Plant Physiol. Drug Metab Dispos
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online May 25, 2007; 10.1104/pp.107.100735

Plant Physiology 144:1383-1390 (2007)
© 2007 American Society of Plant Biologists

OPEN ACCESS ARTICLE
This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrowOA All Versions of this Article:
144/3/1383    most recent
pp.107.100735v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Plant Physiol.
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jacob, Y.
Right arrow Articles by Michaels, S. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jacob, Y.
Right arrow Articles by Michaels, S. D.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Agricola
Right arrow Articles by Jacob, Y.
Right arrow Articles by Michaels, S. D.
DEVELOPMENT AND HORMONE ACTION

The Nuclear Pore Protein AtTPR Is Required for RNA Homeostasis, Flowering Time, and Auxin Signaling1,[C],[W],[OA]

Yannick Jacob2, Chareerat Mongkolsiriwatana2,3, Kira M. Veley, Sang Yeol Kim and Scott D. Michaels*

Department of Biology, Indiana University, Bloomington, Indiana 47405


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Nuclear pore complexes (NPCs) mediate the transport of RNA and other cargo between the nucleus and the cytoplasm. In vertebrates, the NPC protein TRANSLOCATED PROMOTER REGION (TPR) is associated with the inner filaments of the nuclear basket and is thought to serve as a scaffold for the assembly of transport machinery. In a screen for mutants that suppress the expression of the floral inhibitor FLOWERING LOCUS C, we identified lesions in the Arabidopsis (Arabidopsis thaliana) homolog of TPR (AtTPR). attpr mutants exhibit early-flowering and other pleiotropic phenotypes. A possible explanation for these developmental defects is that attpr mutants exhibit an approximately 8-fold increase in nuclear polyA RNA. Thus AtTPR is required for the efficient export of RNA from the nucleus. Microarray analysis shows that, in wild type, transcript abundance in the nuclear and total RNA pools are highly correlated; whereas, in attpr mutants, a significantly larger fraction of transcripts is enriched in either the nuclear or total pool. Thus AtTPR is required for homeostasis between nuclear and cytoplasmic RNA. We also show that the effects of AtTPR on small RNA abundance and auxin signaling are similar to that of two other NPC-associated proteins, HASTY (HST) and SUPPRESSOR OF AUXIN RESISTANCE3 (SAR3). This suggests that AtTPR, HST, and SAR3 may play related roles in the function of the nuclear pore.


The change from vegetative to reproductive growth is one of the most significant transitions in plant development; stem cells in the shoot apical meristem switch from producing vegetative structures (e.g. leaves) to producing flowers. Proper timing of this transition is critical for successful reproduction and is therefore highly regulated by both endogenous and environmental factors. One of the major regulators of flowering time in Arabidopsis (Arabidopsis thaliana) is the floral repressor FLOWERING LOCUS C (FLC). FLC is a MADS-domain-containing transcription factor whose transcript level is regulated by both endogenous and environmental pathways (Michaels and Amasino, 1999Go; Sheldon et al., 1999Go). In rapid-cycling accessions, FLC expression is repressed by a group of seven genes known collectively as the autonomous floral-promotion pathway (AP; Boss et al., 2004Go). In contrast to rapid-cycling accessions, naturally occurring winter-annual Arabidopsis are late flowering unless flowering is promoted by a prolonged exposure to cold temperatures (vernalization). Winter-annual accessions contain functional alleles of the FRIGIDA (FRI) gene, which acts epistatically to the AP to up-regulate FLC expression and delay flowering. Thus both FRI-containing winter annuals and AP mutants contain high levels of FLC and are late flowering. Vernalization, however, can eliminate this late-flowering phenotype through a permanent epigenetic shut off of FLC expression via changes in chromatin structure at the FLC locus (Sung and Amasino, 2005Go). Although the complex regulation of FLC is not yet fully understood at the molecular level, the predicted function of genes known to be required for proper FLC expression can be divided into several groups. In addition to genes of unknown biochemical function, known FLC regulators include chromatin modifying enzymes, transcription factors, and a number of RNA-associated proteins, including ABSCISIC ACID HYPERSENSITIVE1 (ABH1; Hugouvieux et al., 2001Go; Bezerra et al., 2004Go). ABH1 encodes the plant homolog of CAP-BINDING PROTEIN80, a component of the nuclear cap-binding complex that has been implicated in pre-mRNA processing and nuclear export via the nuclear pore complex (NPC; Cheng et al., 2006Go).

Because the sites of transcription and translation are physically separated by the nuclear membrane, transcripts must be exported from the nucleus to the cytoplasm through the nuclear pore. The NPC is a large structure with 8-fold radial symmetry and is constructed from subcomplexes composed of approximately 30 proteins (Tran and Wente, 2006Go). One of the major ultrastructural features of the NPC is the nuclear basket, a filamentous network of proteins that extends from the NPC into the nuclear matrix. The nuclear basket is thought to act as a scaffold for the assembly of various molecules involved in nuclear export (Krull et al., 2004Go). A component of the nuclear basket in vertebrates is TRANSLOCATED PROMOTER REGION (TPR), a large coiled-coil protein associated with inner basket filaments (Krull et al., 2004Go). In yeast (Saccharomyces cerevisiae), the TPR homologs MYOSIN-LIKE PROTEIN1 (MLP1) and MLP2 appear to play a role in mRNA export quality control as incompletely processed transcripts accumulate in the cytoplasm in mlp1 mutants (Galy et al., 2004Go). Here we report the characterization of the Arabidopsis homolog of TPR (AtTPR). AtTPR was identified in a screen for early flowering in an AP-mutant background and is required for high levels of FLC expression; however, its effects are not limited to flowering time. A striking molecular phenotype of attpr mutants is the accumulation of polyadenylated (polyA) transcripts in the nucleus. Interestingly, a similar nuclear accumulation of polyA RNA has been reported for mutants in two other Arabidopsis NPC proteins, SUPPRESSOR OF AUXIN RESISTANCE3 (SAR3) and SAR1, which are orthologs of the human nucleoporins (NUPs) NUP96 and NUP160 (Dong et al., 2006Go; Parry et al., 2006Go). Unlike TPR, NUP96/160 are not associated with the nuclear basket, but are part of the NUP107-160 subcomplex and show a symmetrical distribution on both the cytoplasmic and nuclear faces of the NPC (Tran and Wente, 2006Go). Microarray analysis of nuclear and total RNA fractions in the attpr mutant indicates that, despite the nuclear accumulation of mRNA, the composition of the transcriptome remains relatively similar to wild type. We also show that many of the other phenotypes exhibited by attpr mutants are similar to mutants in SAR3 or HASTY (HST), the Arabidopsis ortholog of the mammalian nuclear export receptor EXPORTIN5 (Bollman et al., 2003Go).


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Identification of AtTPR as a Pleiotropic Early-Flowering Mutant

To identify genes involved in the regulation of FLC by the AP, we conducted a genetic screen for suppressors of the late-flowering phenotype of the AP mutant LUMINIDEPENDENS (LD; Lee et al., 1994Go). ld-1 mutant plants were mutagenized by T-DNA insertional mutagenesis using the activation tagging vector pSKI015 (Weigel et al., 2000Go) and T2 plants were screened for early flowering. Two mutants, ld suppressor (lds) 30B and lds32B, exhibited a strong early-flowering phenotype under both long and short days (Fig. 1, A–C ). Genomic DNA flanking the T-DNA insertion sites was rescued using thermal asymmetric interlaced PCR (Liu et al., 1995Go). The sequences of the PCR products indicated that both mutants contained T-DNA insertions in the same gene, At1g79280 (Fig. 1D). To verify that the lesions in At1g79280 were responsible for the phenotypes of lds30B and lds32B, an additional allele of At1g79280 was obtained from the SALK collection (SALK057101; Alonso et al., 2003Go). SALK057101 homozygotes also flowered earlier than wild type under long and short days (Fig. 1C). This result confirms that the early-flowering phenotype of lds30B and lds32B is due to disruption of At1g79280. The At1g79280 protein is similar to TPR from vertebrates; therefore, we refer to this gene as AtTPR. Among the three alleles of AtTPR, the T-DNA insertion in SALK057101 is nearest the 5' end of the gene and thus most likely to represent a null allele. Therefore, the SALK057101 allele was chosen for further analysis. In addition to early flowering, all three mutants in attpr showed similar pleiotropic phenotypes, including reduced leaf size (Fig. 2A ), reduced apical dominance and fertility (data not shown), a low occurrence of terminal flowers (Fig. 2, B and C), and disruption of cell patterning (Fig. 2, D–G).


Figure 1
View larger version (54K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. attpr mutations and their effect on flowering time. ld-1 (A) and lds30B (B) grown in long days for 4 weeks. C, The effect of attpr mutations on flowering time in the indicated backgrounds. Black and gray bars represent the number of primary rosette leaves formed prior to flowering in long and short days. The white portions of the bars represent the number of cauline leaves. Error bars indicate one SD. D, A schematic representation of AtTPR; the thin line indicates the chromosome, thick lines indicate exons. The positions of T-DNA insertions in attpr mutants are indicated above the gene. [See online article for color version of this figure.]

 

Figure 2
View larger version (49K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Effect of attpr on development and gene expression. A, Rosette leaves formed prior to flowering in long days by Col (top) and attpr (bottom). B to G, Scanning electron micrographs of Col (B, D, and F) and attpr (C, E, and G) inflorescences (B and C) and sepals (D–G). White bars represent 1 mm (B and C), 100 µm (D and E), and 10 µm (F and G). H, RT-PCR analysis of gene expression in the indicated genotypes; numbers indicate fold changes relative to Col. RNA was isolated from 2-week-old seedlings grown under long days. UBQ10 was used as a constitutively expressed control. [See online article for color version of this figure.]

 

AtTPR Affects Flowering Time through FLC-Dependent and FLC-Independent Mechanisms

To further characterize the effect of AtTPR on flowering time, we evaluated the effect of attpr mutations in a FLOWERING LOCUS D (FLD) mutant (FLD is a member of the AP) and in FRI-containing backgrounds. The late-flowering phenotype of AP mutants and FRI-containing lines is due to elevated levels of the floral repressor FLC. Therefore, mutations in FLC suppress the late-flowering phenotype of AP mutations and FRI (Michaels and Amasino, 2001Go). Similar to lds30B and lds32B in the ld-mutant background, attpr fld and attpr FRI lines showed a strong early-flowering phenotype under long or short days (Fig. 1C). To determine if this early-flowering phenotype was due to a suppression of FLC expression, reverse transcription (RT)-PCR was used to investigate FLC mRNA levels (Fig. 2H). In Columbia (Col), fld, and FRI backgrounds, the attpr mutation caused a significant reduction in FLC transcript. FLC is known to inhibit flowering by suppressing the expression of the floral promoters SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 (SOC1), FT, and TWIN SISTER OF FT (TSF; Boss et al., 2004Go). As predicted, the reduced level of FLC transcript in the attpr FRI and attpr fld backgrounds coincides with an increase in SOC1, FT, and TSF (Fig. 2H). These results are consistent with a model in which the early-flowering phenotype of attpr mutants is due to a reduction in FLC expression. It should be noted, however, that the attpr mutant in the Col, ld, or fld backgrounds flowered earlier than the corresponding flc mutant (Fig. 1C), thus the early-flowering phenotype of attpr mutants cannot be explained by FLC suppression alone. Part of the early-flowering phenotype of attpr mutants may involve an FLC-independent activation of SOC1, FT, and TSF. In a FRI attpr background, FLC levels are reduced, but remain higher than in Col (Fig. 2H), yet SOC1, FT, and TSF levels are similar to that observed in Col. Thus it appears that the up-regulation of SOC1, FT, and TSF in a FRI attpr background may be, at least partially, independent of the repression of FLC.

FLC is positively regulated by FRI and negatively regulated by the AP and vernalization. Given the suppression of FLC expression in attpr mutants, we investigated the expression of AtTPR in FRI-containing or AP-mutant backgrounds as well as following vernalization. RT-PCR analysis showed that the expression of AtTPR was unchanged in various genetic backgrounds or by vernalization treatment (Fig. 3A ). Expression of AtTPR was not detected in the attpr mutant. The spatial expression pattern of AtTPR was also investigated using RT-PCR and a transgenic line containing the AtTPR promoter fused to the GUS reporter gene (Jefferson, 1987Go) in the Col background (Fig. 3). Both analyses showed that AtTPR expression is highest in the shoot apical region.


Figure 3
View larger version (92K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. AtTPR expression. A, RT-PCR analysis of gene expression in the indicated genotypes and tissues. UBQ10 was used as a constitutively expressed control. B to E, Histochemical expression of GUS expression in AtTPR::GUS transgenic plants.

 

AtTPR Is a Putative Component of the Nuclear Pore

AtTPR is a large gene predicted to contain 49 exons and spanning 13.6 kb of chromosome 1 (Fig. 1D). attpr mutants contain T-DNA insertions in intron 8 (SALK057101), exon 16 (lds32B), and intron 21 (lds30B). Because no full-length cDNAs have been reported for this gene, the cDNA for AtTPR was amplified using RT-PCR. Due to the large size of the cDNA, AtTPR was amplified as three overlapping fragments that were subjected to sequencing. The sequences obtained for the AtTPR cDNA were identical to the predicted annotation. The full-length At1g79280 cDNA is 6,336 bp from the annotated translational start site to the stop codon and is predicted to encode a protein of 2,111 amino acids. AtTPR is not likely to have functional redundancy with other proteins in Arabidopsis; the most closely related proteins are less than 17% identical to AtTPR. Outside of plants, AtTPR is most similar to a group of long coiled-coil proteins from vertebrates (TPR: Bangs et al., 1996Go; Supplemental Fig. S1), Drosophila (MEGATOR: Qi et al., 2004Go), yeast (MLP1: Kolling et al., 1993Go; MLP2: Strambio-de-Castillia et al., 1999Go), and other species that are associated with the inner basket filaments of the nuclear pore (Krull et al., 2004Go). These proteins appear to play key roles in the regulated transport of mRNA from the nucleus to the cytoplasm. Pre-mRNAs are processed (5' 7-methylguanosine cap, splicing of introns, and 3' cleavage and polyadenylation) within the nucleus to produce mature mRNAs that are then transported to the cytoplasm to be translated. Many of these pre-mRNA processing and transport events are mediated by heterogeneous nuclear ribonucleoproteins. MLP1 has been shown to physically interact with an heterogeneous nuclear ribonucleoprotein, Nab2p (Green et al., 2003Go), and loss of MLP1 causes incompletely processed mRNA to accumulate in the cytoplasm (Galy et al., 2004Go). Thus MLP1 appears to play critical roles in RNA transport and the retention of incompletely processed mRNA in the nucleus.


AtTPR Is Required for the Nuclear Export of mRNA

To determine if AtTPR plays a similar role to MLP1 in nuclear-cytoplasmic mRNA trafficking, we investigated the effect of attpr mutations on mRNA localization. If AtTPR is required for efficient nuclear export, attpr mutants would be expected to accumulate mRNA in the nucleus. Whole-mount in situ hybridization was performed on wild-type and attpr-mutant leaves using a fluorescein-labeled oligo dT probe (Fig. 4, A–C ). Strong nuclear staining was only observed in the attpr mutant, suggesting that AtTPR is required for nuclear export of polyA RNA. This result is similar to that seen for loss-of-function mutations in two other Arabidopsis nuclear pore proteins, SAR3 (Parry et al., 2006Go) and AtNUP160 (Dong et al., 2006Go), suggesting that these proteins may have roles related to that of AtTPR in nuclear pore function.


Figure 4
View larger version (30K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. RNA analysis in attpr mutants. A to C, Whole-mount in situ localization of polyA RNA. Confocal images of leaves of Col (A and B) and attpr (C) hybridized without (A) or with (B and C) a poly(dT) fluorescein-tagged oligonucleotide. Leaves were harvested from 3-week-old plants grown under short days (A–C). D and E, RNA-blot analysis of polyA RNA in nuclear and total RNA from Col and attpr. Blots were probed with a radiolabeled poly(dT) oligonucleotide. D, Numbers indicate fold changes relative to Col. E, Size distribution of polyA RNA in Col and attpr total RNA. Photographs of the ethidium-stained gels used to produce the RNA blots are shown in the bottom sections (D and E) and were used as a control for loading. F to I, Microarray analysis in Col and the attpr mutant. Scatter plots of normalized signal intensities are shown for the indicated samples.

 
The role of AtTPR in polyA RNA transport and metabolism was further investigated by RNA-blot analysis using total RNA and RNA extracted from purified nuclei. To estimate the amount of polyA RNA present, a radioactive oligo(dT) primer was used as a probe. Consistent with the results of in situ hybridization (Fig. 4, A–C), higher levels of polyA RNA were detected in the attpr mutant compared to wild type (Fig. 4D). In nuclear RNA, levels were approximately 8 times higher, whereas in total RNA the level of polyA RNA was approximately 3-fold higher. In addition to an increase in the amount of polyA RNA in the attpr mutant, it appeared that the average size of the detected transcripts might be higher in the mutant. An increase in transcript size would be consistent with AtTPR having a similar function to MLP1 in the retention of incompletely processed (e.g. intron-containing) RNAs in the nucleus. When the experiment was repeated with lower quantities of attpr-mutant RNA (to produce a blot with similar polyA RNA intensities), however, no differences in average transcript size were apparent (Fig. 4E). RNA-blot analysis was also performed on wild-type and attpr-mutant total RNA to look for evidence of incompletely processed RNAs. FLC (Supplemental Fig. S2A) and eight other genes (Supplemental Fig. S2B) with various intron exon structures were used as probes. In all cases, no change in banding pattern was observed in the attpr mutant. Thus, at least in this small sampling of transcripts, no evidence was obtained that AtTPR is required for nuclear retention of incompletely processed mRNAs.


Microarray Analysis of PolyA RNA Partitioning in Wild-Type and attpr Mutants

Loss of AtTPR function leads to higher levels of polyA RNA in both total and nuclear RNA fractions (Fig. 4, A–D). To globally examine the effect of attpr mutations on polyA RNA abundance and localization, microarray analysis was used. Above-ground portions of wild-type and attpr-mutant plants were harvested when the first flowers had fully opened and were used to extract total and nuclear RNA. Five biological replicates were used for each of the four conditions (wild-type total RNA, wild-type nuclear RNA, attpr total RNA, and attpr nuclear RNA). From each of the 20 samples, equal amounts of RNA were used to prepare labeled cRNA, which was hybridized to GeneChip Arabidopsis ATH1 Genome Arrays (Affymetrix). For each comparison, raw signal intensities from the arrays were normalized to give each array the same mean. To minimize erroneous results due to low signal intensity, transcripts were considered for further analysis only if, in at least one of the conditions, the transcript was called present in at least four of the five replicates. Because of the normalization between conditions, the absolute changes in the overall amount of mRNA between wild type and attpr (Fig. 4D) will not be apparent in these analyses; however, the composition of the transcriptomes can be compared.

An interesting question concerning the role of AtTPR in the nuclear export of polyA RNA is whether the increase in nuclear mRNA seen in the attpr mutant is due to a general retention of all transcripts or if particular transcripts are unable to exit the nucleus. Therefore, we compared transcript levels in the nuclear and total RNA fractions from wild type and the attpr mutant. One interesting result from this analysis is that the nuclear and total RNA pools have a very similar composition in wild-type plants (Fig. 4F); relatively few transcripts showed a significant accumulation in either nuclear or total RNA. In contrast, the correlation between transcript abundance in nuclear or total RNA fractions was less strong in the attpr mutant (Fig. 4G). In wild type, 18.7% of transcripts showed a greater than 2-fold difference in abundance between the nuclear and total RNA samples (P = <0.01), whereas in the attpr mutant, 39.1% of transcripts showed a greater than 2-fold difference in abundance. Thus AtTPR is required for maintaining homeostasis between the nuclear and total RNA pools, presumably by facilitating polyA RNA export. We did not observe strong nuclear accumulation of a subset of transcripts that could explain the increased nuclear mRNA levels in the attpr mutant. For this reason, we conclude that the nuclear accumulation of polyA RNA in attpr is likely the result of the reduced transport of most transcripts.

Because the analysis above does not involve direct comparisons between wild-type and attpr-mutant RNA samples, the observed differences in transcript partitioning are unlikely to be due to differences in gene expression between genetic backgrounds. Therefore, to examine the effect of the attpr mutation on gene expression, we compared nuclear (Fig. 4H) and total RNA (Fig. 4I) from wild type and the attpr mutant. Given the large changes observed in polyA RNA abundance in wild type and attpr (Fig. 4D), we were surprised to find relatively few transcripts with large changes in expression. In total RNA (Fig. 4I), only 8% of transcripts showed a greater than 2-fold change in expression (P = <0.01). Therefore, despite the large increase in the amount of polyA RNA in the attpr mutant, the composition of the transcriptome is relatively similar to wild type. This may help to explain why attpr mutants are still viable despite a severalfold increase in polyA RNA.


Early Flowering, Alterations in miRNA Levels, and Changes in Auxin Signaling May Be General Phenotypes Associated with Impaired Nuclear Pore Function

Mutations affecting nuclear pore/nuclear trafficking proteins have been identified from screens for various phenotypes. For example, HST was identified in a screen for mutants that accelerate the juvenile to adult phase transition (Telfer and Poethig, 1998Go; Bollman et al., 2003Go); SAR3 was identified due to an altered auxin response (Parry et al., 2006Go), and SAR1/AtNUP160 has been shown to affect both auxin signaling (Parry et al., 2006Go) and response to cold stress (Dong et al., 2006Go). Despite having been identified from screens for different phenotypes, hst, sar3, and sar1/atnup160 mutants share several common phenotypes with each other and with attpr, including reduced size, reduced fertility, and early flowering. In addition, sar3, sar1/atnup160, and attpr mutants all accumulate polyA transcripts in the nucleus. The similar phenotypes of these mutants suggest that all of these genes may play related roles in nuclear pore function.

To further explore the relationship between AtTPR and other nuclear-pore-associated proteins, we examined the effect of attpr mutations on small RNA levels and auxin signaling. hst mutants have been shown to have reduced levels of many micro (mi)RNAs. The levels of other small RNAs, such as endogenous small interfering RNAs, however, are unaffected in the hst background (Park et al., 2005Go). In the attpr mutant, we found that the levels of several miRNAs were significantly reduced, most notably miR159, miR165, and miR393; but, like hst mutants, the levels of the small interfering RNAs ASRP225 and ASRP1511 were unaffected (Fig. 5A ). Thus attpr and hst mutations have similar effects on small RNA abundance. We also investigated the effect of attpr mutations on auxin signaling. Normal inhibition of root elongation by auxin is blocked in auxin-resistant1 (axr1) mutants; however, sar3 mutations restore auxin sensitivity in an axr1 mutant background (Parry et al., 2006Go). To determine if attpr shows sar1/sar3-like effects on auxin signaling, an attpr axr1 double mutant was created and root elongation was measured in the presence or absence of 0.16 µM 2,4-dichlorophenoxyacetic acid (a synthetic auxin). In the axr1 background, attpr restored auxin sensitivity to a level similar to that seen in wild type or an axr1 sar3 double mutant (Fig. 5B). Thus attpr, like sar3, is a strong suppressor of axr1. Given the similar auxin-related phenotypes of attpr and sar3, we also tested the ability of sar3 mutants to accelerate flowering in a FRI-containing background. Interestingly, sar3 strongly promotes flowering in the FRI background; the sar3 mutant flowered with approximately 40 fewer leaves than FRI alone. Thus both attpr and sar3 are strong suppressors of FRI. It should be noted, however, that the suppression of FRI by sar3 is not as strong as the suppression by attpr (Fig. 1C). Taken together, the similar phenotypes of attpr, sar3, and hst mutants suggest that these genes may have related roles in the function of the NPC.


Figure 5
View larger version (68K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Effects of attpr on small RNA abundance and auxin signaling. A, RNA-blot analysis of small RNAs. Total RNA was isolated from the above-ground portions of long-day-grown flowering plants. B, Root elongation after 4 d on auxin-containing media for the indicated genotypes. C, Effect of sar3 on flowering time in a FRI-containing background. B and C, Error bars indicate one SD.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The transport of molecules across the nuclear membrane by the NPC is required for the exchange of information between the nucleus and the cytoplasm. We identified mutations in the Arabidopsis homolog of TPR, a component of the nuclear pore localized to the nuclear basket, in a screen for early-flowering mutants. attpr mutants strongly suppress the late-flowering phenotype of FRI-containing and AP-mutant backgrounds, which are late flowering due to elevated levels of the floral inhibitor FLC. Consistent with this phenotype, FLC transcript levels are suppressed in attpr-mutant backgrounds. Interestingly, attpr mutants maintain a relatively normal response to photoperiod, flowering earlier under long days than short days. This suggests that the early-flowering phenotype of attpr mutants is primarily an effect of FLC suppression. It should be noted, however, that attpr mutants flower earlier than flc null mutants, thus the early-flowering phenotype of attpr cannot be explained entirely in terms of FLC suppression.

In addition to its early-flowering phenotype, attpr mutants display a number of other developmental abnormalities including reduced size and fertility, occurrence of terminal flowers, and a disorganized cell morphology. At a molecular level, a striking phenotype of attpr mutants is the accumulation of polyA RNA in the nucleus; attpr mutants contain approximately 8 times as much polyA RNA in nuclear RNA extracts as wild type and approximately 3 times more in total RNA extracts. Thus AtTPR is required for efficient transport of polyA RNA out of the nucleus. Microarray analysis suggests that AtTPR is likely to have a relatively general role in polyA RNA transport. Despite the large increase in nuclear polyA RNA in attpr mutants, we did not observe dramatically higher levels of individual transcripts in attpr nuclear RNA when compared to attpr total RNA. This result is consistent with attpr mutants causing a relatively uniform effect on accumulation of mRNAs in the nucleus. It is also interesting to note that the composition of the total and nuclear RNA pools is relatively similar in wild type as well. This suggests that the nuclear retention or exclusion of transcripts may not be a prevalent mechanism of translational gene regulation in Arabidopsis.

In addition to attpr, a number of other mutations that affect nuclear pore components or nuclear pore trafficking proteins have been recently identified in genetic screens. For example, sar3 mutants were identified in screens for restored auxin sensitivity in an auxin-resistant axr1 background, whereas hst mutants show an accelerated juvenile to adult transition. Although they have been identified on the basis of different phenotypes, both sar3 and hst share phenotypes with attpr; both are early flowering, show reduced fertility and plant stature, and sar3 has been shown to accumulate polyA RNA in the nucleus. To determine if the various phenotypes of these mutants are specific to particular nuclear-pore-associated proteins or are indicative of a general compromise in nuclear pore function, we investigated the effect of attpr on other phenotypes that have been reported for sar3 and hst mutants. Interestingly, the effect of the attpr mutant on small RNA abundance is similar to that reported for hst mutants, and, similar to sar3, attpr mutants also restore auxin sensitivity in an axr1-mutant background. In addition, sar3 also strongly suppresses the late-flowering phenotype of FRI (although not as strongly as attpr). Taken together, these data indicate that attpr, sar3, and hst have a number of similar effects on development and that early flowering, alterations in auxin sensitivity and RNA levels may be general phenotypes associated with impaired nuclear pore function. It should be noted, however, that although the phenotypes of these mutants are similar, they are not identical. Therefore, it appears that these nuclear-pore-associated proteins may play related, as well as independent, roles in plant development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Materials and Growth Conditions

FRI Col (Lee et al., 1994Go), ld-1 (Redei, 1962Go), flc-3 (Michaels and Amasino, 1999Go), fld-3 (He et al., 2003Go), axr1-3 (Lincoln et al., 1990Go), and sar3-1 (Parry et al., 2006Go) have been described previously. Plants were grown at 22°C under cool-white fluorescent lights for both long (16 h light/8 h dark) and short (8 h light/16 h dark) days. For vernalization treatment, seeds were plated on agar-solidified medium containing 0.5x Murashige and Skoog salts (Murashige and Skoog, 1962Go) and cold treated at 4°C for 30 d. Following cold treatment, seedlings were grown for 14 d under standard long-day conditions prior to tissue harvest.


Gene Expression Analysis

RT-PCR analysis was performed as described previously (Michaels et al., 2004Go). Primers used for detection of FLC, SOC1, UBIQUITIN (UBQ), FT, and TSF have been described previously (Michaels et al., 2004Go, 2005Go). Number of cycles performed is as follows, FLC and UBQ (26), SOC1 (31), FT (42), and TSF (34). Data shown is representative of a minimum of three replicates. Small RNA-blot analysis was performed as described previously (Aukerman and Sakai, 2003Go); sequences for probes were as follows: miR157 (5'gtgctctctatcttctgtca3'), miR159 (5'tagagctcccttcaatccaaa3'), miR165 (5'gggggatgaagcctggtccga3'), miR167 (5'tagatcatgctggcagcttca3'), miR172 (5'ctgcagcatctacaagattct3'), miR393 (5'gatcaatgcgatccctttgga3'), ASRP225 (5'tacgctatgttggacttagtt3'), and ASRP1511 (5'aagtatcatcattcgcttgga3'). Other RNA-blot analysis was performed using standard methods (Sambrook et al., 1989Go). DNA for probes was PCR amplified from genomic DNA using primers directed to the translational start and stop sites and radiolabeled using the Prime-a-Gene labeling system (Promega). Whole-mount in situ hybridization (Parry et al., 2006Go) and GUS staining (Schomburg et al., 2001Go) were performed as described previously. Nuclear RNA was isolated as described previously (Park et al., 2005Go).


Scanning Electron Microscopy

Briefly, samples were fixed overnight in 3.0% glutaraldehyde in 0.05 M sodium phosphate buffer pH 6.8 at 4°C, washed four times in 0.05 M sodium phosphate buffer, and treated with 1% osmium tetroxide for 90 min. Samples were then dehydrated in an ethanol series and critical point dried. Following drying, samples were mounted on aluminum stubs and sputter coated. Samples were then examined in a JEOL 5800LV scanning electron microscope.


Microarray Analysis

Affymetrix ATH1 Genome Arrays were used for microarray analysis. Labeling, hybridization, and scanning were performed according to manufacturer's instructions.


Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Alignment of AtTPR and human TPR proteins.
Supplemental Figure S2. Analysis of RNA processing in the attpr mutant.
Supplemental Array Data S1. Microarray analysis of total and nuclear RNA.

Received April 7, 2007; accepted May 16, 2007; published May 25, 2007.


    FOOTNOTES
 
1 This work was supported by the National Science Foundation (grant no. IOB–0447583 to S.D.M.) and the National Institutes of Health (grant no. 1R01GM075060–01 to S.D.M.). Back

2 These authors contributed equally to the article. Back

3 Present address: Department of Genetics, Kasetsart University, Ladyow Chatuchak, Bangkok 10900, Thailand. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Scott D. Michaels (michaels{at}indiana.edu).

[C] Some figures in this article are displayed in color online but in black and white in the print edition. Back

[W] The online version of this article contains Web-only data. Back

[OA] Open Access articles can be viewed online without a subscription. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.107.100735

* Corresponding author; e-mail michaels{at}indiana.edu; fax 812–855–6082.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657[Abstract/Free Full Text]

Aukerman MJ, Sakai H (2003) Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes. Plant Cell 15: 2730–2741[Abstract/Free Full Text]

Bangs PL, Sparks CA, Odgren PR, Fey EG (1996) Product of the oncogene-activating gene Tpr is a phosphorylated protein of the nuclear pore complex. J Cell Biochem 61: 48–60[CrossRef][Web of Science][Medline]

Bezerra IC, Michaels SD, Schomburg FM, Amasino RM (2004) Lesions in the mRNA cap-binding gene ABA HYPERSENSITIVE 1 suppress FRIGIDA-mediated delayed flowering in Arabidopsis. Plant J 40: 112–119[CrossRef][Web of Science][Medline]

Bollman KM, Aukerman MJ, Park MY, Hunter C, Berardini TZ, Poethig RS (2003) HASTY, the Arabidopsis ortholog of EXPORTIN 5/MSN5, regulates phase change and morphogenesis. Development 130: 1493–1504[Abstract/Free Full Text]

Boss PK, Bastow RM, Mylne JS, Dean C (2004) Multiple pathways in the decision to flower: enabling, promoting, and resetting. Plant Cell (Suppl) 16: S18–31

Cheng H, Dufu K, Lee CS, Hsu JL, Dias A, Reed R (2006) Human mRNA export machinery recruited to the 5' end of mRNA. Cell 127: 1389–1400[CrossRef][Web of Science][Medline]

Dong CH, Hu X, Tang W, Zheng X, Kim YS, Lee BH, Zhu JK (2006) A putative Arabidopsis nucleoporin, AtNUP160, is critical for RNA export and required for plant tolerance to cold stress. Mol Cell Biol 26: 9533–9543[Abstract/Free Full Text]

Galy V, Gadal O, Fromont-Racine M, Romano A, Jacquier A, Nehrbass U (2004) Nuclear retention of unspliced mRNAs in yeast is mediated by perinuclear Mlp1. Cell 116: 63–73[CrossRef][Web of Science][Medline]

Green DM, Johnson CP, Hagan H, Corbett AH (2003) The C-terminal domain of myosin-like protein 1 (Mlp1p) is a docking site for heterogeneous nuclear ribonucleoproteins that are required for mRNA export. Proc Natl Acad Sci USA 100: 1010–1015[Abstract/Free Full Text]

He Y, Michaels SD, Amasino RM (2003) Regulation of flowering time by histone acetylation in Arabidopsis. Science 302: 1751–1754[Abstract/Free Full Text]

Hugouvieux V, Kwak JM, Schroeder JI (2001) An mRNA cap binding protein, ABH1, modulates early abscisic acid signal transduction in Arabidopsis. Cell 106: 477–487[CrossRef][Web of Science][Medline]

Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5: 387–405[CrossRef]

Kolling R, Nguyen T, Chen EY, Botstein D (1993) A new yeast gene with a myosin-like heptad repeat structure. Mol Gen Genet 237: 359–369[Web of Science][Medline]

Krull S, Thyberg J, Bjorkroth B, Rackwitz HR, Cordes VC (2004) Nucleoporins as components of the nuclear pore complex core structure and Tpr as the architectural element of the nuclear basket. Mol Biol Cell 15: 4261–4277[Abstract/Free Full Text]

Lee I, Aukerman MJ, Gore SL, Lohman KN, Michaels SD, Weaver LM, John MC, Feldmann KA, Amasino RM (1994) Isolation of LUMINIDEPENDENS—a gene involved in the control of flowering time in Arabidopsis. Plant Cell 6: 75–83[Abstract]

Lee I, Michaels SD, Masshardt AS, Amasino RM (1994) The late-flowering phenotype of FRIGIDA and LUMINIDEPENDENS is suppressed in the Landsberg erecta strain of Arabidopsis. Plant J 6: 903–909[CrossRef][Web of Science]

Lincoln C, Britton JH, Estelle M (1990) Growth and development of the axr1 mutants of Arabidopsis. Plant Cell 2: 1071–1080[Abstract/Free Full Text]

Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J 8: 457–463[CrossRef][Web of Science][Medline]

Michaels SD, Amasino RM (1999) FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell 11: 949–956[Abstract/Free Full Text]

Michaels SD, Amasino RM (2001) Loss of FLOWERING LOCUS C activity eliminates the late-flowering phenotype of FRIGIDA and autonomous-pathway mutations but not responsiveness to vernalization. Plant Cell 13: 935–942[Abstract/Free Full Text]

Michaels SD, Bezerra IC, Amasino RM (2004) FRIGIDA-related genes are required for the winter-annual habit in Arabidopsis. Proc Natl Acad Sci USA 101: 3281–3285[Abstract/Free Full Text]

Michaels SD, Himelblau E, Kim SY, Schomburg FM, Amasino RM (2005) Integration of flowering signals in winter-annual Arabidopsis. Plant Physiol 137: 149–156[Abstract/Free Full Text]

Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol Plant 15: 473–497[CrossRef]

Park MY, Wu G, Gonzalez-Sulser A, Vaucheret H, Poethig RS (2005) Nuclear processing and export of microRNAs in Arabidopsis. Proc Natl Acad Sci USA 102: 3691–3696[Abstract/Free Full Text]

Parry G, Ward S, Cernac A, Dharmasiri S, Estelle M (2006) The Arabidopsis SUPPRESSOR OF AUXIN RESISTANCE proteins are nucleoporins with an important role in hormone signaling and development. Plant Cell 18: 1590–1603[Abstract/Free Full Text]

Qi H, Rath U, Wang D, Xu YZ, Ding Y, Zhang W, Blacketer MJ, Paddy MR, Girton J, Johansen J, et al (2004) Megator, an essential coiled-coil protein that localizes to the putative spindle matrix during mitosis in Drosophila. Mol Biol Cell 15: 4854–4865[Abstract/Free Full Text]

Redei GP (1962) Supervital mutants in Arabidopsis. Genetics 47: 443–460[Free Full Text]

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Schomburg FM, Patton DA, Meinke DW, Amasino RM (2001) FPA, a gene involved in floral induction in Arabidopsis, encodes a protein containing RNA-recognition motifs. Plant Cell 13: 1427–1436[Abstract/Free Full Text]

Sheldon CC, Burn JE, Perez PP, Metzger J, Edwards JA, Peacock WJ, Dennis ES (1999) The FLF MADS box gene: a repressor of flowering in Arabidopsis regulated by vernalization and methylation. Plant Cell 11: 445–458[Abstract/Free Full Text]

Strambio-de-Castillia C, Blobel G, Rout MP (1999) Proteins connecting the nuclear pore complex with the nuclear interior. J Cell Biol 144: 839–855[Abstract/Free Full Text]

Sung S, Amasino RM (2005) Remembering winter: toward a molecular understanding of vernalization. Annu Rev Plant Biol 56: 491–508[CrossRef][Medline]

Telfer A, Poethig RS (1998) HASTY: a gene that regulates the timing of shoot maturation in Arabidopsis thaliana. Development 125: 1889–1898[Abstract]

Tran EJ, Wente SR (2006) Dynamic nuclear pore complexes: life on the edge. Cell 125: 1041–1053[CrossRef][Web of Science][Medline]

Weigel D, Ahn JH, Blazquez MA, Borevitz JO, Christensen SK, Fankhauser C, Ferrandiz C, Kardailsky I, Malancharuvil EJ, Neff MM, et al (2000) Activation tagging in Arabidopsis. Plant Physiol 122: 1003–1013[Abstract/Free Full Text]


Related articles in Plant Physiol.:

On the Inside
Peter V. Minorsky
Plant Physiol. 2007 144: 1235-1236. [Full Text]  



This article has been cited by other articles:


Home page
Plant Physiol.Home page
N. Geraldo, I. Baurle, S.-i. Kidou, X. Hu, and C. Dean
FRIGIDA Delays Flowering in Arabidopsis via a Cotranscriptional Mechanism Involving Direct Interaction with the Nuclear Cap-Binding Complex
Plant Physiology, July 1, 2009; 150(3): 1611 - 1618.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
Y. Lee, H.-S. Lee, J.-S. Lee, S.-K. Kim, and S.-H. Kim
Hormone- and light-regulated nucleocytoplasmic transport in plants: current status
J. Exp. Bot., September 1, 2008; 59(12): 3229 - 3245.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
Compiled by, F. Tooke, T. Chiurugwi, and N. Battey
Flowering Newsletter bibliography for 2007
J. Exp. Bot., July 18, 2008; (2008) ern109v1.
[Full Text] [PDF]


Home page
Plant Physiol.Home page
K. M. Veley and S. D. Michaels
Functional Redundancy and New Roles for Genes of the Autonomous Floral-Promotion Pathway
Plant Physiology, June 1, 2008; 147(2): 682 - 695.
[Abstract] [Full Text] [PDF]


This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrowOA All Versions of this Article:
144/3/1383    most recent
pp.107.100735v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Plant Physiol.
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jacob, Y.
Right arrow Articles by Michaels, S. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jacob, Y.
Right arrow Articles by Michaels, S. D.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Agricola
Right arrow Articles by Jacob, Y.
Right arrow Articles by Michaels, S. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2007 by the American Society of Plant Biologists