMP formation may require addition of guanine or xanthine in addition to adenine. Indeed, this logic was used to initially define the site of action of hydantocidin as AdSS (Heim et al., 1995
There are three functional GPRAT genes in the Arabidopsis genome (Ito et al., 1994
The phenotype produced by DAS734 is distinctive in comparison with many other herbicidal inhibitors of primary metabolism. New leaves are bleached white, suggesting damage by photooxidative effects or a deleterious effect on chloroplast development or function. Treatment with the compound phenocopies mutants lacking AtGPRAT2 that were identified by their variegated bleached appearance (Hung et al., 2004
Other herbicidal compounds that produce similar distinctive bleached-white phenotypes via photooxidative mechanisms are metabolic inhibitors of pathways that are either directly or indirectly involved in producing photoprotectant carotenoids. These include phytoene desaturase inhibitors (e.g. norflurazon; Sandmann and Boger, 1997
Many previous biochemical studies of GPRATs have been hindered by the extreme oxygen sensitivity of the enzymes (Itakura and Holmes, 1979
Detailed studies of the B. subtilis and E. coli GPRATs have shown that they are highly functionalized enzymes composed of two domains in tight allosteric communication with each other (Chen et al., 1997
Three resistance mutations occur in vicinity of the glutaminase site. R264K confers the highest level of resistance and Arg-264 (or its equivalent) is conserved in almost every GPRAT sequence that we have inspected in a phylogenetic comparison of sequences from 200 species of microbes and higher organisms. Nevertheless, a conservative substitution of this residue to Lys produces a fully functional enzyme with remarkable (approximately 125-fold) resistance to DAS734. The only naturally occurring GPRATs that we found that do not have Arg at this position are those from a small clade of six species of methanotrophic bacteria that also possess a Lys residue at this location. The mutation conferring 50-fold resistance (P476S) occurs on the periphery of the glutaminase site (approximately 10 Å from the active site thiol group) and could therefore be linked to changes in this pocket due to DAS734 binding at or near this site. Because the mutations giving the highest levels of resistance occur around the glutaminase site and we found no effect of the R264K mutation on inhibition by purine nucleotides acting on the PRPP domain, the glutaminase domain is perhaps the most likely site of interaction. However, as there is clear evidence for extensive interdomain and intradomain allosteric communication in GPRAT function (Smith, 1998
The combination of chemical and genetic approaches used in this study has provided a novel and unique small molecule ligand for probing GPRAT function and de novo purine biosynthesis in plants. Unlike many other nonspecific inhibitors of purine biosynthesis (Lyons et al., 1990
Materials Seeds of atd2 were obtained from the Arabidopsis Biological Resource Center. DAS734 was synthesized as described in Supplemental Materials and Methods S1. All other reagents were obtained from Sigma.
Ethylmethanesulfonate-mutagenized M2 Col-0 seed (Lehle Seeds) were screened for resistance as described by Walsh et al. (2006)
Seeds of test species were planted in Metromix 360 (Brehob) 8 to 12 d prior to spraying with compound and grown in a greenhouse with a 16-h photoperiod at 24°C to 29°C. Compounds were dissolved in acetone:dimethyl sulfoxide (97:3, v/v) and dilutions made with water:isopropanol:crop oil concentrate (78:20:2, v/v/v) containing 0.02% Triton X-155. Compounds were applied using a DeVilbiss compressed air sprayer.
To determine whether resistance mutations were dominant or recessive, M3 plants resistant to DAS734 were crossed with wild-type Col-0 plants. F1 seed were tested for resistance to DAS734 by plating the seed on modified Murashige and Skoog medium containing 0.54 µM DAS734. To determine if the DAS734-resistant lines contained allelic mutations, five M3 plants resistant to DAS734 from each line were crossed with five M3 plants resistant to DAS734 from every other line. To identify crosses between homozygous DAS734-resistant lines, M4 seed resulting from self-fertilization of each parent used in the crosses were harvested and tested for resistance to DAS734. M3 homozygotes produced M4 seed that were 100% resistant to DAS734. F1 progeny from crosses between the identified homozygous parents resistant to DAS734 were grown and allowed to self-fertilize. At least 300 F2 seedlings from each cross were tested for resistance to DAS734. Lines containing independently segregating resistance genes should produce 93% resistant F2 seedlings, whereas allelic lines should produce 100% resistant seedlings. In all cases where the parent was homozygous for the resistance gene, F1 progeny from the test cross were 100% resistant to DAS734. When the herbicide-resistant parent was heterozygous for the resistance gene, approximately 50% of the F1 progeny showed herbicide resistance.
To generate the mapping population, a resistant homozygous M3 line of R03 (from the Col-0 accession) was crossed with a wild-type plant of the Landsberg erecta accession. The resulting F1 plants were allowed to self-fertilize and produce F2 seed. Because the resistance phenotype is caused by a dominant mutation, the wild-type allele from the Landsberg erecta background was mapped. The F2 seed was germinated in modified Murashige and Skoog medium containing 0.54 µM DAS734. Plants sensitive to the herbicide were identified, rescued onto medium without herbicide, and transplanted to soil after 7 d. When plants were at the rosette stage, one leaf was removed for genomic DNA isolation. Mapping was performed using single nucleotide polymorphism markers as described by Walsh et al. (2006) For sequencing, the At4g34740 (AtGPRAT2) gene was PCR amplified by Pfu Turbo DNA polymerase (Stratagene) using the primers TCAACTTTTCATAATTGGTTTGTGTGTATTT and AATTTCGTAGAACTCGCCACAAGCA. The PCR products were sequenced using Applied Biosystems BigDye Terminator version 3.1 cycle sequencing kit and run on an ABI 3100.
The gene encoding AtGPRAT2 was PCR amplified from an Arabidopsis cDNA library using the forward DNA 5'-CATATGGATGATTATGACGAGAAGCCTCGGGAAGAGTGTGGAG-3' and the reverse primer 3'-TAGGTGTTGTAACTTCCTCCAACCCATGCCATCATTCCTAGG-5'. To facilitate gene cloning, the forward and reverse primers encoded an NdeI and BamHI site, respectively (underlined). In Bacillus subtilis, propeptide autoprocessing to reveal an N-terminal Cys is required to generate an active GPRAT enzyme. The 5' primer was therefore designed to encode a comparable 11-amino acid propeptide (in bold) and deletion of the chloroplast transit peptide of AtGPRAT2. The amplification product was gel purified and cloned using TOPO TA cloning vector pCR2.1 TOPO. Four individual clones were sequenced using Beckman CEQ 2000 Dye Terminator chemistry. DNA sequencing verified that the encoded protein sequence was identical to the published sequence. One clone, AtGPRAT2.1, was selected for E. coli expression. The AtGPRAT2 gene was released from AtGPRAT2.1 as an NdeI/BamHI fragment and cloned into identical sites of the E. coli expression vector pET26b. Following verification by DNA restriction analysis, two clones (pET2.1.2 and pET2.1.8) were selected for E. coli expression experiments. DNA from pET2.1.2, pET2.1.8, and pET26b (empty vector control), respectively, was transformed into BL21(DE3) cells. Transformation reactions were plated on L agar containing 50 µg/mL kanamycin and 50 mM Glc and grown overnight at 37°C. For expression of individual clones, a loopful of fresh cells was inoculated into 250 mL of Luria-Bertani broth containing 50 µg/mL kanamycin and 75 µM isopropyl-D-thiogalactopyranoside. Cultures were grown for 24 h at 28°C. Cells were harvested by centrifugation and the resulting cell pellets were frozen in dry ice and stored at 80°C.
For enzyme extraction, pelleted E. coli cells expressing AtGPRAT were resuspended in 0.1 M Tris, pH 7.4, containing 1 mg/mL lysozyme (5 mL/cells from 250 mL culture) at room temperature. After approximately 15 min, the suspension was frozen in liquid N2 and then thawed. DNase was added to 0.02 mg/mL final concentration and MgCl2 to 1 mM. After the extract was no longer viscous, dithiothreitol (DTT) was added to 10 mM and the extract was centrifuged. The supernatant was passed over a Bio-Rad 10DG column preequilibrated with 50 mM Tris-Cl, pH 7.8, 5 mM MgCl2, 10 mM DTT and the eluant stored in aliquots at 70°C. GPRAT activity was determined by monitoring the PRPP-dependent production of Glu from Gln. Aliquots of extracts were assayed in 50 µL of 50 mM Tris-Cl, pH 7.8, 5 mM MgCl2, 10 mM DTT and the reaction initiated by adding 50 µL of 40 mM Gln, 5 mM PRPP. Control assays were performed in parallel by adding 50 µL of 40 mM Gln with no PRPP. After 30 min, reactions were quenched in a 100°C sandbath for 2.5 min and precipitated protein removed by brief centrifugation. The Glu present in the reaction mixture was quantitated using Glu dehydrogenase and 3-acetylpyridine dinucleotide as a cofactor. Fifty microliters of each assay supernatant was placed in the wells of a 96-well plate, then 150 µL of a mixture containing 1.36 mM 3-acetylpyridine dinucleotide and 33 units/mL Glu dehydrogenase in 125 mM potassium phosphate, pH 8.0, was added. After 30 min, the A363 was read in a Molecular Devices SpectroMax plate reader. The absorbance in the control sample was subtracted from that in the PRPP-containing assay to determine the amount of PRPP-dependent glutaminase activity in the sample. Enzyme kinetic and I50 values were determined by fitting the data to the appropriate equations using Grafit software (Erithacus Software). Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers NP_179247 (AtGPRAT1), NP_195200 (AtGPRAT2), and NP_195599 (AtGPRAT3).
The following materials are available in the online version of this article.
We are grateful to several Dow AgroSciences scientists for invaluable assistance. Lowell Markley first conceptualized and synthesized the phenyltriazole acetate herbicides, Nick Irvine provided additional chemical synthesis expertise, and Debby Camper provided molecular modeling help. At Exelixis Plant Sciences, we thank Cathy Hironaka, Darcie Otter, Michelle Leal, Karin Conners, and Alan Lammers for technical assistance. We also thank Dr. Eric van der Graaff (University of Cologne, Germany) for kindly providing unpublished information on the atd2 insertional Arabidopsis mutant. Received March 16, 2007; accepted May 19, 2007; published June 1, 2007.
1 Present address: Department of Botany and Plant Sciences, University of California, Riverside, CA 92521. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Terence A. Walsh (tawalsh{at}dow.com).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.099705 * Corresponding author, e-mail tawalsh{at}dow.com; fax 3173373249.
Armstrong JI, Yuan S, Dale JM, Tanner VN, Theologis A (2004) Identification of inhibitors of auxin transcriptional activation by means of chemical genetics in Arabidopsis. Proc Natl Acad Sci USA 101: 1497814983 Asami T, Nakano T, Nakashita H, Sekimata K, Shimada Y, Yoshida S (2003) The influence of chemical genetics on plant science: shedding light on functions and mechanism of action of brassinosteroids using biosynthesis inhibitors. J Plant Growth Regul 22: 336349[Medline] Ashihara H, Stasolla C, Loukanina N, Thorpe TA (2000) Purine and pyrimidine metabolism in cultured white spruce (Picea glauca) cells: metabolic fate of 14C-labeled precursors and activity of key enzymes. Physiol Plant 108: 2533 Ashihara H, Stasolla C, Loukanina N, Thorpe TA (2001) Purine metabolism during white spruce somatic embryo development: salvage of adenine, adenosine, and inosine. Plant Sci 160: 647657[Medline] Bera AK, Chen S, Smith JL, Zalkin H (1999) Interdomain signaling in glutamine phosphoribosylpyrophosphate amidotransferase. J Biol Chem 274: 3649836504 Bera AK, Smith JL, Zalkin H (2000) Dual role for the glutamine phosphoribosylpyrophosphate amidotransferase ammonia channel. Interdomain signaling and intermediate channeling. J Biol Chem 275: 79757979 Bernlohr DA, Switzer RL (1981) Reaction of Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase with oxygen: chemistry and regulation by ligands. Biochemistry 20: 56755681[CrossRef][Medline] Blackwell HE, Zhao Y (2003) Chemical genetic approaches to plant biology. Plant Physiol 133: 448455 Boldt R, Zrenner R (2003) Purine and pyrimidine biosynthesis in higher plants. Physiol Plant 117: 297304[CrossRef][Medline] Brannigan J, Dodson G, Duggleby HJ, Moody PCE, Smith JL, Tomchick DR, Murzin AG (1995) A protein catalytic framework with an N-terminal nucleophile is capable of self-activation. Nature 378: 416419[CrossRef][Medline] Burdine L, Kodadek T (2004) Target identification in chemical genetics: the (often) missing link. Chem Biol 11: 593597[CrossRef][ISI][Medline] Chen S, Tomchick DR, Wolle D, Hu P, Smith JL, Switzer RL, Zalkin H (1997) Mechanism of the synergistic end-product regulation of Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase by nucleotides. Biochemistry 36: 1071810726[CrossRef][Medline] Christopherson RI, Lyons SD, Wilson PK (2002) Inhibitors of de novo nucleotide biosynthesis as drugs. Acc Chem Res 35: 961971[CrossRef][ISI][Medline] Cox JM, Hawkes TR, Bellini P, Ellis RM, Barrett R, Swanborough JJ, Russell SE, Walker PA, Barnes NJ, Knee AJ, et al (1997) The design and synthesis of inhibitors of imidazoleglycerol phosphate dehydratase as potential herbicides. Pestic Sci 50: 297311[CrossRef] Cseke C, Gerwick BC, Crouse GD, Murdoch MG, Green SB, Heim DR (1996) 2a-phosphohydantocidin: the in vivo adenylosuccinate synthetase inhibitor responsible for hydantocidin phytotoxicity. Pestic Biochem Physiol 55: 210217[CrossRef][ISI] Dancer J, Lindell S, Ford MJ (1999) Inhibitors of histidine biosynthesis. In BK Singh, ed, Plant Amino Acids. Marcel Dekker, New York, pp 417444 Hatch MD (1967) Inhibition of plant adenylosuccinate synthetase by hadacidin and the mode of action of hadacidin and structurally related compounds on plant growth. Phytochemistry 6: 115119[CrossRef][ISI] Heim DR, Cseke C, Gerwick BC, Murdoch MG, Green SB (1995) Hydantocidin: a possible pro-herbicide inhibiting purine biosynthesis at the site of adenylosuccinate synthetase. Pestic Biochem Physiol 53: 138145[CrossRef][ISI] Hung WF, Chen LJ, Boldt R, Sun CW, Li HM (2004) Characterization of Arabidopsis glutamine phosphoribosyl pyrophosphate amidotransferase-deficient mutants. Plant Physiol 135: 13141323 Itakura M, Holmes EW (1979) Human amidophosphoribosyltransferase. An oxygen-sensitive iron-sulfur protein. J Biol Chem 254: 333338 Ito T, Shiraishi H, Okada K, Shimura Y (1994) Two amidophosphoribosyltransferase genes of Arabidopsis thaliana expressed in different organs. Plant Mol Biol 26: 529533[CrossRef][ISI][Medline] Katahira R, Ashihara H (2006) Profiles of purine biosynthesis, salvage and degradation in disks of potato (Solanum tuberosum L.) tubers. Planta 225: 115126[CrossRef][ISI][Medline] Krahn JM, Kim JH, Burns MR, Parry RJ, Zalkin H, Smith JL (1997) Coupled formation of an amidotransferase interdomain ammonia channel and a phosphoribosyltransferase active site. Biochemistry 36: 1106111068[CrossRef][Medline] Lange BM, Ketchum RE, Croteau RB (2001) Isoprenoid biosynthesis. Metabolite profiling of peppermint oil gland secretory cells and application to herbicide target analysis. Plant Physiol 127: 305314 Lee D, Moffatt BA (1994) Adenine salvage activity during callus induction and plant growth. Physiol Plant 90: 739747[CrossRef] Lukens JH, Durbin RD (1985) Tagetitoxin affects plastid development in seedling leaves of wheat. Planta 165: 311321[CrossRef][ISI] Lyons SD, Sant ME, Christopherson RI (1990) Cytotoxic mechanisms of glutamine antagonists in mouse L1210 leukemia. J Biol Chem 265: 1137711381 Mathews DE, Durbin RD (1990) Tagetitoxin inhibits RNA synthesis directed by RNA polymerases from chloroplasts and Escherichia coli. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||