|
|
||||||||
|
First published online May 11, 2007; 10.1104/pp.106.092288 Plant Physiology 144:1370-1382 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
HAWAIIAN SKIRT: An F-Box Gene That Regulates Organ Fusion and Growth in Arabidopsis1,[C],[W],[OA]Plant Sciences Division, School of Biosciences, University of Nottingham, Sutton Bonington Campus, Loughborough, Leicestershire LE12 5RD, United Kingdom (Z.H.G.-C., U.R., J.A.R.); Section Plant Genetics, Institute for Wetland and Water Research, Radboud University Nijmegen, 6525 ED Nijmegen, The Netherlands (J.L.P); Department of Plant Sciences, University of Oxford, Oxford OX1 3RB, United Kingdom (A.M.B.); School of Biological Sciences, University of Southampton, Bassett Crescent East, Southampton S016 7PX, United Kingdom (C.W.); and School of Biological Sciences, Royal Holloway, University of London, Egham, Surrey TW20 0EX, United Kingdom (A.D.S.)
A fast neutron-mutagenized population of Arabidopsis (Arabidopsis thaliana) Columbia-0 wild-type plants was screened for floral phenotypes and a novel mutant, termed hawaiian skirt (hws), was identified that failed to shed its reproductive organs. The mutation is the consequence of a 28 bp deletion that introduces a premature amber termination codon into the open reading frame of a putative F-box protein (At3g61590). The most striking anatomical characteristic of hws plants is seen in flowers where individual sepals are fused along the lower part of their margins. Crossing of the abscission marker, ProPGAZAT: -glucuronidase, into the mutant reveals that while floral organs are retained it is not the consequence of a failure of abscission zone cells to differentiate. Anatomical analysis indicates that the fusion of sepal margins precludes shedding even though abscission, albeit delayed, does occur. Spatial and temporal characterization, using ProHWS: -glucuronidase or ProHWS:green fluorescent protein fusions, has identified HWS expression to be restricted to the stele and lateral root cap, cotyledonary margins, tip of the stigma, pollen, abscission zones, and developing seeds. Comparative phenotypic analyses performed on the hws mutant, Columbia-0 wild type, and Pro35S:HWS ectopically expressing lines has revealed that loss of HWS results in greater growth of both aerial and below-ground organs while overexpressing the gene brings about a converse effect. These observations are consistent with HWS playing an important role in regulating plant growth and development.
Abscission involves the detachment of an organ from the body of a plant and takes place at a site that is predestined for the purpose (Sexton and Roberts, 1982 -1-4 glucanase and polygalacturonase precisely at the site of abscission (Roberts et al., 2002
To dissect further the mechanisms responsible for regulating the abscission process, forward genetic strategies have been employed to identify non- or delayed-shedding mutants followed by the mapping and characterization of the mutated genes (Patterson, 2001
During the screening of a fast neutron-mutagenized population of Arabidopsis Columbia-0 (Col-0) wild-type plants a mutant, termed hawaiian skirt (hws), was isolated that retained its floral organs even after silique desiccation had taken place. In addition to exhibiting a nonshedding phenotype hws also exhibited sepals that are fused for some distance along their margins. Other mutants from Arabidopsis that show varying degrees of sepal fusion include unusual floral organs (ufo) where the mutated gene has been shown to encode an F-box protein (Levin and Meyerowitz, 1995 In this article, the mapping and identification of a mutation in a putative F-box gene (At3g61590), which is responsible for bringing about the hws-1 phenotype, is described. Although the transcript of HWS accumulates throughout the plant, reporter gene analysis reveals that expression is restricted to only certain tissues. By comparing and contrasting the phenotypic features of hws-1, an overexpressing HWS line driven by the 35S cauliflower mosaic virus (CaMV) promoter wild-type plants, a role for HWS in regulating plant growth and development has been highlighted.
Mutant Isolation and Characterization The hws-1 mutant was isolated, as a result of an inability to shed its floral organs, during a screen of M2 progeny grown from a fast neutron-mutagenized population (dose: 55 Gy; Lehle seeds) of M1 Arabidopsis seeds in the Col-0 (wild type) background. Sepals, petals, and anther filaments were retained throughout reproductive development and remained in situ even after silique desiccation and dehiscence had taken place. To study flower development in more detail material was harvested from positions throughout the primary inflorescence with the first being where petals were visible. From that position all subsequent flowers were numbered. A scanning electron microscope (SEM) study of hws-1 flowers revealed that sepals of the mutant were fused, for a distance along the lower part of their margins, and that characteristically the sepal whorl was broader than that seen in wild-type plants (Fig. 1, AF ). While the shedding of petals and anther filaments did not take place in the mutant, fine structural analysis of these tissues indicated that abscission of these organs could be detected in both wild-type and hws-1 flowers (Fig. 1, GJ). Cell separation at the sepal bases was also apparent in hws-1 flowers, however, the timing of this was delayed in comparison to wild-type plants and the sepal whorl was retained even though abscised (Fig. 1, H and J).
Further SEM analysis revealed that no distinction could be made between the wild-type and hws-1 plants during early bud development (Fig. 2, A, B, E, and F ). However, by the time the buds have reached stage 10 (Smyth et al., 1990
The hws-1 mutant was crossed with a wild-type plant and a 3:1 segregation of shedding:nonshedding individuals in the F2 population showed that the phenotype is due to a recessive mutation in a single gene of nuclear origin.
To determine whether the nonshedding phenotype of hws-1 was due to a failure of abscission zone (AZ) differentiation a cross was made between the mutant and a transgenic marker line (ProPGAZAT:GUS) that expresses the reporter gene GUS specifically at the site of floral organ separation. PGAZAT (At2g41850) encodes a polygalacturonase that is transcribed immediately prior to organ abscission in Arabidopsis and is thought to contribute to cell wall degradation (González-Carranza et al., 2002
Other Phenotypic Features of the hws Mutant
The identification of another allele of HWS (hws-2) from the SALK collection (Alonso et al., 2003 A detailed analysis revealed that 28% of flowers in the hws-1 mutant had fused anther filaments to differing extents along their length (Fig. 4A ), compared with 2% in the wild type. Occasionally, in hws-1 plants, these filaments were fused to the side of siliques (Fig. 4B). The top of the hws-1 silique was consistently broader than wild type, and the length of the AZ region, exposed by manually removing the floral organs, was longer in the mutant (Fig. 4, C and D). Some hws-1 siliques comprised more than two valves (Fig. 4E) and dissection of aberrant pods revealed that this was associated with abnormal development of the septum (Fig. 4F). The lamina tissue of the primary cauline leaves of hws-1 plants routinely exhibited fusion to the inflorescence stems (Fig. 4G).
Mapping the hws Locus
Homozygous hws-1 (Col-0 ecotype) plants were crossed with the Landsberg erecta (Ler) ecotype and the F2 progeny used as a mapping population. An amplified fragment length polymorphism (AFLP)-based genome-wide approach (Peters et al., 2004
Insertional mutant lines from the SALK collection of these 18 candidate genes were examined and two individuals in a population of 50 plants from line SALK_088349 (located in the gene At3g61590) exhibited phenotypic characteristics reminiscent of hws-1. Further analysis of this line revealed that it contained two T-DNA insertions, arranged in opposing configurations, downstream from the ATG of the At3g61590 gene. These insertions were located 475 and 491 bp from the ATG (Fig. 5B). PCR amplification of the At3g61590 genomic region of wild type and hws-1 DNA and restriction analyses of the amplified products with the high frequency cutting enzymes AluI, RsaI, and TaqI revealed subtle differences in banding patterns between the two genotypes (Fig. 5C). Sequencing of this region from hws-1 revealed that it contained a 28 bp deletion located 966 bp downstream of the translation start of the open reading frame (ORF) of At3g61590. The consequence of this deletion is to introduce a frame shift resulting in the introduction of a premature termination amber codon in place of an Ile residue and the predicted production of a truncated version of the At3g61590 protein (Fig. 5B). To determine whether the hws-1 phenotype was a consequence of a mutation in the At3g61590 gene, a cross between the mutant and the SALK_088349 line (knockout [KO]) was performed. All progeny of this cross displayed hws-1 characteristics. To test that these had not arisen by a self-pollination event two plants were analyzed by PCR and reverse transcription (RT)-PCR. The PCR demonstrated that both a gene-specific product (originating from the hws-1 mutant) and an insertion product (originating from the KO) were amplified in each individual but only the former was present in the wild-type control (Fig. 5D). RT-PCR analysis of RNA extracted from various tissues of the SALK_088349 line and from two F1 plants (hws-1 x KO) showed no At3g61590 expression in the KO but the presence of a transcript in both progeny (Fig. 5E). Proof that HWS is encoded by the At3g61590 gene was obtained by complementing the hws-1 mutant with a 3.513 kb fragment amplified from wild-type DNA containing 1,291 bp upstream of the promoter, plus the 5' and 3' untranslated regions (UTRs), and intron and exon of the At3g61590 gene. This segment proved to be of sufficient length to rescue fully the hws-1 mutant (Fig. 5F).
The likely function of the HWS gene (At3g61590) is that it encodes an F-box protein. These proteins, as part of a SCF complex, are proposed to interact with a substrate leading to their degradation by the 26S proteasome (Ni et al., 2004
Outside the F-box region, the ORF of HWS shows only a low level of sequence similarity with other putative F-box proteins that have been annotated within the Arabidopsis genome. The Arabidopsis gene encoding a protein with highest sequence similarity (approximately 30%) to HWS is UFO. UFO is a protein that has been shown to be required for normal patterning and growth of the floral meristem (Samach et al., 1999
RT-PCR analysis of RNA isolated from wild-type plants revealed that the HWS transcript is expressed in many different tissues of the plant. Levels of expression were highest in buds and flowers, however, expression could also be detected in roots, leaves, stem, and siliques (Fig. 6 ). A more detailed analysis of the spatial and temporal pattern of expression, with the aid of the GUS or green fluorescent protein (GFP) reporter genes fused to the HWS promoter, showed that the gene is expressed at discrete sites within a range of tissues including the outer margins of cotyledons (Fig. 7A ), the sepals of young buds and flowers (Fig. 7, BD), the stigmatic papillae and tip of the elongating silique (Fig. 7, E and G), the base and vascular tissue of petals and sepals (Fig. 7F), the anther filaments and pollen (Fig. 7G), the floral and cauline leaf AZs (Fig. 7, H and I), the testa of developing seeds (Fig. 7J), the vascular tissue of the primary root and emerging laterals (Fig. 7K), and lateral root cap (Fig. 7L). A detailed time course of GUS accumulation during flower and silique development revealed that intense HWS expression could be detected at the site of floral organ abscission in position 8 flowers continuing up to the stage when desiccation of the pods took place (Fig. 3C).
Ectopic Expression of the HWS Gene Produces Smaller Seedlings Transgenic plants were generated where the ORF from the HWS gene was expressed ectopically using a double 35S CaMV promoter. Homozygous plants from two lines (8.3, A23.3) were examined in detail as RT-PCR analysis had indicated that these lines most strongly expressed both HWS and the transgene (Supplemental Fig. S1) and contained only a single insertion (data not shown). Line 8.3 exhibited a more severe phenotype than line A23.3 in all the experiments that were undertaken. A growth study, carried out 2 weeks after emergence, revealed that both ectopic expressing lines were substantially smaller than wild type (Fig. 8A ). However, hws-1 plants at the same stage were larger than the control (Fig. 8A). Compared to the wild type, the rosette leaves of the overexpressing lines had shorter petioles, narrower and more rounded lamina with serrated borders, and displayed a greater degree of hyponastic bending (Fig. 8B).
Impact of Ectopic Expression of HWS on Flower Development A comparison of flower development in wild type, hws-1, and Pro35S:HWS line 8.3 demonstrated that organ shedding took place at an earlier developmental stage in the overexpressing line (position 10) compared to the wild type (position 12). Flowers from line 8.3 also underwent sepal senescence prematurely, as evidenced by a visual decline in chlorophyll, compared to the wild type (Fig. 9 ; Supplemental Fig. S2). Figure 9 shows that hws-1 had the longest, while the overexpressing line had the shortest, stigmatic papillae. A close-up view of flowers confirmed these observations (Supplemental Fig. S2).
Measurements of dissected sepals and petals from flowers at position 3 revealed that hws-1 had significantly longer and wider sepals and petals compared to the wild type or Pro35S:HWS A23.3 line. The floral bases of the two overexpressing lines were the narrowest (Fig. 9; Supplemental Fig. S3), while hws-1 was the widest compared to the wild type (see also Fig. 1, B and E).
Seeds from hws-1, wild type, and the two overexpressing lines were germinated in germination medium (GM) or Murashige and Skoog media and root length was measured after a period of 2 weeks. The mutant exhibited the longest roots while both Pro35S:HWS lines 8.3 and A23.3 had significantly shorter roots than the wild type (Fig. 10A ).
The dimensions of mature seeds from the three different genotypes were analyzed. The hws-1 mutant was found to have statistically larger (both in length and width) seeds compared to the wild type while the overexpressing lines produced the smallest seeds (Fig. 10B).
We have described the isolation and characterization of a novel Arabidopsis mutant termed hws that fails to shed its floral organs. The mutated gene responsible for bringing about this phenotype (At3g61590) encodes a putative F-box protein. HWS is expressed throughout the plant but reporter gene analysis indicates that expression is restricted to specific tissues. Loss of HWS function results in an elevation of plant size while overexpression of the gene, using the 35S CaMV promoter, generates plants exhibiting a significant reduction in root and vegetative shoot growth. These observations are consistent with HWS playing a role in the regulation of organ development in Arabidopsis.
The hws-1 mutant was originally isolated as a consequence of an inability to shed its sepals, petals, and anther filaments. Indeed, these organs are retained throughout silique growth and development and remain at the base of the silique even after desiccation and dehiscence is complete. A close examination of the flowers has revealed that the mutation results in the fusion of the sepals along their basal margins. Ectopic expression of the microRNA miR164 results in the generation of flowers with similar characteristics (Mallory et al., 2004 An examination of the early stages of development in wild-type and hws-1 plants indicates that floral morphology is initially indistinguishable, however, while sepal separation proceeds to the base of the bud in wild type this is terminated prematurely in hws-1 material. Thus the hws phenotype is not the consequence of postgenital fusion of the sepals but due to their failure to undergo complete separation.
To test whether differentiation of the floral AZs was taking place in hws-1 we crossed the gene marker ProPGAZAT:GUS into the mutant. PGAZAT (At2g41850) encodes a polygalacturonase that is expressed specifically within the AZ cells of Arabidopsis and has been proposed to play a role in middle lamella degradation (González-Carranza et al., 2002
Mapping and characterization of the hws-1 locus has revealed that the mutant phenotype is a consequence of a 28 bp deletion in the ORF of a gene (At3g61590) encoding a putative F-box protein. The 28 bp deletion in hws-1 introduces a premature translation termination codon, predicted to truncate HWS. The phenotype of hws-1 is indistinguishable from that of a null mutant (SALK_088349; hws-2) caused by the insertion of two T-DNAs into At3g61590, suggesting that the shortened HWS protein, if synthesized, is nonfunctional. Evidence to support the proposal that HWS functions as an F-box protein has come from the demonstration by Takahashi et al. (2004)
HWS contains a single intron located within the 5' UTR region of the gene. A bioinformatic analysis of HWS indicates that in addition to having an F-box domain, the protein contains a predicted transmembrane sequence, and a Kelch-like repeat region. The truncated protein produced by the hws-1 mutant would lack an important element of the Kelch_2 motif and it has been proposed that this region, in other F-box proteins, might play a key role in the recognition of the substrate (Jarillo et al., 2001
As the phenotypic characteristics of the hws-1 mutant were primarily restricted to the shoot and reproductive tissues it was a surprise to discover that the transcript of the HWS gene could be detected by RT-PCR at high levels throughout the plant. Reporter gene analysis, using either GUS or GFP, revealed that although expression is evident in many tissues HWS promoter activity is restricted to specific cell types or regions of an organ. In roots, the pattern of expression is limited to the vascular tissues and the cells that comprise the lateral root cap. In leaves and stems expression is rarely detected in the vasculature but is associated with the margins of cotyledons. Floral tissues strongly express HWS with GUS activity being detected throughout development in sepals, the distal end of the stigma, anther filaments, and pollen. Expression is also evident in the AZs of cauline leaves and floral organs. Aspects of the root and floral organ expression pattern are reminiscent of that exhibited by the F-box protein TIR1 (Gray et al., 1999
GUS expression in ProHWS:GUS plants is intense at both the site of abscission of floral organs and cauline leaves. Expression precedes sepal, petal, and anther filament shedding and is maintained throughout silique development and maturation. This spatial and temporal pattern of expression is similar to that observed by genes that have been proposed to contribute to the process of cell separation (González-Carranza et al., 2002
Although the principal characteristic of hws-1 plants is their nonshedding phenotype, the isolation of a null allele (hws-2) of the gene has enabled us to dissect other consistent phenotypic features. A key difference from wild-type plants is that hws-1 plants grown under the same environmental conditions have more elongated leaves and larger seeds. Plants ectopically expressing HWS exhibit a reduced overall stature compared to wild type with the degree of reduction being associated with the intensity of the up-regulation of the gene. These observations indicate that the target for HWS degradation plays a key role in the maintenance of organ growth. Indeed the impact of losing HWS can be seen in individual cells such as the stigmatic papillae where elongation is substantially elevated in the mutant and reduced in the overexpressing lines. A role for UFO in regulating organ growth has been previously identified (Laufs et al., 2003
Plant Material and Growth Conditions
Arabidopsis (Arabidopsis thaliana) ecotypes Col-0 and Ler, the hws-1 mutant, SALK lines for the 18 genes in the 56 kb segment that were obtained from the Nottingham Arabidopsis Stock Centre, diverse crosses, and the mapping population were grown in a glasshouse with a temperature of 23°C ± 2°C in plastic pots containing Levington M3 (The Scotts Company) compost and Vermiculite (2.05.0 mm, Sinclair) in a 3:1 ratio, respectively. To grow plants under sterile conditions, petri plates were prepared with 4.33 g L1 of Murashige and Skoog basal salt mixture, pH 5.9 (Sigma; Murashige and Skoog, 1962 The position of the flower was determined from the first site where petals were visible. From that position all subsequent flowers were numbered.
Inflorescence apices and flowers were taken from Col-0 (wild type) and hws-1 plants. Buds were staged in accord with Smyth et al. (1990)
Unopened and open flowers were collected from wild type and the hws-1 mutant when the plants were 1 month old. Young buds, mature buds, and flowers from positions 4, 6, 8, 12, 16, or 20 were fixed in 4% (v/v) paraformaldehyde: phosphate-buffered saline (PBS) buffer (1.3 mM NaCl, 0.03 M Na2HPO4, 0.03 M NaH2PO4, pH 7.2, 0.1% [v/v] Triton X-100, and 0.1% [v/v] Tween 20) overnight at 4°C. Tissues were washed with PBS at 4°C for 1 h, then brought to room temperature and washed with PBS for 1.5 h. The tissues were postfixed with 2% (w/v) OsO4 in PBS at room temperature for 3 h, then rinsed twice in PBS for 15 min and dehydrated with an ethanol series (30%, 50%, 70%, 90%, and 100% [v/v], twice, for 1 h in each). Specimens were processed with 100% ethanol/propylene oxide (1:1) for 20 min, washed three times with propylene oxide for 10 min, and propylene oxide/Spurrs resin (1:1; TAAB) for 1.5 h. Specimens were infiltrated with pure Spurrs resin at 4°C for 10 to 12 h. Individual samples were placed in appropriate flat-labeled silicone embedding molds filled with Spurrs resin and placed at 72°C for 10 to 12 h. Longitudinal semithin sections (0.5 µm) were cut on a Reichert-Jung Ultracut ultramicrotome using glass knives. The glass knives were made from a glass bar (TAAB) on a Leica EM KMR2 knife maker machine. Sections were stained with Toluidine blue (TBO) 0.25% to 1% (w/v), mounted with DePex (Sigma), and observed under a Nikon Optiphot-2 microscope equipped with a Leica DFC320 camera using the IM50 Leica software (Leica Microsystems Imaging Solutions).
Six plants from the hws-1 mutant, wild type, and 35S CaMV ectopic expression lines 8.3 or A23.3 were grown under the same conditions and 25 flowers were dissected and analyzed under a Zeiss Stemi SV6 Stereo microscope. Organ fusion and other phenotypic characteristics were recorded either with a Kodak MDS290 digital camera attached to the microscope or with a Fujifilm FinePix A205S. Images were analyzed with Adobe photoshop software.
Seedlings of 2 weeks old were grown in Murashige and Skoog media or in soil. Rosette leaves were dissected, and pictures taken with a Fujifilm FinePix A205S. For measurements of roots (26 plants grown in Murashige and Skoog media or GM media), the sepals, petals (12 flowers from different plants at position 3), and seeds (70 seeds from five plants) pictures were taken and measurements were performed with the image processor and analyzer in Java software ImageJ Version 1.37h (Abramoff et al., 2004
A mapping population was generated by crossing the hws-1 mutant in Col-0 background with the Ler ecotype and the F1 progeny was allowed to self. DNA was extracted, following manufacturer instructions (Qiagen, DNAeasy Plant Mini kit), from a small population of 33 F2 hws-1 mutant plants and used to map the HWS locus to a region of 3.28 MB between markers SM148,6 and SM239_119,5 at the bottom of chromosome 3 using an AFLP strategy as described by Peters et al. (2004)
With a further analysis of 156 hws-1 mutant plants from the original F2 population, using a combination of CAPS and SSLP, the region was reduced to a 0.404 MB between the markers FUS6.2 and NGA6. From 600 F2 hws-1 mutant plants, and the use of InDels that were identified from the Cereon Arabidopsis Polymorphism collection (Cereon Genomics; http://www.arabidopsis.org/Cereon/index.html), the region was further reduced to a segment of 56 kb between markers 470113 and 469675. This region contained 18 annotated genes (Fig. 5A). The InDel flanking primers designed for fine mapping hws-1 are summarized in Supplemental Table S1. PCRs were performed in a reaction of 20 µL following red taq (ABgene) manufacturer instructions; the PCR conditions for amplification were: 3 min at 94°C, 30 cycles of 94°C for 30 s, 55°C to 60°C for 30 s (depending on primer combination), 72°C for 30 s, and 7 min at 72°C, 4°C Salk KO lines were identified for the 18 annotated genes within this region and grown in the glasshouse. Individuals from one of these KO lines (Salk_088349), documented to contain a T-DNA insertion in At3g61590, proved to exhibit a similar phenotype to the hws-1 mutant. Primers from the region corresponding to the At3g61590 gene that amplified a genomic PCR segment of 1,271 bp are At361590forcDNA: 5'GCTCTTGAGAATGGAAGCAGAAAC 3' and At3g61590Rev: 5'CAGACCCATTTGCTTCTTCATTGC 3'. PCR reactions were performed in a 50 µL reaction following red taq (ABgene) manufacturer instructions. Conditions for amplification were: 3 min at 94°C, 30 cycles of 94°C for 15 s, 61°C for 1 min, 72°C for 2 min, 7 min at 72°C, 4°C, and the PCR products were run in a 1% agarose gel. The digestion of PCR products was performed in 20 µL reactions containing: 500 ng of PCR product, 10x reaction buffer, 2 µg of bovine serum albumin, and 0.5 µL of each enzyme, incubated at 37°C (RsaI and AluI) or 65°C (TaqI) and run in a 3% agarose gel. The expected restriction sizes for the amplified PCR segment corresponding to the At3g61590 ORF genomic region are shown in Supplemental Table S2.
A plant from the Salk_088349 KO line was used to cross with the hws-1 line and PCR analyses were performed to identify the presence of the two T-DNA insertions and the genomic fragment from the hws-1 mutant from the two parental lines; information about primers is described previously. To test the T-DNA insertion the LBb1 of pBIN-pROK2 for SALK lines primer was used: 5' GCGTGGACCGCTTGCTGCAACT 3' (http://signal.salk.edu/tdnaprimers.2.html; Alonso et al., 2003
Total RNA from roots, buds, flowers, rosette leaves, stem, young siliques, and old siliques from wild type, and a mix of tissues from progeny plants 1 and 2 from the cross between the hws-1 mutant with Salk_088349 line (hws-2) and from a mix of flowers from several developmental positions from F1 overexpressing lines, was extracted using a modified method described by Han and Grierson (2002) Expression analyses were determined using the SuperScript II Reverse Transcriptase kit from Invitrogen according to the manufacturer's instructions. First-strand cDNA synthesis was performed in a 20 µL reaction containing 2 µg of total RNA, 1 µL of 500 µg mL1 oligo (dT), and 2 µL of 5 mM dNTPs and 13 µL of water. PCR reactions were performed in 25 µL following red taq (ABgene) manufacturer instructions; the PCR conditions for amplification were: 3 min at 95°C, 30 cycles of 95°C for 1 min, 50°C to 58°C for 1 to 2 min (depending on primer combination and size of expected band), 72°C for 1 to 2 min, and 7 min at 72°C, 4°C. PCR products were run in a 1% agarose gel. The forward and reverse primers used in tissues from wild type, the progeny from crosses, and endogenous gene for overexpressing lines were 590 5' UTR: 5' CTTCTCTCATCCTCGCGCTTGCTCTCTC 3' and At3g61590Rev (previously described) that gave a genomic band of 2,213 bp and a cDNA of 1,668 bp. Use of these primers allows the identification of genomic contamination. To amplify the transgene of overexpressing lines the primer pKT735Sprom 5' GAGGAGCATCGTGGAAAAAG 3' from the 35S promoter and At3g61590Rev were used. The amplified band from this primer combination is 1,677 bp. Ubiquitin (At4g05320) primers UBQ10For, 5'-TAAAAACTTTCTCTCAATTCTCTCT-3' and UBQ10Rev, 5'-AAGCTCCGACACCATTGACAA-3' were used to evaluate the amounts of RNA levels in all tissues; these primers amplify a 1,555 bp from genomic DNA and 1,251 bp from cDNA; in addition, control reactions without reverse transcriptase were performed using the same conditions to confirm absence of genomic contamination in all RT-PCR reactions performed.
All the constructs generated originated from wild-type genomic DNA extracted (Qiagen, DNAeasy Plant Mini kit) and amplified with the proof reading pfx DNA polymerase (Invitrogen) following the manufacturer's instructions. All the PCR products were subcloned in P-GEM T-Easy from Promega, unless otherwise specified, digested, and fused to the binary vectors at the multiple cloning site or at the site of digestion, as described below. To perform the complementation test of the hws-1 mutant, a genomic segment from At3g61590 containing 1,291 bp of the promoter region, 419 bp from the 5' UTR, 532 bp from the intron, 1,236 bp from the ORF, and 181 bp from the 3' UTR using the primers 590compfor 5' CCTCCAGTTTCAGAATCCGACC 3'and 590comprev 5' CCTCCAGTTTCAGAATCCGACC 3' was amplified from DNA of Col-0 wild type. Using this PCR product as template, the following primers containing a SalI site and a BamHI site in the forward and reverse primer, respectively (highlighted in bold), were used: 590CompSalFor, 5' GCAGTCGACGGCACTAAGGAGCAATGTG 3' 590CompBamRev, 5' GCCGGATCCTCCAGTTTCAGAATCCGAC 3'. The PCR parameters used were: 94°C for 5 min, followed by 35 cycles of 94°C for 15 s and 68°C for 3.5 min, and a final elongation step at 68°C for 7 min. To generate the GUS reporter lines, a segment containing the promoter of the HWS (At3g61590), the 5' UTR and the intron (2,242 bp), was also amplified by PCR. The primers used to amplify this genomic segment were the 590CompSalFor described previously and the 590PrBamRev 5' GCCGGATCCTCTCAAGAGCCTCTGAAAC 3' with a SalI and a BamHI site at the forward and reverse primers, respectively (highlighted in bold). The PCR parameters used were: 94°C for 5 min, followed by 35 cycles of 94°C for 15 s and 68°C 2.5 min, and a final elongation step at 68°C for 7 min.
To generate the GFP lines, the ProHWS:GUS construct was modified by digesting and replacing the GUS gene with the GFP ORF also digested from the MOG vector used previously for the PGAZAT gene (González-Carranza et al., 2002 The overexpressor construct was generated by amplifying the ORF from the HWS gene using the primers: 59035SBamHATGfor, 5' GCGGGATCCCTCTTGAGAATGGAAGCAG 3' and 59035SsacIrev, 5' CGTGAGCTCCCAGTTTCAGAATCCGACC 3' with a BamHI and a SacI site at the forward and reverse primers, respectively (highlighted in bold). The PCR parameters used were the same as for the ProHWS:GUS construct. This segment was subcloned in a MOG402 engineered vector containing two copies of the 35S CaMV promoter.
Escherichia coli DH5 Selection of transformants was carried out in a growth room at 22°C using petri dishes containing Murashige and Skoog media at pH 5.9, 0.8% (w/v) agar, and kanamycin 40 µg mL1. Transformation was confirmed by PCR using the correct set of primers per construct. For complementation tests, primary transformants were screened for kanamycin resistance and plants were grown and analyzed for rescue of the hws phenotype. T2 seeds were collected from individual lines for the GUS and GFP reporter lines and the overexpressor lines, and screened for kanamycin resistance to identify at least six homozygous lines to check for consistency of expression.
GUS staining, washing, and mounting for the different tissues analyzed was performed as described in González-Carranza et al. (2002)
GFP fluorescence in the transgenic lines was examined using a Leica (TCS SP2) laser-scanning confocal microscope equipped with argon krypton and green HeNe lasers and an AOBS scan head system (Leica Microsystems). GFP was excited at 488 nm with the argon ion laser. Images were recorded using the Leica CONFOCAL software. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers BT000054/BX823146/BX824604 (At3g61590) and AAC02763 (At2g41850).
The following materials are available in the online version of this article.
We thank Rick Noteboom (Radboud University, Nijmegen, The Netherlands) for technical help in the map-based cloning experiments and Patricia Goggin of the Electron Microscopy Unit at Royal Holloway. Received October 31, 2006; accepted April 29, 2007; published May 11, 2007.
1 This work was supported by a grant from the Biotechnology and Biological Sciences Research Council and a studentship funded by the government of Thailand. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Jeremy A. Roberts (jeremy.roberts{at}nottingham.ac.uk).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.092288 * Corresponding author; e-mail jeremy.roberts{at}nottingham.ac.uk; fax 441159516334.
Abramoff MD, Magelhaes PJ, Ram SJ (2004) Image processing with ImageJ. J Biophotonics Int 11: 3642 Addicott FT (1982) Abscission. University of California Press, Berkeley, CA Aida M, Ishida T, Fukaki H, Fujishawa H, Tasaka M (1997) Genes involved in organ separation in Arabidopsis: an analysis of the cuc-shaped cotyledon mutant. Plant Cell 9: 841857 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653657 Belfield EJ, Ruperti B, Roberts JA, McQueen-Mason S (2005) Changes in expansin activity and gene expression during ethylene-promoted leaflet abscission in Sambucus nigra. J Exp Bot 56: 817823 Brewer P, Howles P, Dorian K, Griffith M, Ishida T, Kaplan-Levy R, Kilinc A, Smyth D (2004) Petal loss, a trihelix transcription factor gene, regulates perianth architecture in the Arabidopsis flower. Development 131: 40354045 Butenko MA, Patterson SE, Grini PE, Stenvik G-E, Amundsen SS, Mandal A, Aalen RB (2003) INFLORESCENCE DEFICIENT IN ABSCISSION controls floral organ abscission in Arabidopsis and identifies a novel family of putative ligands in plants. Plant Cell 15: 22962307 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735743[CrossRef][Web of Science][Medline] Durfee T, Roe JL, Sessions RA, Inouye C, Serikawa K, Feldmann KA, Weigel D, Zambryski PC (2003) The F-box-containing protein UFO and AGAMOUS participate in antagonistic pathways governing early petal development in Arabidopsis. Proc Natl Acad Sci USA 100: 85718576 Ellis CM, Nagpal P, Young JC, Hagen G, Guilfoyle TJ, Reed JW (2005) AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis. Development 132: 45634574 Fernandez DE, Heck GR, Perry SE, Patterson SE, Bleecker AB, Fang S-C (2000) The embryo MADS domain factor AGL15 acts postembryonically: inhibition of perianth senescence and abscission via constitutive expression. Plant Cell 12: 183198 González-Carranza ZH, Lozoya-Gloria E, Roberts JA (1998) Recent developments in abscission: shedding light on the shedding process. Trends Plant Sci 3: 1014[CrossRef][Web of Science] González-Carranza ZH, Whitelaw CA, Swarup R, Roberts JA (2002) Temporal and spatial expression of a polygalacturonase during leaf and flower abscission in oilseed rape and Arabidopsis. Plant Physiol 128: 534543 Gray WM, del Pozo CJ, Walker L, Hobbie L, Risseeuw E, Banks T, Crosby WL, Yang M, Ma H, Estelle M (1999) Identification of an SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana. Genes Dev 13: 16781691 Han Y, Grierson D (2002) Relationship between small antisense RNAs and aberrant RNAs associated with sense transgene mediated gene silencing in tomato. Plant J 29: 509519[CrossRef][Web of Science][Medline] Harding EW, Tang W, Nichols KW, Fernandez DE, Perry SE (2003) Expression and maintenance of embryogenic potential is enhanced through constitutive expression of AGAMOUS-Like 15. Plant Physiol 133: 653663 Hepworth SR, Zhang Y, McKim S, Li X, Haughn GW (2005) BLADE-ON-PETIOLE1 dependent signaling controls leaf and floral patterning in Arabidopsis. Plant Cell 17: 14341448 Jarillo JA, Capel J, Tang RH, Yang HQ, Alonso JM, Ecker JR, Cashmore AR (2001) An Arabidopsis circadian clock component interacts with both CRY1 and phyB. Nature 410: 487490[CrossRef][Medline] Jinn T-L, Stone JM, Walker JC (2000) HAESA, an Arabidopsis leucine-rich repeat receptor kinase, controls floral organ abscission. Genes Dev 14: 108117 Kepinski S, Leyser O (2005) The Arabidopisis F-box protein TIR1 is an auxin receptor. Nature 435: 446451[CrossRef][Medline] Krizek BA, Lewis MW, Fletcher JC (2006) RABBIT EARS is a second-world repressor of AGAMOUS that maintains spatial boundaries in Arabidopsis flowers. Plant J 45: 369383[CrossRef][Web of Science][Medline] Laufs P, Coen E, Kronenberger J, Traas J, Doonan J (2003) Separable roles of UFO during floral development revealed by conditional restoration of gene function. Development 130: 785796 Laufs P, Peaucelle A, Morin H, Traas J (2004) MicroRNA regulation of the CUC genes is required for boundary size control in Arabidopsis meristems. Development 131: 43114322 Lehti-Shiu MD, Adamczyk BJ, Fernandez DE (2005) Expression of MADS-box genes during the embryonic phase in Arabidopsis. Plant Mol Biol 58: 89107[CrossRef][Web of Science][Medline] Levin J, Fletcher J, Chen X, Meyerowitz E (1998) A genetic screen for modifiers of UFO meristem activity identifies three novel fused floral organs genes required for early flower development in Arabidopsis. Genetics 149: 579595 Levin JZ, Meyerowitz EM (1995) UFO: an Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell 7: 529548[Abstract] Li C, Zhou A, Sang T (2006) Rice domestication by reducing shattering. Science 311: 19361939 Mallory AC, Dugas DV, Bartel DP, Bartel B (2004) MicroRNA regulation of NAC-domain targets is required for proper formation and separation of adjacent embryonic, vegetative, and floral organs. Curr Biol 14: 10351046[CrossRef][Web of Science][Medline] Mao L, Begum D, Chuang HW, Budiman MA, Szymkowiak EJ, Irish EE, Wing RA (2000) JOINTLESS is a MADS-box gene controlling tomato flower abscission zone development. Nature 406: 910913[CrossRef][Medline] Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 18: 100127 Ni W, Xie D, Hobbie L, Feng B, Zhao D, Akkara J, Ma H (2004) Regulation of flower development in Arabidopsis by SCF complexes. Plant Physiol 134: 15741585 Norberg M, Holmlund M, Nilsson O (2005) The BLADE ON PETIOLE genes act redundantly to control growth and development of lateral organs. Development 132: 22032213 Patterson SE (2001) Cutting loose: abscission and dehiscence in Arabidopsis. Plant Physiol 126: 494500 Peters JL, Cnops G, Neyt P, Zethof J, Cornelis K, Van Lijsebettens M, Gerats T (2004) An AFLP-based genome-wide mapping strategy. Theor Appl Genet 108: 321327[CrossRef][Web of Science][Medline] Prasad AM, Sivanandan C, Resminath R, Thakare DR, Bhat SR, Srinivasan (2005) Cloning and characterization of a pentatricopeptide protein encoding gene (LOJ) that is specifically expressed in lateral organ junctions in Arabidopsis thaliana. Gene 353: 6779[CrossRef][Web of Science][Medline] Roberts JA, Elliott KA, González-Carranza ZH (2002) Abscission, dehiscence, and other cell separation processes. Annu Rev Plant Biol 53: 131158[CrossRef][Medline] Samach A, Klenz JE, Kohalmi SE, Risseeuw E, Haughn GW, Crosby WL (1999) The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F-box protein required for normal patterning and growth in the floral meristem. Plant J 20: 433445[CrossRef][Web of Science][Medline] Sampedro J, Cosgrove DJ (2005) The expansin superfamily. Genome Biol 6: 242[Medline] Schruff MC, Spielman M, Tiwari S, Adams S, Fenby N, Scott RJ (2006) The AUXIN RESPONSE FACTOR2 gene of Arabidopsis links auxin signalling, cell division, and the size of seeds and other organs. Development 133: 251261 Schultz EA, Haughn GW (1991) LEAFY, a homeotic gene that regulates inflorescence development in Arabidopsis. Plant Cell 3: 771781 Sedbrook JC, Carroll KL, Hing KF, Masson PH, Somerville CR (2002) The Arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositol-anchored glycoprotein involved in directional root growth. Plant Cell 14: 16351648 Sexton R, Roberts JA (1982) Cell biology of abscission. Annu Rev Plant Physiol 33: 133162[Web of Science] Shuai B, Reynaga-Peña CG, Springer PS (2002) The LATERAL ORGAN BOUNDARIES gene defines a novel, plant-specific gene family. Plant Physiol 129: 747761 Smyth DR, Bowman JL, Meyerowitz EM (1990) Early flower development in Arabidopsis. Plant Cell 2: 755767 Stenvik G-E, Butenko MA, Urbanowicz BR, Rose JKC, Aalen RB (2006) Overexpression of INFLORESENCE DEFICIENT IN ABSCISSION activates cell separation in vestigial abscission zones in Arabidopsis. Plant Cell 18: 14671476 Takada S, Hibara K, Ishida T, Tasaka M (2001) The CUP-SHAPED COTYLEDON1 gene of Arabidopsis thaliana regulates shoot apical meristem formation. Development 128: 11271135[Abstract] Takahashi N, Kuroda H, Kuromori T, Hirayama T, Seki M, Shinozaki K, Shimada H, Matsui M (2004) Expression and interaction analysis of Arabidopsis Skp1-related genes. Plant Cell Physiol 45: 8391 Taylor JE, Whitelaw CA (2001) Signals in abscission. New Phytol 151: 323339[CrossRef][Web of Science] Taylor S, Hofer J, Murfet I (2001) Stamina pistilloida, the pea orthologue of Fim and UFO, is required for normal development of flowers, inflorescences, and leaves. Plant Cell 13: 3146 Vroemen CW, Mordhorst AP, Albretch C, Kwaaitaal CJ, de Vries SC (2003) The CUC-SHAPED COTYLEDON3 gene is required for boundary and shoot meristem formation in Arabidopsis. Plant Cell 15: 15631577 Weigel D, Meyerowitz EM (1993) Activation of floral homeotic genes in Arabidopsis. Science 261: 17231726 Zhao Y, Medrano L, Ohasho K, Fletcher JC, Yu H, Sakai H, Meyerowitz EM (2004) HANABA TARANU is a GATA transcription factor that regulates shoot apical meristem and flower development in Arabidopsis. Plant Cell 16: 25862600 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|