| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online April 27, 2007; 10.1104/pp.107.100172 Plant Physiology 144:1429-1441 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Identification of a Novel Chloroplast Protein AtNYE1 Regulating Chlorophyll Degradation during Leaf Senescence in Arabidopsis1,[C],[W],[OA]State Key Laboratory of Genetic Engineering, Department of Biochemistry, School of Life Sciences, Fudan University, Shanghai 200433, China
A dramatic increase of chlorophyll (Chl) degradation occurs during senescence of vegetative plant organs and fruit ripening. Although the biochemical pathway of Chl degradation has long been proposed, little is known about its regulatory mechanism. Identification of Chl degradation-disturbed mutants and subsequently isolation of responsible genes would greatly facilitate the elucidation of the regulation of Chl degradation. Here, we describe a nonyellowing mutant of Arabidopsis (Arabidopsis thaliana), nye1-1, in which 50% Chl was retained, compared to less than 10% in the wild type (Columbia-0), at the end of a 6-d dark incubation. Nevertheless, neither photosynthesis- nor senescence-associated process was significantly affected in nye1-1. Characteristically, a significant reduction in pheophorbide a oxygenase activity was detected in nye1-1. However, no detectable accumulation of either chlorophyllide a or pheophorbide a was observed. Reciprocal crossings revealed that the mutant phenotype was caused by a monogenic semidominant nuclear mutation. We have identified AtNYE1 by positional cloning. Dozens of its putative orthologs, predominantly appearing in higher plant species, were identified, some of which have been associated with Chl degradation in a few crop species. Quantitative polymerase chain reaction analysis showed that AtNYE1 was drastically induced by senescence signals. Constitutive overexpression of AtNYE1 could result in either pale-yellow true leaves or even albino seedlings. These results collectively indicate that NYE1 plays an important regulatory role in Chl degradation during senescence by modulating pheophorbide a oxygenase activity.
Ever since the nonyellowing mutant was identified, chlorophyll (Chl) catabolism has been known as a separable event from other senescence processes in senescing vegetative plant organs and ripening fruits (Thomas and Stoddart, 1975  ; Thomas and Howarth, 2000). Extensive chemical and biochemical analyses have led to the construction of a major Chl catabolism pathway, i.e. pheophorbide a oxygenase (PaO) pathway (Hörtensteiner, 2006; Tanaka and Tanaka, 2006). However, very little is known about its regulation. According to the proposed pathway, phytol and magnesium (Mg) are first removed from Chl a by chlorophyllase (Chlase) and a putative Mg-dechelatase or Mg-dechelating substance, respectively, and the resultant pheophorbide a (Pheide a) is then converted to the primary fluorescent Chl catabolites (pFCCs) through the sequential functioning of two enzymes: PaO and red Chl catabolite reductase (RCCR). The pFCC is subsequently transported out of the chloroplast and converted to the colorless nonfluorescent Chl catabolites in the vacuole. Chl b is proposed to be transformed to Chl a with a two-step reduction, catalyzed by Chl b and 71-OH-Chl a reductases, respectively, before being further degraded (Tanaka and Tanaka, 2006). Over the past few years, the identification of genes encoding key enzymes, including CLHs (for chlorophyll-chlorophyllido hydrolases), PaO, and RCCR, offered a possibility of exploring the regulation of Chl catabolism (Gray et al., 1997; Jacob-Wilk et al., 1999; Tsuchiya et al., 1999; Wüthrich et al., 2000; Pru inská et al., 2003). Of the three genes identified, PaO is thus far shown to have a regulatory effect on Chl degradation (Pruinská et al., 2003; Pruinská et al., 2005; Chung et al., 2006). Nevertheless, a mutation in PaO or even a down-regulation of PaO expression may cause a lesion mimic phenotype, a reaction resembling the hypersensitive response induced by pathogens.
An alternative way to explore the regulatory mechanism of Chl catabolism is to identify genes directly regulating Chl degradation during senescence through forward genetics. Mutants, with Chl degradation being disturbed but other senescence-associated processes not being significantly affected, have been reported in diversified species (Thomas and Stoddart, 1975 Here we report the isolation of a nonyellowing mutant (nye1-1) from a fast-neutron mutagenized M2 population of Arabidopsis (Arabidopsis thaliana). It was shown that the mutation primarily affected Chl catabolism, mainly by reducing PaO activity, during senescence. However, no detectable accumulation of major Chl degradation intermediates was observed in nye1-1. We isolated the causal gene AtNYE1 by positional cloning and confirmed its identity by genomic complementation. Overexpression of AtNYE1 may cause either pale-yellow true leaves or even albino seedlings.
Isolation and Phenotypic Characterization of nye1-1 To explore the regulatory mechanism of Chl degradation during leaf senescence, a nonyellowing mutant was identified from the M2 population of fast-neutron mutagenized Arabidopsis (Columbia-0 [Col-0]). It was subsequently backcrossed with Col-0 four times and designated as nye1-1 (nonyellowing). The nye1-1 mutant exhibited a stable nonyellowing phenotype during both natural and dark-induced senescence of leaves either attached, detached, or in planta (Figs. 1, A–D , and 2A). Its siliques also stayed lightly green at harvesting time (Supplemental Fig. S1). In all the follow-up experiments, incubating detached leaves in darkness was therefore adopted constantly as the simplest way to identify the mutation phenotype. Under long-day (16-h light/8-h dark) growth condition, an approximately 9-d delayed bolting and a slightly prolonged flowering period were observed in nye1-1, as compared with Col-0 (Fig. 1F). No other significant morphological differences were observed between nye1-1 and Col-0, and the etiolation/deetiolation behavior was not altered either (data not shown).
In reciprocal crosses with the wild types of both the Col-0 and Landsberg erecta (Ler), all the leaves of F1 plants showed a partially stay-green phenotype after 4-d dark treatment (Fig. 2A ). Total Chl content of F1 plants was significantly higher (P < 0.01) than that of wild-type plants after 4-d dark treatment and lower (P < 0.01) than that of mutants (Fig. 2B). A statistical 1:2:1 segregation ratio was detected in the F2 population (backcrossed to Col-0; 44 wild-type phenotype:64 mutant phenotype:131 intermediate phenotype;  2 = 5.56, P = 0.062 > 0.05), and a consistent result was also observed in the F2 population of crosses to Ler (data not shown). Thus, we concluded that the mutant phenotype was caused by a monogenic semidominant nuclear mutation.
To detect the lesion step of Chl degradation, total pigments were extracted from the leaves of nye1-1 as well as Col-0, and initially quantified by spectrophotometry. Over the course of a 6-d dark treatment, the Chl content declined dramatically in the leaves of Col-0, down to approximately 10% of that in the untreated leaves by the end of the treatment. By contrast, the Chl content in nye1-1 dropped much more slowly, 50% of that in the untreated leaves being retained at day 6 (Fig. 1E). The result was further validated by HPLC analysis (data not shown). However, no significant accumulation of either chlorophyllide a (Chlide a) or Pheide a was observed either in nye1-1 or in Col-0 in the chromatogram assay, although trace levels of the above catabolites were detected in both of the genotypes after 0-, 2-, and 4-d dark treatment (Fig. 3
indicates representative data of 4-d samples). To gain insight into the mechanism of the delayed Chl degradation, time-course changes in the transcript levels of AtCLH1, PaO, and RCCR were examined during dark treatment and no differences were detected either between the two genotypes (Fig. 4
). Nevertheless, subsequent analyses of in vivo key enzyme activities known for green pigment degradation revealed that the function of PaO in nye1-1 was somehow reduced, while Chlase remained fully competent (Fig. 5, A and B
). pFCC-1 was hardly detected at 0 d after darkness in both nye1-1 and Col-0 in a coupled PaO-RCCR enzymatic assay. The PaO activity in nye1-1, although also dramatically induced, was significantly lower (20% to approximately 50% residual activity relative to that in Col-0 in repeated experiments) than that in Col-0 (Fig. 5B; Table I
). A crossover experiment (Roca et al., 2004
Photosynthesis- and Senescence-Associated Processes Largely Unaffected in the Leaves of nye1-1
To elucidate the possible relationship of the nonyellowing mutation with photosynthesis, the photosynthetic capacity was initially examined in both genotypes. Compared with that in Col-0, a substantially identical changing pattern of the net photosynthetic rate in the fourth to sixth leaves was observed in nye1-1 in a time-course monitoring experiment. The photosynthetic rates started to decline slightly 15 d after emergence (DAE), dramatically 21 DAE and sharply 27 DAE in the leaves of both genotypes (Fig. 6A
). To explore the relationship further, the transcriptions of two photosynthesis-associated genes, Chl a/b-binding (CAB) protein gene and ribulose bisphosphate carboxylase/oxygenase small subunit (RBCS) gene, were examined by quantitative PCR (qPCR). The transcript levels of CAB declined sharply during dark-induced senescence, but indistinguishably between nye1-1 and Col-0 (Fig. 6B). The transcript levels of RBCS also declined rapidly in Col-0, but less dramatically in nye1-1 (Fig. 6C). To determine whether senescence processes are affected by the mutation, the transcript levels of two well-characterized senescence-associated genes, SEN1 and SAG12, were examined in both nye1-1 and Col-0. Increased abundances of both SEN1 and SAG12 transcripts were detected in both the genotypes after a 2-d dark treatment in a similar way (Fig. 6, D and E). These results indicated that neither photosynthesis- nor senescence-associated processes were significantly affected by the mutation. The nye1-1 could therefore be classified as a nonfunctional (type C) stay-green mutant (Thomas and Howarth, 2000
Mapping and Isolation of AtNYE1 Twenty-two simple sequence length polymorphic (SSLP) markers (http://www.arabidopsis.org), distributed evenly on five chromosomes, were employed to map NYE1 locus, with a mixed DNA sample extracted separately from 100 homozygous individuals identified from an F2 population derived from a cross with wild-type Ler. The locus was roughly located between F7J7 and F10N7, with an interval of approximately 8.0 cM on the long arm of chromosome IV. New SSLP markers within this region were generated to narrow down the interval. With a mapping population of 828 plants, the locus was further located between T12H17 and F7H19, with an interval of 0.5 cM (Fig. 7 ).
Sequencing the middle region of approximately 40 kb within this interval led to the identification of a single base pair change, an A to T substitution, at position 29 of the first exon in the open reading frame (ORF) of at4g22920. This mutation converts the 10th Leu to a stop codon, which leads to an early termination of the translation. The at4g22920 was therefore tentatively designated as AtNYE1.
A 4.1-kb PstI-BamHI genomic fragment, containing AtNYE1 as well as its 1.9 kb upstream and 1.0 kb downstream sequences, was amplified and constructed into pPZP221 (Hajdukiewicz et al., 1994
Overexpression of AtNYE1 Caused Precocious Chl Degradation To examine its capacity in regulating Chl degradation, we expressed AtNYE1, driven by cauliflower mosaic virus 35S promoter, in nye1-1. Fifty transgenic seedlings were obtained in the first batch. Of them, 21 developed normally, 11 showed pale-yellow true leaves displaying varied degrees of degreening, and the rest (18) exhibited albino phenotype (Fig. 9, A and B ). The severity of the degreening in the AtNYE1 overexpressors was not only reflected on retardation to their growth and development but also well correlated with the expression level of AtNYE1 (Fig. 9C). In addition, we also detected that PaO expression was not induced in these overexpression lines (Fig. 9C), indicating that a higher expression of AtNYE1 is sufficient to induce Chl degradation, provided that there is a basal level of PaO expression.
AtNYE1 Gene Encodes a Novel Protein Highly Conserved in Plants
AtNYE1 encodes a 268-amino acid protein with an apparent molecular mass of 30 kD and a theoretical pI of 8.73 (Fig. 10A
). ChloroP analysis (http://www.cbs.dtu.dk/services/ChloroP/; Emanuelsson et al., 1999
Searching of the GenBank database (http://www.ncbi.nlm.nih.gov/BLAST) and The Institute of Genomic Research plant genome database (http://www.tigr.org/plantProjects.shtml) revealed dozens of ESTs that are highly homologous to AtNYE1 in diversified species of angiosperms and gymnosperms, but not in yeast (Saccharomyces cerevisiae) and animals (Fig. 10A). Putative genes that encode proteins showing weak similarities to AtNYE1 are also present in a green algae, Ostreococcus tauri (CAL56489), and some bacterial species (ZP_01170511.1 of Bacillus sp., NP_563502 of Clostridium perfringens, and NP_350006 of Clostridium acetobutylicum; data not shown). An EST clone (AV618908) in Chlamydomonas reinhardtii and several ribonuclease II family proteins in some Cyanobacteria species, showing very low similarities to AtNYE1 though, were also revealed in the C. reinhardtii ESTs and Cyanobacteria databases (http://www.kazusa.or.jp/en/plant/database.html). Even though highly conserved among higher plants, domain sequences hardly provide any cues about its possible biochemical roles. However, a variety of potential modifications are suggested by the presence of three N-glycosylation sites, four protein kinase C phosphorylation sites, three casein kinase II phosphorylation sites, and an N-myristoylation site (Bairoch et al., 1997 ). Twelve sequences from eight representative plant species, corresponding to the amino acids between 78 and 211 in AtNYE1, were adopted to construct a phylogenetic tree (Fig. 10B). The angiosperms-gymnosperms divergence and monocot-dicot divergence were well reflected on the tree. Furthermore, our data also suggest that the divergence of family members within a species is posterior to the divergence of species.
To verify the prediction that AtNYE1 was likely targeted to the chloroplast, its C terminus was fused to enhanced yellow fluorescent protein (eYFP) and the resultant fusion protein was introduced into nye1-1. Transgenic plants expressing the AtNYE1-eYFP fusion protein driven by the 35S promoter also could result in albino seedlings or pale-yellow true leaves (data not shown), suggesting that the AtNYE1-eYFP fusion protein was functioning properly. Expectedly, eYFP fluorescence in albino seedlings was predominantly observed in chloroplast (Fig. 11 ), while it was hardly detected in those phenotypically normal transgenic plants (data not shown). By comparison, eYFP in the 35S-eYFP control plants was present in both cytoplasm and nucleus (Fig. 11). These data confirm that AtNYE1 is localized in chloroplast.
Spatial and Temporal Transcriptions of AtNYE1
In attempt to elucidate its physiological function in Arabidopsis, relative transcriptions of AtNYE1 in different organs and in leaves at various developmental stages were determined by real-time PCR. The transcript of AtNYE1 was detected in all the organs examined, with relatively higher levels being detected in flowers and buds, medium to low levels in siliques, and the lowest in roots, seedlings, and young rosette leaves (Fig. 12A
). As expected, AtNYE1 was strongly induced by dark treatment or natural senescence (Fig. 12, B and C; Guo et al., 2004
NYE1 Is a Key Regulator Directly Associated with Chl Degradation during Organ Senescence or Maturation
Recent studies showed that alterations in the sequences of AtNYE1 orthologs were associated with stay-green phenotypes in various crop species. In rice, a missense mutation was identified in its putative ortholog (SGR) through mapping a stay-green locus (Cha et al., 2002
RNA interference and overexpression have been adopted to analyze the regulatory role of AtNYE1 on Chl degradation in Arabidopsis. In RNA interference plants, Chl degradation was delayed significantly during dark-induced senescence (L. Yang and B. Kuai, unpublished data; Armstead et al., 2007
In a series of related studies, Chl degradation is also found to be affected by plant hormones, such as cytokinin and ethylene. However, this kind of effect is mainly considered an indirect consequence of altered senescence (Smart, 1994
Although highly conserved domains are present in its putative orthologs of various plant species, no informative implications about the molecular and biochemical roles of NYE1 have been revealed by any of the available bioinformatical analyses. Nevertheless, experimentally examining (chemical, biochemical, and molecular) parameters associated to green pigment (Chl, Chlide, and Pheide) breakdown in nye1-1 demonstrated that PaO activity was greatly reduced, with an estimated reduction of about 50% to approximately 80%. This detection is in accordance with that observed in Bf993 of F. pratensis (Vicentini et al., 1995
On the other hand, Chl in NYE1 mutants was still being degraded upon dark incubation, even in the null mutant nye1-1, indicating that there might exist a paralog, less efficient though, of NYE1, or even an alternative Chl degradation pathway. Our HPLC analysis data, along with Roca's (Roca et al., 2004
It has been reported that the growth and productivity of stay-green plants of Lolium prenne, with the putative NYE1 mutant ortholog introgressed from Bf993, are significantly reduced compared to wild-type plants under conditions of extreme nitrogen (N) limitation, and the extra retention of leaf N in its senescing leaves contributes a functionally significant proportion of the total N content of the plant with respect to growth potential (Macduff et al., 2002 In conclusion, NYE1 has been convincingly identified as a key and direct regulator of Chl degradation during senescence, probably by modulating PaO activity. The successful identification of NYE1 mutation in Arabidopsis would not only provide an efficient system to analyze its molecular and biochemical roles, but also greatly facilitate further exploration for the regulatory mechanism of Chl degradation in general.
Plant Materials and Growth Conditions
All the wild-type and mutant Arabidopsis (Arabidopsis thaliana) lines used in this study are in the Col-0 background unless indicated otherwise. Seeds were sown in square pots (10 cm in length) with soil (v [peat soil]:v [vermiculite]:v [pearlite] = 3:9:0.5; Shanghai Institute of Landscape Science) presoaked with plant nutrient medium including 0.5% Suc (Estelle and Somerville, 1987 For dark treatment, leaves 4 to 6, or whole plants without roots, from 3- to 4-week-old Arabidopsis plants were excised and incubated on wet filter paper in total darkness at 25°C for various periods, as indicated. For the dark treatment of whole plants in soil, trays were covered with black bags and incubated in growth room for a period of time as indicated.
The fast-neutron mutagenized M2 seeds in Col-0 genetic background were purchased from Lehle Seeds (Round Rock). About 50,000 3-week-old M2 plants were incubated in darkness for 6 d to screen mutants with delayed Chl loss. The putative screened mutants were subjected to further confirmation for a couple of times during the remaining growth period by visually checking the phenotypes of their detached leaves incubated in permanent darkness for 4 to 6 d. A stable nonyellowing mutant, without obvious pleiotropic effects, was finally identified and designated as nye1-1. It was then backcrossed with the wild-type Col-0 four times, and the resulting homozygous nye1-1 plants were used for further analysis.
For genetic analysis of the mutation, nye1-1 plants were crossed with the wild-type Col-0 as well as Ler plants reciprocally, and the resulting F1 seedlings were allowed to self-pollinate to produce F2 populations. Phenotypes of F1 and F2 were visually classified and scored as mutant, intermediate, or wild type.
Mapping procedure was performed as described by Lukowitz and Jander (Lukowitz et al., 2000
Plasmid Construction
For the genomic complementation test, a 4.1-kb DNA fragment containing the predicted ORF as well as 1.9 kb promoter region and 1.0 kb downstream sequence was amplified from the wild type by PCR using two oligonucleotides, 5' CACGGATCCAACAAGATCTAACCCTTTTG 3' and 5' CAGCTGCAGTGGAGGTGACAGGAGG 3' (the lowercase c is an introduced mismatch to create restriction site, underlined). The fragment was subcloned into PstI and BamHI sites of pPZP221 (Hajdukiewicz et al., 1994
For subcellular localization test, the eYFP coding region (Ge et al., 2005
For overexpression of AtNYE1, the full-length coding region (807 bp) was amplified with a pair of primers 5' CATGGTACCATGTGTAGTTTGTCGGCGATTATG 3' (the underlined sequence is a KpnI site) and 5' CATGGATCCCTAGAGTTTCTCCGGATTTGGAG 3' (the underlined sequence is a BamHI site). The PCR products were cloned into pMD 19-T vector and sequenced. After digesting with KpnI and BamHI, the releasing fragment was subcloned into pCHF3 binary vector (Ge et al., 2005
The above constructs were introduced into the Agrobacterium tumefaciens strain LBA4404. Plants were transformed via the floral-dipping method (Clough and Bent, 1998
Excised leaves were mounted on glass with a drop of water and then covered with coverslips. They were examined by confocal microscopy using a LSM 510 laser scanning confocal microscope (ZEISS) with a 40x oil immersion objective. Chl autofluorescence and YFP signal were sequentially excited by switching between the 488- and 514-nm laser lines, respectively. The fluorescence emission was selected by a band pass filter (BP530–600) for eYFP and a long pass filter (LP560) for Chl fluorescence. Recorded images from the microscopes were processed with Adobe Photoshop (Adobe Systems).
Total RNA was extracted from control and dark-treated leaves of Col-0 using Trizol Reagent (Invitrogen), followed by chloroform extraction, isopropanol precipitation, and spectrophotometric quantification. After digestion with Rnase-free DNase (Promega), 2 µg total RNA was reverse transcribed with the Superscript reverse transcriptase (Shenenergy Biocolor). The products were subsequently used as templates for real-time PCR analysis. The real-time PCR was performed using SYBR Green I PCR kit (Toyobo) on an iCycler according to the manufacturer's suggestions, with ACT2 as a reference (Bio-Rad). Specific primers to respective genes were as follows: ACT2 (forward, 5'-CGCTCTTTCTTTCCAAGCTC-3' and reverse, 5'-AACAGCCCTGGGAGCATC-3'); AtNYE1 (forward, 5'-GCAAGGATGGGCAAATAGG-3' and reverse, 5'-CACCGCTTATGTGACAATGAAC-3'); SAG12 (forward, 5'-TGGATACGGCGAATCTACTAACG-3' and reverse, 5'- GCTTTCATGGCAAGACCACATAG-3'); SEN1 (forward, 5'-GTCATCGGCTATTTCTCCACCT-3' and reverse, 5'-GTTGTCGTTGCTTTCCTCCATC-3'); CAB (forward, 5'-CCAGAGGCATTCGCTGAGTTG-3' and reverse, 5'-CCTTACCAGTGACGATGGCTTG-3'); RBCS (forward, 5'-CCACCCGCAAGGCTAACAAC-3' and reverse, 5'-TTCGGAATCGGTAAGGTCAGG-3'); PaO (forward, 5'-GAAAATGGTTGGGATAGAGC-3' and reverse, 5'-TGGGTTGGAGTGAATGTGAG-3'); ATCLH1 (forward, 5'-GGCATCGGAAAACCTCAA-3' and reverse, 5'-ATCTCCGCTTTTTCACCC-3'); RCCR (forward, 5'-CATGGAAGACCACGACGATCA-3' and reverse, 5'-GGAGGGAGGTTACAGGGAAGG-3').
Net photosynthetic rate was measured using LI-6400 (LI-COR) under a fixed LED light source (500 µmol m–2 s–1) at 25°C, as described in the manufacturer's instruction.
For pigment quantification, leaves 4 to 6 (about 0.1 g fresh weight) from 3- to 4-week-old plants were taken. After dark treatment, excised leaves were immediately frozen in liquid N and stored at –80°C. Chl contents were quantified by spectrometer according to Benedetti and Arruda (Benedetti and Arruda, 2002
Standard Chl a was purchased from Sigma and Pheide a from Wako Chemicals. Chlide a was prepared by digesting Chl a with Chlase, as described by Fang (Fang et al., 1998
Chlase activity was measured according to a reported protocol (Todorov et al., 2003
PaO was measured using a coupled assay with RCCR according to previous reports, with a slight modification (Hörtensteiner et al., 1995 The PaO and RCCR were prepared strictly according to the previous protocols. Soluble stroma protein (S1 fraction) was used as the source of RCCR and solubilized membrane protein in osmotic buffer (Tris-MES, pH 8.0, 0.1% bovine serum albumin) with 1% Triton X-100 used as the source of PaO. For PaO assay, the reaction mixture (50 µL) contained Pheide a (30 µg) as substrate and the ferredoxin-reduced system as cofactors: 10 µg ferredoxin (Sigma), 1 mM NADPH (Sigma), 1 mM Glc-6-P (G6P), and 10 milliunits of G6P dehydrogenase. After incubation in the dark at 25°C for 1 h, the reaction was terminated with methanol at a final concentration of 70%. After centrifugation at 14,000g for 10 min, the supernatant was analyzed for pFCC-1 by reverse-phase HPLC with 0.1 M potassium phosphate (pH 7.0)/methanol (32.5%:67.5%, V/V). HPLC analyses were performed with a Waters 2690 HPLC coupled to a Waters 2475 fluorescence detector equipped with a ZorbaxSB C-18 column (4.6 mm x 25 cm, 5-µm particle diameter). Twenty microliters were injected at a flow rate of 0.8 mL/min. Under these conditions, pFCC-1 was eluted after 5.8 min. Fluorescence was recorded at 320 nm (excitation)/450 nm (emission). The amount of pFCC-1 was given as integrated peak areas.
The GenBank accession numbers for AtNYE1 and At4g11910 are DQ437531 and DQ437532, respectively.
The following materials are available in the online version of this article.
Mutant screening was conducted at Dong Lab, Developmental, Cell and Molecular Biology group, Department of Biology, Duke University. We are grateful to Profs. X. Dong and H. Huang for their valuable advice and help. We would also like to thank Profs. J. Huang and H. Mi for the gifts of G6P and G6P dehydrogenase, Dr. T. Zhou, Mr. C. He, and Miss Z. Huang for their help in HPLC analysis, Profs. Z. Yang and Mr. Q. Shi for their help in microscopy, and Dr. L. Jiang for her help in photosynthetic rate measurement. Received March 25, 2007; accepted April 23, 2007; published April 27, 2007.
1 This work was supported by the National Science Foundation of China (grant no. 39870452).  The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Benke Kuai (bkkuai{at}fudan.edu.cn).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.100172 * Corresponding author; e-mail bkkuai{at}fudan.edu.cn; fax 86–21–65642648.
Akhtar MS, Goldschmidt EE, John I, Rodoni S, Matile P, Grierson D (1999) Altered patterns of senescence and ripening in gf, a stay-green mutant of tomato (Lycopersicon esculentum Mill.). J Exp Bot 50: 1115–1122 Almela L, Fernandez-Lopez JA, Roca MJ (2000) High-performance liquid chromatographic screening of chlorophyll derivatives produced during fruit storage. J Chromatogr A 870: 483–489[CrossRef][ISI][Medline] Armstead I, Donnison I, Aubry S, Harper J, Hörtensteiner S, James C, Mani J, Moffet M, Ougham H, Roberts L, et al (2006) From crop to model to crop: identifying the genetic basis of the staygreen mutation in the Lolium/Festuca forage and amenity grasses. New Phytol 172: 592–597[CrossRef][ISI][Medline] Armstead I, Donnison I, Aubry S, Harper J, Hörtensteiner S, James C, Mani J, Moffet M, Ougham H, Roberts L, et al (2007) Cross-species identification of Mendel's I locus. Science 315: 73 Bairoch A, Bucher P, Hofmann K (1997) The PROSITE database, its status in 1997. Nucleic Acids Res 25: 217–221 Benedetti CE, Arruda P (2002) Altering the expression of the chlorophyllase gene ATHCOR1 in transgenic Arabidopsis caused changes in the chlorophyll-to-chlorophyllide ratio. Plant Physiol 128: 1255–1263 Cha KW, Lee YJ, Koh HJ, Lee BM, Nam YW, Paek NC (2002) Isolation, characterization, and mapping of the stay green mutant in rice. Theor Appl Genet 104: 526–532[CrossRef][ISI][Medline] Chung DW, Pru Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][ISI][Medline] Efrati A, Eyal Y, Paran I (2005) Molecular mapping of the chlorophyll retainer (cl) mutation in pepper (Capsicum spp.) and screening for candidate genes using tomato ESTs homologous to structural genes of the chlorophyll catabolism pathway. Genome 48: 347–351[Medline] Emanuelsson O, Nielsen H, Von Heijne G (1999) ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci 8: 978–984[Abstract] Estelle MA, Somerville CR (1987) Auxin-resistant mutants of Arabidopsis thaliana with an altered morphology. Mol Gen Genet 206: 200–206[CrossRef][ISI] Fang ZY, Bouwkamp JC, Solomos T (1998) Chlorophyllase activities and chlorophyll degradation during leaf senescence in non-yellowing mutant and wild type of Phaseolus vulgaris L. J Exp Bot 49: 503–510 Gan S, Amasino RM (1995) Inhibition of leaf senescence by autoregulated production of cytokinin. Science 270: 1986–1988 Ge X, Dietrich C, Matsuno M, Li G, Berg H, Xia Y (2005) An Arabidopsis aspartic protease functions as an anti-cell-death component in reproduction and embryogenesis. EMBO Rep 6: 282–288[CrossRef][ISI][Medline] Gepstein S, Sabehi G, Carp MJ, Hajouj T, Nesher MFO, Yariv I, Dor C, Bassani M (2003) Large-scale identification of leaf senescence-associated genes. Plant J 36: 629–642[CrossRef][ISI][Medline] Gray J, Close PS, Briggs SP, Johal GS (1997) A novel suppressor of cell death in plants encoded by the Lls1 gene of maize. Cell 89: 25–31[CrossRef][ISI][Medline] Guiamét JJ, Teeri JA, Noodén LD (1990) Effects of nuclear and cytoplasmic genes altering chlorophyll loss on gas-exchange during monocarpic senescence in soybean. Plant Cell Physiol 31: 1123–1130 Guiamét JJ, Tyystjarvi E, Tyystjarvi T, John I, Kairavuo M, Pichersky E, Noodén LD (2002) Photoinhibition and loss of photosystem II reaction centre proteins during senescence of soybean leaves: enhancement of photoinhibition by the "stay-green" mutation cytG. Physiol Plant 115: 468–478[CrossRef][Medline] Guo Y, Cai Z, Gan S (2004) Transcriptome of Arabidopsis leaf senescence. Plant Cell Environ 27: 521–549[CrossRef] Hajdukiewicz P, Svab Z, Maliga P (1994) The small, versatile ppzp family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25: 989–994[CrossRef][ISI][Medline] Hörtensteiner S (2006) Chlorophyll degradation during senescence. Annu Rev Plant Biol 57: 55–57[CrossRef][Medline] Hörtensteiner S, Vicentini F, Matile P (1995) Chlorophyll breakdown in senescent cotyledons of rape, brassica-napus L—enzymatic cleavage of Phaeophorbide-a in-vitro. New Phytol 129: 237–246[CrossRef][ISI] Iriyama K, Ogura N, Takamiya A (1974) A simple method for extraction and partial purification of chlorophyll from plant material, using dioxane. J Biochem (Tokyo) 76: 901–904 Jacob-Wilk D, Holland D, Goldschmidt EE, Riov J, Eyal Y (1999) Chlorophyll breakdown by chlorophyllase: isolation and functional expression of the Chlase1 gene from ethylene-treated Citrus fruit and its regulation during development. Plant J 20: 653–661[CrossRef][ISI][Medline] Jander G, Norris SR, Rounsley SD, Bush DF, Levin IM, Last RL (2002) Arabidopsis map-based cloning in the post-genome era. Plant Physiol 129: 440–450 Lukowitz W, Gillmor CS, Scheible WR (2000) Positional cloning in Arabidopsis: why it feels good to have a genome initiative working for you. Plant Physiol 123: 795–805 Luquez VM, Guiamét JJ (2002) The stay green mutations d1 and d2 increase water stress susceptibility in soybeans. J Exp Bot 53: 1421–1428 Macduff J, Raistrick N, Humphreys M (2002) Differences in growth and nitrogen productivity between a stay-green genotype and a wild-type of Lolium perenne under limiting relative addition rates of nitrate supply. Physiol Plant 116: 52–61[CrossRef][Medline] Nicholas KB, Nicholas HB Jr, Deerfield DW II (1997) GeneDoc: analysis and visualization of genetic variation. EMBnet.news 4: 1–4 Oh MH, Kim JH, Moon YH, Lee CH (2004) Defects in a proteolytic step of light harvesting complex II in an Arabidopsis stay-green mutant, ore10, during dark-induced leaf senescence. J Plant Biol 47: 330–337 Oh MH, Moon YH, Lee CH (2003) Increased stability of LHCII by aggregate formation during dark-induced leaf senescence in the Arabidopsis mutant, ore10. Plant Cell Physiol 44: 1368–1377 Pru | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOP
ABSTRACT
RESULTS
