| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online May 3, 2007; 10.1104/pp.107.100305 Plant Physiology 144:1520-1530 (2007) © 2007 American Society of Plant Biologists RNA Interference Silencing of Chalcone Synthase, the First Step in the Flavonoid Biosynthesis Pathway, Leads to Parthenocarpic Tomato Fruits[C]Plant Research International, Business Unit Bioscience, 6700 AA Wageningen, The Netherlands (E.G.W.M.S., C.H.R.d.V., H.H.J., F.M.R., J.W.M., Y.M.T., G.C.A., A.G.B.); Philipps Universität Marburg, Institut für Pharmazeutische Biologie, D–35037 Marburg/Lahn, Germany (S.M.); and Keygene N.V., 6700 AE Wageningen, The Netherlands (A.J.v.T.)
Parthenocarpy, the formation of seedless fruits in the absence of functional fertilization, is a desirable trait for several important crop plants, including tomato (Solanum lycopersicum). Seedless fruits can be of great value for consumers, the processing industry, and breeding companies. In this article, we propose a novel strategy to obtain parthenocarpic tomatoes by down-regulation of the flavonoid biosynthesis pathway using RNA interference (RNAi)-mediated suppression of chalcone synthase (CHS), the first gene in the flavonoid pathway. In CHS RNAi plants, total flavonoid levels, transcript levels of both Chs1 and Chs2, as well as CHS enzyme activity were reduced by up to a few percent of the corresponding wild-type values. Surprisingly, all strong Chs-silenced tomato lines developed parthenocarpic fruits. Although a relation between flavonoids and parthenocarpic fruit development has never been described, it is well known that flavonoids are essential for pollen development and pollen tube growth and, hence, play an essential role in plant reproduction. The observed parthenocarpic fruit development appeared to be pollination dependent, and Chs RNAi fruits displayed impaired pollen tube growth. Our results lead to novel insight in the mechanisms underlying parthenocarpic fruit development. The potential of this technology for applications in plant breeding and biotechnology will be discussed.
Flavonoids are plant secondary metabolites that are widespread throughout the plant kingdom. To date, more than 6,000 flavonoids have been identified. Based on the structure of their basic skeleton, flavonoids can be divided into different classes, such as chalcones, flavonols, and anthocyanins (Fig. 1 ). In nature, flavonoids are involved in many biological processes. For example, they act as UV light scavengers to protect against oxidative damage, as antimicrobial compounds to defend against pathogens, and as pigments in fruits, flowers, and seeds, where they have a function in attracting pollinators and seed dispersers to facilitate reproduction (Koes et al., 1994  ). Flavonoids are also present in pollen and pistils of many plant species (Wiermann, 1979), and there is increasing evidence showing that flavonoids, at least in some plants, play a crucial role in fertility and sexual reproduction. For example, inhibition of flavonoid production in Petunia plants, through antisense suppression of the gene encoding chalcone synthase (CHS), the first enzyme in the flavonoid pathway (Fig. 1), resulted not only in the inhibition of flower pigmentation but also in male sterility (Van der Meer et al., 1992). Pollination experiments revealed that flavonoids in either the anther or pistil are essential for pollen tube growth, fertilization, and subsequent seed set (Ylstra et al., 1992). After cross pollination, the sterile phenotype could be partly rescued by flavonoids present in the wild-type plant. In addition, in vitro experiments showed that flavonols, in particular, kaempferol and quercetin, are essential for pollen tube germination and growth in Petunia and maize (Zea mays; Mo et al., 1992; Ylstra et al., 1992, 1996). Further evidence for a role of flavonoids in sexual reproduction is provided by the male sterile Petunia white anther (wha) mutant, which could be complemented by the introduction of a functional CHS cDNA (Napoli et al., 1999).
In addition to (male) sterility, parthenocarpy, which is defined as the formation of seedless fruits in the absence of functional fertilization (Gustafson, 1942 ; Gorguet et al., 2005), is a desirable trait for several important crop plants. The production of seedless fruits can be of great value for consumers when directly eaten but also for the processing industry. Besides this, parthenocarpy is advantageous when pollination or fertilization is affected due to extreme temperatures. Unfortunately, mutations causing parthenocarpic fruits as well as plant hormone-based approaches to obtain parthenocarpy often have pleiotropic effects and can result in undesirable characteristics, such as misshapen fruits (Varoquaux et al., 2000; Fos et al., 2001; Wang et al., 2005). To obtain more insight into the role of flavonoids in reproduction and fruit development, we have blocked flavonoid biosynthesis in tomato (Solanum lycopersicum) by RNA interference (RNAi) suppression of the gene encoding CHS. The resulting transgenic fruits showed a strong decrease of total flavonoid levels and displayed an altered color. Surprisingly, these fruits were devoid of seeds. In this article, we show that engineering of the flavonoid pathway may be a novel approach to obtain parthenocarpic tomato fruits. In addition, we present evidence for a possible mechanism and discuss potential applications of this technology.
RNAi Strategy Down-Regulates Chs Gene Expression in Tomato To down-regulate the flavonoid biosynthesis in tomato, we introduced a Chs1 RNAi gene construct (Fig. 2 ) using Agrobacterium-mediated plant transformation. This Chs RNAi construct was expressed under control of the constitutively enhanced cauliflower mosaic virus (CaMV) 35S promoter, and, therefore, it was expected that the transgene effect would not be restricted to the tomato fruit only but would also influence the flavonoid pathway in other parts of the tomato plant.
Biochemical Analysis of Flavonoid Levels In total, 15 PCR-positive transgenic Chs RNAi T0 plants were used for a first biochemical analysis. Based on HPLC analyses of leaf as well as fruit peel extracts, transgenic plants showing various degrees of reduced total flavonoid levels could be identified (Fig. 3A ).
From these primary transformants, four single-copy transgenic lines (24, 34, 39, and 44) with strongly decreased flavonoid levels were selected for further analysis. Of each plant, three cuttings were propagated, and from each individual cutting a sample was collected encompassing at least three ripe fruits. These samples from transgenic and wild-type tomato plants were analyzed for flavonoid content using HPLC. The main flavonoids accumulating in wild-type tomato fruits are naringenin (NAR)-chalcone and the flavonol rutin (quercetin-3-rutinoside). In fruits, these flavonoids are predominantly produced in the peel because the flavonoid pathway is inactive in flesh tissue (Muir et al., 2001 ; Bovy et al., 2002). In peel extracts of Chs RNAi fruits, a large decrease was observed in the levels of both rutin and NAR-chalcone when compared with extracts from control plants (Fig. 3, B and C). According to the percentage of NAR-chalcone and quercetin derivatives relative to control plants, lines 24, 39, and 44 were regarded as lines with a "strong" phenotype (<5% of total flavonoids left), and line 34 as a "weak" phenotype (approximately 30% left).
Tomato contains two established Chs genes, Chs1 and 2, although both southern hybridization signals (O'Neill et al., 1990
A similar decrease was found in CHS enzyme activity (Fig. 5 ). The strong Chs RNAi lines appeared to have the lowest CHS activity and product levels (reduced to 2% of wild-type values), whereas most remaining activity was found in line 34 (approximately 8% of wild-type values). In fruits derived from reciprocal crossing, the presence of CHS activity was related to the wild-type maternal genotype, giving rise to fruit peel tissue.
Phenotypic Characterization of Chs RNAi Tomatoes
The Chs RNAi tomato plants were phenotypically similar to wild type with respect to the vegetative tissues. However, all the strong Chs RNAi plants showed a delayed fruit development and yielded smaller fruits (Fig. 6
). In addition, ripe fruits derived from Chs RNAi plants were reddish, and their peel showed a dull appearance (Fig. 7, B and C
) in contrast to wild, ripe fruits that are more orange-red and shiny (Fig. 7A). The more intense red color of Chs RNAi fruits was most probably due to the reduction in the levels of the yellow-pigmented NAR-chalcone normally present at high levels in epidermal cells of the ripening fruit (Hunt and Baker, 1980
Parthenocarpic Fruit Development
A more detailed investigation of the four selected single-copy transgenic lines revealed that they all produced parthenocarpic fruits, containing no seed at all (strong phenotypes; lines 24, 39, and 44) or arrested seed set at early stages of development (weak phenotype; line 34, with occasionally one or a few seeds in a fruit). Within each line, the fruit phenotype was quite constant, but between different transgenic lines the phenotype varied considerably. Like in many parthenocarpic plants (Falavigna et al., 1978
Because flavonoids were shown to play an essential role in pollen germination and pollen tube growth in Petunia and maize (Mo et al., 1992
Several cross-fertilized flowers were allowed to give fruits to see if the rescued pollen tube growth was able to yield fruits with normal seed production (Table II ). Seed production was fully rescued when wild-type female plants were pollinated with Chs RNAi pollen. Wild-type pollen was also able to give rise to seed production in Chs RNAi female plants; however, this was less efficient. Interestingly, the size of fruit obtained after Chs RNAi flowers were pollinated with wild-type pollen increased to normal, and the fruits gained their velvet sheen, although they were still more reddish (Fig. 7D) compared to wild type due to the absence of NAR-chalcone as a result of Chs RNAi inhibition (Fig. 5A). It is likely that seed set and fruit shininess result from complex interactions between more development factors. Apparently, flavonoids present in wild-type pollen are sufficient to give rise to seed set, and, possibly, they also trigger directly or indirectly signals involved in fruit peel formation. The wild-type flowers that were pollinated with Chs RNAi pollen gave rise to fruits that were indistinguishable from normal wild-type fruits.
Transgene Stability and Offspring A few offspring plants (F1) obtained from transgenic line 34 and several obtained from crossings of Chs RNAi with wild-type plants were selected for further evaluation of inheritance stability of the transgene. Both the low flavonoid and the parthenocarpic phenotype were shown to segregate with the Chs RNAi transgene in all plants tested (n = 8); fruits of transgenic offspring contained very low flavonoid levels (less than 1% of nontransgenic fruits, data not shown) and were devoid of seeds. The segregation of the transgene could already be seen in light-stressed seedlings. Nontransgenic seedlings accumulated anthocyanins in stems and leaf axis when grown under high light conditions and became purple. In contrast, in Chs RNAi transgenic seedlings, the inhibition of flavonoid biosynthesis resulted in the absence of anthocyanins and likewise remained green.
In this study, we have shown that the flavonoid pathway in tomato can be efficiently down-regulated by RNAi-mediated suppression of CHS gene expression. In fruits, this led to a strong decrease in expression of both Chs1 and Chs2 genes and CHS activity. As a consequence, an up to 99% reduction in total flavonoids was measured. This was mainly due to reduced levels of NAR-chalcone and rutin, the predominant flavonoids in tomato peel. Chs RNAi fruits showed an altered fruit color and a dull appearance due to aberrations in the epidermal cell layers. Also, pollen development was hampered, resulting in a strongly reduced seed set. Surprisingly, all strong Chs RNAi lines yielded parthenocarpic fruits. We suggest the use of Chs RNAi as a novel approach to obtain this desirable trait in plants.
Although a relation between flavonoids and parthenocarpic fruit development has never been described, it is well known that flavonoids present in the sculptured cavities of the pollen exine, the so-called pollen coat (Edlund et al., 2004
To our knowledge, natural Chs mutants have not been found in tomato so far. However, several other tomato mutants with reduced flavonoid levels in vegetative tissues have been described (Jorgensen and Dooner, 1986
Flavonoids belonging to the class of flavonols have especially been shown to have strong stimulatory effects on pollen development, germination, pollen tube growth, and seed set (Mo et al., 1992
In accordance to this, we observed that pollen tube growth was also strongly inhibited in self-pollinated Chs RNAi tomato plants, leading to parthenocarpic fruit development. Because both male and female Chs RNAi parents were hemizygous, and, hence, produced gametes segregating for the transgene, the observed effects on pollen tube growth, seed set, and parthenocarpic development are probably determined by parental tissues. The tapetum and, consequently, pollen wall assembly, as well as the maternal tissues such as stigma and the style, can play crucial roles in functional pollen rehydration, polarization, and pollen tube migration into the stigma. Control of these processes likely requires constant interaction between pollen tube and stigma (Mascarenhas 1993 Pollen tube growth and seed set was fully rescued when CHS-deficient pollen was applied on wild-type stigmas. The reciprocal crossing (wild-type pollen on Chs RNAi stigmas) resulted in only a partial rescue of pollen tube growth and seed set, indicating that in Chs RNAi tomatoes fertilization is mainly diminished due to the lack of flavonoids in the female reproductive organ. Pollination appeared to be required for parthenocarpic fruit development in Chs RNAi lines because in the absence of pollination no fruits were obtained. This suggests that pollination is required and sufficient to trigger fruit setting and that fertilization and subsequent seed set are key determinants for normal fruit development and expansion.
Hormones play an important role in regulating fruit development. It is well known that pollen produces gibberellins and that application of gibberellins can induce an increase in the content of auxin in the ovaries of unpollinated flowers of the tomato plant, thereby triggering fruit set in the absence of fertilization (Sastry and Muir, 1963 During normal fruit set, auxins are produced by the pollen tube as it grows through the style and later on by the embryo and endosperm in the developing seeds. The latter two sources of auxin are clearly diminished or even absent in Chs-deficient parthenocarpic tomato plants, suggesting that these auxin sources are not required to induce fruit setting but may be important in later stages of fruit development, such as fruit expansion.
A possible direct role for flavonoids in auxin distribution and GA synthesis has been proposed by several research groups, and there is accumulating evidence supporting this view. For example, loss of CHS activity in Arabidopsis caused an increase in polar auxin transport (Brown et al., 2001
Several tomato mutant genotypes resulting in parthenocarpic fruit growth have been described, of which pat (Mazzucato et al., 2003 In this article, we described the effect of decreasing flavonoid levels in Chs RNAi transgenic tomato plants on pollination, fertility, and fruit development. This approach may provide a new method to obtain parthenocarpic fruits.
Efficient RNAi silencing using flavonoid genes has been reported recently in Medicago and soybean (Glycine max; Subramanian et al., 2005
For a successful commercial application of this technology, it is an essential prerequisite that these parthenocarpic fruits have a good taste. To address whether or not the parthenocarpic phenotype dramatically affects fruit taste, we measured the levels of the most important taste- and flavor-related tomato metabolites (sugars, organic acids, and 16 volatiles; Yilmaz, 2001
Controllable parthenocarpic fruit development with minimal side effects would also be of great value for future commercial applications. This could be achieved by using flower- or early fruit-specific promoters to drive Chs RNAi gene expression. The latter strategy could also be important to avoid potential adverse effects of flavonoid down-regulation on, for example, disease resistance, as was reported for the RNAi-mediated inhibition of isoflavonoid synthase in soybean (Subramanian et al., 2005
Inducible parthenocarpy could also be achieved by using inducible promoters, such as the ethanol-inducible alc gene expression system (Deveaux et al., 2003
Even more desirable for the breeding industry may be the development of parthenocarpic tomato lines with inducible seed set rather than inducible parthenocarpy. For example, seed set in parthenocarpic Chs RNAi plants could be rescued by stimulating the flavonoid pathway through inducible overexpression of the transcription factors Lc/C1 (Bovy et al., 2002 This report demonstrates the use of a flavonoid gene to induce parthenocarpic fruit development in tomato. The strict requirement for pollination to obtain parthenocarpic fruit development suggests a close mechanistic link to the essential role flavonoids play in pollen development. Further research is needed, however, to better understand the role of flavonoids in hormone-related processes such as parthenocarpic fruit development.
Plasmid Construction A full-length cDNA-encoding tomato (Solanum lycopersicum) NAR-CHS-1 (Chs1; X55194) was obtained from a cDNA library of tomato fruits. Two oligonucleotides, CHS-3'BamHI (GGATCCACTAAGCAGCAACAC) and CHS-5'SalI (GTCTCGTCGACATGGTCACCGTGGAGGA) were used to introduce a BamHI restriction site at the 3' end and a SalI site at the 5' end of the Chs1 sequence. The PCR product was digested and ligated as a BamHI/SalI fragment into pFLAP50, a pUC-derived vector containing a fusion of the double CaMV 35S promoter (Pd35S) and the Agrobacterium tumefaciens nos terminator (Tnos). The resulting plasmid was designated as pHEAP-02. To create an inverted repeat construct, a sense cDNA fragment was cloned between the promoter sequence and the anti-sense Chs1. Therefore, an 801-bp fragment was obtained by PCR amplification using two primers with restriction sites for BglII (forward primer CCCAGATCTATGGTCACCGTGGAGGAGTA; reverse primer CCCAGATCTTCACGTAAGGTGTCCGTCAA) The BglII-digested PCR fragment was cloned in the BamHI-digested plasmid HEAP-02, resulting in the plasmid pHEAP-17. The Pd35S-Chs1 inverted repeat-Tnos construct was transferred as a PacI/AscI fragment into pBBC90, a derivative of the plasmid pGPTV-KAN(11), and the final binary plasmid was designated pHEAP-20.
The plasmid pHEAP-20 was transferred to A. tumefaciens strain COR308 by the freeze-thaw method (Gynheung et al., 1988 The transgenic status of tomato plants was confirmed by PCR analysis on young leaf material according to manufacturers protocol (X-amp PCR; Sigma-Aldrich).
High molecular weight genomic DNA was isolated from young leaves of tomato, as described by Dellaporta et al. (1983) For further analysis (HPLC, DNA, and RNA), fruits were harvested when visually ripe. From each selected primary transformant, three cuttings were made and grown to maturity. From each plant, at least three fruits were pooled for extraction to minimize sample variation. The fruit peel (approximately 2 mm consisting of cuticula, epidermis, and subepidermis) was separated from the flesh tissue (i.e. columella; jelly parenchyma and seeds excluded) and immediately frozen in liquid nitrogen. In addition to fruit material, young leaves were also collected and frozen in liquid nitrogen to store at –80°C for later use.
Flavonoid content was determined both as glycosides and aglycones by preparing nonhydrolyzed and acidic-hydrolyzed extracts, respectively. Nonhydrolyzed extracts were prepared in 75% (w/v) aqueous methanol using 15 min of sonication. Subsequent HPLC of the extracted flavonoids was performed with a gradient of 5% to 50% acetonitrile in 0.1% formic acid. Absorbance spectra and retention times of eluting peaks were compared with those of commercially available flavonoid standards (Apin Chemicals). Analysis of flavonoids in the extracts was performed by reverse phase HPLC (Phenomenex Luna 3 µm C18, 150 x 4, 50-mm column, at 40°C) with photodiode array detection (Waters 996).
Total RNA was isolated from tomato fruits as described previously (Bovy et al., 1995
Real-time quantitative RT-PCR analysis was performed to test the effect of the RNAi construct on the endogenous Chs gene expression levels. Sequence detection primers were designed based on the published tomato Chs sequences from tomato (Chs1; X55194 and Chs2; X55195) using the SDS 1.9 software (Applied Biosystems). All primers (Table I) were synthesized by Applied Biosystems. Then 2 µg total RNA was used for cDNA synthesis using Superscript II reverse transcriptase (Invitrogen) in a 100-µL final volume according to the standard protocol. For each of the three biological replicates of each transgenic line, Chs1 and Chs2 expression was measured in triplicate using SYBR-green RT-PCR on the ABI 7700 sequence detection system. Chs gene expression was expressed relative to the constitutively expressed ribosomal protein gene L33 (TC85035). Calculations of the expression in each sample were carried out according to the standard curve method (PE Applied Biosystems).
NAR was from Roth. [2-14C]Malonyl-CoA (spec. act. 53 mCi/mmol) was from Hartmann Analytic. 4-Coumaryol-CoA was a gift from W. Heller (Neuherberg, Germany). [4a,6,8-14C]NAR was prepared as described by S. Martens (unpublished data) using recombinant CHS and chalcone isomerase. Radioactivity incorporated in labeled substrate was quantified by scanning sample aliquots after migration on cellulose plates (Merck) using a bio-Imaging Analyzer Fuji BAS FLA 2000 (Raytest) and by direct scintillation counting (LKB Wallac 1214 Rackbeta; PerkinElmer Wallac).
Proteins were extracted from grounded fruit tissue as follows: 200 mg tissue was homogenized with 100 mg sea sand, 200 mg Dowex 200-400 mesh (äquil. 0.1 M Tris-HCl, pH 7.5) in 1 mL of 0.1 M Tris-HCl, pH 7.5, containing 20 mM sodium ascorbate. After two centrifugation steps at 10,000g (Sorvall RMC 14; Du Pont Nemours) for 5 min at 4°C, the resulting supernatant was directly used for CHS assays. Protein concentration was determined according to Bradford (1976) Standard assays for CHS was performed in a final volume of 200 µL and contained: 140 µL of 0.1 M Tris-HCl, pH 7.5, 50 µL of crude extract (8–22 µg protein), 5 µL of [2-14C]malonyl-CoA (1.5 nmol; approximately 1,800 Bq), and 5 µL of 4-coumaroyl-CoA (1 nmol). After incubation, reactions were stopped and extracted twice with 100 µL ethyl acetate. The pooled ethyl acetate phase from each assay was directly subjected to scintillation counter for quantification or chromatographed on cellulose plates with either chloroform:acetic acid:water; 50:45:5) or 15% acetic acid. For each enzyme preparation, CHS assays were performed in triplicate. Labeled products were localized and quantified by scanning the plates as above described. Product identification was done by cochromatography with authentic samples.
Mature closed flowers were emasculated and pollinated. Two days after pollination, pistils were harvested and incubated overnight at 60°C in 1 M KOH. After rinsing with water, pistils were transferred to a microscope slide and stained with 0.005% aniline in 50% Gly. A coverslip was placed on top and pressed gently. Callose in the pollen tubes was visualized by UV light on a Zeiss Axioskop microscope and photographed using 400 ASA film. Slides were scanned with an AGFA duoscan scanner.
Small samples of material were dissected from fresh fruits, mounted on a stub, and subsequently frozen in liquid nitrogen. The samples were further prepared in an Oxford Alto 2500 cryo-system (Catan) and then analyzed in a JEOL JSM-6330F field emission electron scanning microscope. The frozen samples were fractionated inside the cryo system for cross views. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers X55194 and X55195. Received March 27, 2007; accepted April 27, 2007; published May 3, 2007.
The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Elio G.W.M. Schijlen (elio.schijlen{at}wur.nl).
[C] Some figures in this article are displayed in color online but in black and white in the print edition. www.plantphysiol.org/cgi/doi/10.1104/pp.107.100305 * Corresponding author; e-mail elio.schijlen{at}wur.nl; fax 31–317–41–80–94.
Abad M, Monteiro AA (1989) The use of auxins for the production of greenhouse tomatoes in mild winter conditions: a review. Sci Hortic (Amsterdam) 38: 167–192[CrossRef] Brown DE, Rashotte AM, Murphy AS, Normanly J, Tague BW, Peer WA, Taiz L, Muday GK (2001) Flavonoids act as negative regulators of auxin transport in vivo in Arabidopsis. Plant Physiol 126: 524–535 Bovy A, de Vos R, Kemper M, Schijlen E, Almenar Pertejo M, Muir S, Collins G, Robinson S, Verhoeyen M, Hughes S, et al (2002) High-flavonol tomatoes resulting from heterologous expression of the maize transcription factor gene Lc and C1. Plant Cell 14: 2509–2526 Bovy A, van den Berg C, de Vrieze G, Thompson WF, Weisbeek P, Smeekens S (1995) Light-regulated expression of the Arabidopsis thaliana ferredoxin gene requires sequences upstream and downstream of the transcription initiation site. Plant Mol Biol 27: 27–39[CrossRef][ISI][Medline] Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254[CrossRef][ISI][Medline] Burbulis IE, Iacobucci M, Shirley BW (1996) A null mutation in the first enzyme of flavonoid biosynthesis does not affect male fertility in Arabidopsis. Plant Cell 8: 1013–1025[Abstract] Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version II. Plant Mol Biol Rep 1: 19–21[CrossRef] Deveaux Y, Peaucelle A, Roberts GR, Coen E, Simon R, Mizukami Y, Traas J, Murray JA, Doonan JH, Laufs P (2003) The ethanol switch: a tool for tissue-specific gene induction during plant development. Plant J 36: 918–930[CrossRef][ISI][Medline] Edlund AF, Swanson R, Preuss D (2004) Pollen and stigma structure and function: the role of diversity in pollination. Plant Cell (Suppl) 16: S84–S97 Falavigna A, Baldino M, Soressi GP (1978) Potential of the mono Mendelian factor pat in tomato breeding for industry. Genet Agrar 32: 159–160 Fillatti JJ, Kiser J, Rose R, Comai L (1987) Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium tumefaciens vector. Bio/Technol 5: 726–730[CrossRef] Fischer R, Budde I, Hain R (1997) Stilbene synthase gene expression causes changes in flower colour and male sterility in tobacco. Plant J 11: 489–498[CrossRef][ISI] Fos M, Nuez F, García-Martínez JL (2000) The pat-2 gene, which induces natural parthenocarpy, alters gibberellin content in unpollinated tomato ovaries. J Plant Physiol 122: 471–479[CrossRef] Fos M, Proaño K, Nuez F, García-Martínez JL (2001) Role of gibberellins in parthenocarpic fruit development induced by the genetic system pat-3/pat-4 in tomato. Physiol Plant 111: 545–550[CrossRef][Medline] Giovinazzo G, D'Amico L, Paradiso A, Bollino R, Sparvoli F, DeGara L (2005) Antioxidant metabolite profiles in tomato fruit constitutively expressing the grapevine stilbene synthase gene. Plant Biotechnol J 3: 57–69[CrossRef][Medline] Gorguet B, van Heusden AW, Lindhout P (2005) Parthenocarpic fruit development in tomato. Plant Biol 7: 131–139[CrossRef][Medline] Gustafson FG (1942) Parthenocarpy: natural and artificial. Bot Rev 8: 599–654[CrossRef] Gynheung AN, Ebert PR, Mitra A, Ha SB (1988) Binary vectors. In S Gelvin, R Schilperoort, D Verma, eds, Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp A3/1–19 Hunt JM, Baker EA (1980) Phenolic constituents of tomato fruit cuticles. Phytochemistry 19: 1415–1419[ISI] Jackson AL, Linsley PS (2004) Noise amidst the silence: off-target effects of siRNAs? Trends Genet 20: 521–524[CrossRef][ISI][Medline] Jorgensen RA, Dooner HK (1986) Activity of anthocyanin biosynthetic enzymes and CHS in anthocyanin deficient mutants in tomato. Tomato Genet Coop Rep 36: 6–7 Koes RE, Quattrocchio F, Mol JNM (1994) The flavonoid biosynthetic pathway in plants: function and evolution. Bioessays 16: 123–132[CrossRef][ISI] Kurtz S, Choudhuri JV, Ohlebusch E, Schleiermacher C, Stoye J, Giegerich R (2001) REPuter: the manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res 29: 4633–4642 Mascarenhas JP (1993) Molecular mechanisms of pollen tube growth and differentiation. Plant Cell 5: 1303–1314 Mazzucato A, Olimpieri I, Ciampolini F, Cresti M, Soressi GP (2003) A defective pollen-pistil interaction contributes to hamper seed set in the parthenocarpic fruit tomato mutant. Sex Plant Reprod 16: 157–164[CrossRef] Mo Y, Nagel C, Taylor LP (1992) Biochemical complementation of chalcone synthase mutants defines a role for flavonols in functional pollen. Proc Natl Acad Sci USA 89: 7213–7217 Mol J, Grotewold E, Koes R (1998) How genes paint flowers ands seeds. Trends Plant Sci 3: 212–217[CrossRef][ISI] Muir SR, Collins GJ, Robinson S, Hughes S, Bovy S, De Vos CH, van Tunen AJ, Verhoeyen ME (2001) Overexpression of petunia chalcone isomerase in tomato results in fruit containing increased levels of flavonols. Nat Biotechnol 19: 470–474[CrossRef][ISI][Medline] Napoli CA, Fahy D, Wang HY, Taylor LP (1999) White anther: a Petunia mutant that abolishes pollen flavonol accumulation, induces male sterility, and is complemented by a chalcone synthase transgene. Plant Physiol 120: 615–622 Noda K, Glover BJ, Linstead P, Martin C (1994) Flower colour intensity depends on specialized cell shape controlled by a Myb-related transcription factor. Nature 369: 661–664[CrossRef][Medline] Nuez F, Costa J, Cuartero J (1986) Genetics of the parthenocarpy for tomato varieties ‘Sub-Arctic Plenty’, ‘75/59’ and ‘Severianin’. Z Pflanzenzüchtung 96: 200–206 O'Neill SD, Tong Y, Sporlein B, Forkmann G, Yoder YI (1990) Molecular genetic analysis of chalcone synthase in Lycopersicon esculentum and an anthocyanin-deficient mutant. Mol Gen Genet 224: 279–288[CrossRef][ISI][Medline] Philouze J, Maisonneuve B (1978) Heredity of the natural ability to set parthenocarpic fruits in the Soviet variety Severianin. Tomato Genet Coop Rep 28: 12–13 Rotino GL, Perri E, Zottini M, Sommer H (1997) Genetic engineering of parthenocarpic plants. Nat Biotechnol 15: 1398–1401[CrossRef][ISI][Medline] Ruiz JJ, Alonso A, Garcia-Martinez S, Valer M, Blasco P, Ruiz-Bevia F (2005) Quantitative analysis of flavour volatiles detects differences among closely related traditional cultivars of tomato. J Sci Food Agric 85: 54–60[CrossRef][ISI] Sastry K, Muir R (1963) Gibberellin: effect on diffusible auxin in fruit development. Science 140: 494–495 Schijlen E, de Vos CHR, Jonker H, van den Broeck H, Molthoff J, van Tunen A, Martens S, Bovy A (2006) Pathway engineering for healthy phytochemicals leading to the production of novel flavonoids in tomato fruit. Plant Biotechnol J 4: 433–444[CrossRef][Medline] Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006) Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell 18: 1121–1133 Subramanian S, Graham MY, Yu O, Graham TL (2005) RNA interference of soybean isoflavone synthase genes leads to silencing in tissue distal to the transformation site and to enhanced susceptibility to Phytophthora sojae. Plant Physiol 137: 1345–1353 Taylor LP, Jorgensen R (1992) Conditional male fertility in chalcone synthase-deficient Petunia. J Hered 83: 11–17 Tikunov Y, Lommen A, de Vos CHR, Verhoeven HA, Bino RJ, Hall RD, Bovy AG (2005) A novel approach for nontargeted data analysis for metabolomics. Large-scale profiling of tomato fruit volatiles. Plant Physiol 139: 1125–1137 Van der Meer IM, Stam ME, Van Tunen AJ, Mol JN, Stuitje AR (1992) Antisense inhibition of flavonoid biosynthesis in Petunia anthers results in male sterility. Plant Cell 4: 253–262 van Houwelingen A, Souer E, Spelt K, Kloos D, Mol J, Koes R (1998) Analysis of flower pigmentation mutants generated by random transposon mutagenesis in Petunia hybrida. Plant J 13: 39–50[CrossRef][ISI][Medline] Varoquaux F, Blanvillain R, Delseny M, Gallois P (2000) Less is better; new approaches for seedless fruit production. Trends Biotechnol 18: 233–242[CrossRef][ISI][Medline] Wang H, Jones B, Li Z, Frasse P, Delalande C, Regad F, Chaabouni S, Latche A, Pech J-C, Bouzayen M (2005) The tomato Aux/IAA transcription factor IAAg is involved in fruit development and leaf morphogenesis. Plant Cell 17: 2676–2692 Wasson AP, Pellerone FI, Mathesius U (2006) Silencing the flavonoid pathway in Medicago truncatula inhibits root nodule formation and prevents auxin transport regulation by Rhizobia. Plant Cell 18: 1617–1629 Wiermann R (1979) Stage specific phenylpropanoid metabolism during pollen development. In M Luckner, L Schreiber, eds, Regulation of Secondary Product and Plant Hormone Metabolism. Pergamon Press, Oxford, pp 231–239 Yilmaz E (2001) The chemistry of fresh tomato flavor. Turk J Agric For 25: 149–155 Ylstra B, Muskens M, van Tunen AJ (1996) Flavonols are not essential for fertilization in Arabidopsis thaliana. Plant Mol Biol 32: 1155–1158[CrossRef][ISI][Medline] Ylstra B, Touraev A, Benito Moreno RM, Stöger E, van Tunen AJ, Vicente O, Mol JNM, Heberle-Bors E (1992) Flavonols stimulate development, germination and tube growth of tobacco pollen. Plant Physiol 100: 902–907 Yoder JI, Belzile F, Tong Y, Goldsbrough A (1994) Visual markers for tomato derived from the anthocyanin biosynthetic pathway. Euphytica 79: 163–167[CrossRef][ISI] Related articles in Plant Physiol.:
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOP
ABSTRACT
RESULTS
