Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online May 3, 2007; 10.1104/pp.107.100305

Plant Physiology 144:1520-1530 (2007)
© 2007 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/3/1520    most recent
pp.107.100305v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Plant Physiol.
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schijlen, E. G.W.M.
Right arrow Articles by Bovy, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schijlen, E. G.W.M.
Right arrow Articles by Bovy, A. G.
Agricola
Right arrow Articles by Schijlen, E. G.W.M.
Right arrow Articles by Bovy, A. G.
SYSTEMS BIOLOGY, MOLECULAR BIOLOGY, AND GENE REGULATION

RNA Interference Silencing of Chalcone Synthase, the First Step in the Flavonoid Biosynthesis Pathway, Leads to Parthenocarpic Tomato Fruits[C]

Elio G.W.M. Schijlen*, C.H. Ric de Vos, Stefan Martens, Harry H. Jonker, Faye M. Rosin, Jos W. Molthoff, Yury M. Tikunov, Gerco C. Angenent, Arjen J. van Tunen and Arnaud G. Bovy

Plant Research International, Business Unit Bioscience, 6700 AA Wageningen, The Netherlands (E.G.W.M.S., C.H.R.d.V., H.H.J., F.M.R., J.W.M., Y.M.T., G.C.A., A.G.B.); Philipps Universität Marburg, Institut für Pharmazeutische Biologie, D–35037 Marburg/Lahn, Germany (S.M.); and Keygene N.V., 6700 AE Wageningen, The Netherlands (A.J.v.T.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Parthenocarpy, the formation of seedless fruits in the absence of functional fertilization, is a desirable trait for several important crop plants, including tomato (Solanum lycopersicum). Seedless fruits can be of great value for consumers, the processing industry, and breeding companies. In this article, we propose a novel strategy to obtain parthenocarpic tomatoes by down-regulation of the flavonoid biosynthesis pathway using RNA interference (RNAi)-mediated suppression of chalcone synthase (CHS), the first gene in the flavonoid pathway. In CHS RNAi plants, total flavonoid levels, transcript levels of both Chs1 and Chs2, as well as CHS enzyme activity were reduced by up to a few percent of the corresponding wild-type values. Surprisingly, all strong Chs-silenced tomato lines developed parthenocarpic fruits. Although a relation between flavonoids and parthenocarpic fruit development has never been described, it is well known that flavonoids are essential for pollen development and pollen tube growth and, hence, play an essential role in plant reproduction. The observed parthenocarpic fruit development appeared to be pollination dependent, and Chs RNAi fruits displayed impaired pollen tube growth. Our results lead to novel insight in the mechanisms underlying parthenocarpic fruit development. The potential of this technology for applications in plant breeding and biotechnology will be discussed.


Flavonoids are plant secondary metabolites that are widespread throughout the plant kingdom. To date, more than 6,000 flavonoids have been identified. Based on the structure of their basic skeleton, flavonoids can be divided into different classes, such as chalcones, flavonols, and anthocyanins (Fig. 1 ). In nature, flavonoids are involved in many biological processes. For example, they act as UV light scavengers to protect against oxidative damage, as antimicrobial compounds to defend against pathogens, and as pigments in fruits, flowers, and seeds, where they have a function in attracting pollinators and seed dispersers to facilitate reproduction (Koes et al., 1994Go). Flavonoids are also present in pollen and pistils of many plant species (Wiermann, 1979Go), and there is increasing evidence showing that flavonoids, at least in some plants, play a crucial role in fertility and sexual reproduction. For example, inhibition of flavonoid production in Petunia plants, through antisense suppression of the gene encoding chalcone synthase (CHS), the first enzyme in the flavonoid pathway (Fig. 1), resulted not only in the inhibition of flower pigmentation but also in male sterility (Van der Meer et al., 1992Go). Pollination experiments revealed that flavonoids in either the anther or pistil are essential for pollen tube growth, fertilization, and subsequent seed set (Ylstra et al., 1992Go). After cross pollination, the sterile phenotype could be partly rescued by flavonoids present in the wild-type plant. In addition, in vitro experiments showed that flavonols, in particular, kaempferol and quercetin, are essential for pollen tube germination and growth in Petunia and maize (Zea mays; Mo et al., 1992Go; Ylstra et al., 1992Go, 1996Go). Further evidence for a role of flavonoids in sexual reproduction is provided by the male sterile Petunia white anther (wha) mutant, which could be complemented by the introduction of a functional CHS cDNA (Napoli et al., 1999Go).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Schematic overview of the flavonoid biosynthesis pathway in plants. The pathway normally active in tomato fruit peel, leading to flavonol production, is indicated by solid arrows. Abbreviations: STS, stilbene synthase; CHI, chalcone isomerase; F3H, flavanone hydroxylase; FNS, flavone synthase; IFS, isoflavone synthase; FLS, flavonol synthase; F3'H, flavonoid-3'-hydroxylase; F3'5'H, flavonoid-3',5'-hydroxylase; DFR, dihydroflavonol-4-reductase; ANS, anthocyanidin synthase.

 
In addition to (male) sterility, parthenocarpy, which is defined as the formation of seedless fruits in the absence of functional fertilization (Gustafson, 1942Go; Gorguet et al., 2005Go), is a desirable trait for several important crop plants. The production of seedless fruits can be of great value for consumers when directly eaten but also for the processing industry. Besides this, parthenocarpy is advantageous when pollination or fertilization is affected due to extreme temperatures. Unfortunately, mutations causing parthenocarpic fruits as well as plant hormone-based approaches to obtain parthenocarpy often have pleiotropic effects and can result in undesirable characteristics, such as misshapen fruits (Varoquaux et al., 2000Go; Fos et al., 2001Go; Wang et al., 2005Go).

To obtain more insight into the role of flavonoids in reproduction and fruit development, we have blocked flavonoid biosynthesis in tomato (Solanum lycopersicum) by RNA interference (RNAi) suppression of the gene encoding CHS. The resulting transgenic fruits showed a strong decrease of total flavonoid levels and displayed an altered color. Surprisingly, these fruits were devoid of seeds.

In this article, we show that engineering of the flavonoid pathway may be a novel approach to obtain parthenocarpic tomato fruits. In addition, we present evidence for a possible mechanism and discuss potential applications of this technology.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

RNAi Strategy Down-Regulates Chs Gene Expression in Tomato

To down-regulate the flavonoid biosynthesis in tomato, we introduced a Chs1 RNAi gene construct (Fig. 2 ) using Agrobacterium-mediated plant transformation. This Chs RNAi construct was expressed under control of the constitutively enhanced cauliflower mosaic virus (CaMV) 35S promoter, and, therefore, it was expected that the transgene effect would not be restricted to the tomato fruit only but would also influence the flavonoid pathway in other parts of the tomato plant.


Figure 2
View larger version (7K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Schematic drawing of the tomato Chs RNAi construct. Transgene expression was under control of the CaMV double 35S promoter (Pd35S) and terminated by Tnos. An inverted repeat was generated by cloning a sense Chs1 cDNA fragment (801 bp) followed by the full-length cDNA sequence encoding tomato Chs1 in anti-sense orientation.

 

Biochemical Analysis of Flavonoid Levels

In total, 15 PCR-positive transgenic Chs RNAi T0 plants were used for a first biochemical analysis. Based on HPLC analyses of leaf as well as fruit peel extracts, transgenic plants showing various degrees of reduced total flavonoid levels could be identified (Fig. 3A ).


Figure 3
View larger version (15K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Comparison of flavonoid levels between wild-type and Chs RNAi tomato. A, Total flavonoid levels in leaf extracts of different CHS RNAi transgenic lines. B, HPLC chromatograms obtained from nonhydrolyzed fruit peel extracts of wild-type (top) and Chs RNAi plants (bottom). In the control plant, the major compounds found are NAR-chalcone (NC) and the flavonol rutin. C, Percentage of flavonoids in the fruit peel of Chs RNAi plants (lines 34, 39, 44, and 24) relative to the fruit peel of control tomatoes. Mean control values (milligram per kilogram fresh weight): NAR-chalcone, 212.5, SD 66.5; quercetin derivatives (rutin + rutin apioside), 80.7, SD 11.0. [See online article for color version of this figure.]

 
From these primary transformants, four single-copy transgenic lines (24, 34, 39, and 44) with strongly decreased flavonoid levels were selected for further analysis. Of each plant, three cuttings were propagated, and from each individual cutting a sample was collected encompassing at least three ripe fruits. These samples from transgenic and wild-type tomato plants were analyzed for flavonoid content using HPLC. The main flavonoids accumulating in wild-type tomato fruits are naringenin (NAR)-chalcone and the flavonol rutin (quercetin-3-rutinoside). In fruits, these flavonoids are predominantly produced in the peel because the flavonoid pathway is inactive in flesh tissue (Muir et al., 2001Go; Bovy et al., 2002Go). In peel extracts of Chs RNAi fruits, a large decrease was observed in the levels of both rutin and NAR-chalcone when compared with extracts from control plants (Fig. 3, B and C). According to the percentage of NAR-chalcone and quercetin derivatives relative to control plants, lines 24, 39, and 44 were regarded as lines with a "strong" phenotype (<5% of total flavonoids left), and line 34 as a "weak" phenotype (approximately 30% left).


Chs Gene Expression Analysis

Tomato contains two established Chs genes, Chs1 and 2, although both southern hybridization signals (O'Neill et al., 1990Go; Yoder et al., 1994Go) and EST database searches suggest the presence of at least one additional, more divergent Chs gene family member. Gene-specific oligonucleotides were designed to discriminate between both Chs1 and Chs2 mRNA (Table I). The samples used for biochemical analysis were also used to measure the expression of the endogenous Chs1 and Chs2 genes by real-time quantitative reverse transcription (RT)-PCR. The constitutively expressed tomato gene encoding ribosomal protein L33 was used as internal standard. Expression of this gene was found to be constitutive in DNA microarray experiments with Chs RNAi and wild-type fruit peel, as well as during different stages of fruit ripening (data not shown). Compared to wild type, the strong Chs RNAi lines showed a large decrease in expression levels of both Chs1 and Chs2 (Fig. 4 ). In contrast, a relatively small decrease in Chs expression was found in fruits of line 34, the weak phenotype. For all lines, the observed decreases in gene expression levels correlated well with the biochemical data.


View this table:
[in this window]
[in a new window]

 
Table I. Oligonucleotides used for TaqMan analysis

 

Figure 4
View larger version (11K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Quantitative real-time PCR analysis. Steady-state mRNA levels of tomato Chs1 and Chs2 relative to the housekeeping gene L33 (encoding tomato ribosomal protein L33) were measured in fruit peel extracts of RNAi (34, 39, 44, and 24) and control lines. Values represent the average of three biological replicates, each with three technical replicates. Expression levels in control were set to 100%.

 
A similar decrease was found in CHS enzyme activity (Fig. 5 ). The strong Chs RNAi lines appeared to have the lowest CHS activity and product levels (reduced to 2% of wild-type values), whereas most remaining activity was found in line 34 (approximately 8% of wild-type values). In fruits derived from reciprocal crossing, the presence of CHS activity was related to the wild-type maternal genotype, giving rise to fruit peel tissue.


Figure 5
View larger version (40K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. CHS enzyme activity. A, Autoradiography scan of extraction of CHS assays developed on cellulose plates in chloroform:acetic acid:water. Left, CHS activity of tomato fruit peel in different Chs RNAi and control lines. Right, CHS activity in fruits obtained after (reciprocal) crossings between wild type and Chs RNAi. B, Densitometric scans of profiles of selected assays. The peak representing the CHS reaction product NAR is indicated.

 

Phenotypic Characterization of Chs RNAi Tomatoes

The Chs RNAi tomato plants were phenotypically similar to wild type with respect to the vegetative tissues. However, all the strong Chs RNAi plants showed a delayed fruit development and yielded smaller fruits (Fig. 6 ). In addition, ripe fruits derived from Chs RNAi plants were reddish, and their peel showed a dull appearance (Fig. 7, B and C ) in contrast to wild, ripe fruits that are more orange-red and shiny (Fig. 7A). The more intense red color of Chs RNAi fruits was most probably due to the reduction in the levels of the yellow-pigmented NAR-chalcone normally present at high levels in epidermal cells of the ripening fruit (Hunt and Baker, 1980Go). Interestingly, chalcone isomerase-overexpressing fruits display reduced NAR-chalcone levels, a more intense red color, and a dull appearance as well (Muir et al., 2001Go). This suggests a relationship between flavonoids and fruit dullness. To investigate the dull appearance of the fruit peel in more detail, red wild-type and Chs RNAi fruits were subjected to electron microscopy analysis. The epidermal cell layer of the wild-type fruits consisted of intact cells with a typical conical shape (Fig. 8, A and B ), which normally confers the properties of higher light absorption and velvet sheen. The absence of this conical cell surface in Chs RNAi fruits could be an explanation for the dullness, as was described for the Antirrhinum majus (mixta) and the Petunia (mybPh1) mutants (Noda et al., 1994Go; Mol et al., 1998Go; van Houwelingen et al., 1998Go) in which the fainter petal colors also resulted from flattening of the epidermal cells. Furthermore, the fruit surface of the Chs RNAi plants consisted of dead epidermal cells that were empty, as shown by the scanning electron microscopy freeze-fraction cross view (Fig. 8, C and D). A similar collapsed flat tire appearance of epidermal cells was observed in petals of the Petunia shriveled up (shp) mutants and led to a drastic change of flower color (Mol et al., 1998Go).


Figure 6
View larger version (14K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. Tomato fruit weight in grams (black bars) and fruit size at equatorial cross section in millimeters (gray bars). Values represent mean values ± SEM. Control (wild type), n = 10; line 34, n = 4; line 44, n = 15; line 24 and 39, each n = 14.

 

Figure 7
View larger version (102K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. Overview of different phenotypes found in Chs RNAi tomatoes compared to wild type. A, Typical ripe wild-type tomato fruits are shiny and orange red, in contrast to dull, smaller, and more reddish Chs RNAi fruits (B, C, and D; line 24, 34, and 39, respectively). Fruits derived from flowers that were pollinated with wild-type pollen (arrow) grew to normal size and obtained their shininess (D). Transgenic line 44 yielded extreme small fruits and line 34 "fruit caves" when compared to wild type (E). In parthenocarpic Chs RNAi fruits, seed development was disturbed (G) or totally absent (H and I), whereas wild-type fruits had a normal seed set (F).

 

Figure 8
View larger version (153K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 8. Electron microscopy photograph of epidermal cells of red ripe tomato fruits. A and C, Surface view; B and D, cross section. Wild-type (A and B) fruits contain conical-shaped cells on the epidermal surface, whereas in Chs RNAi (C and D) fruits the epidermal cell layer is disturbed (absence of conical shapes and empty cells).

 

Parthenocarpic Fruit Development

A more detailed investigation of the four selected single-copy transgenic lines revealed that they all produced parthenocarpic fruits, containing no seed at all (strong phenotypes; lines 24, 39, and 44) or arrested seed set at early stages of development (weak phenotype; line 34, with occasionally one or a few seeds in a fruit). Within each line, the fruit phenotype was quite constant, but between different transgenic lines the phenotype varied considerably. Like in many parthenocarpic plants (Falavigna et al., 1978Go; Abad and Monteiro, 1989Go), undersized, misshapen, or hollow fruits were also found in Chs RNAi tomato. At the end of the growing season, the Chs RNAi phenotype appeared to be more extreme in terms of very small fruit size for some lines (39 and 44) when compared to wild-type fruits (Fig. 7E). Fruits of some Chs RNAi plants contained no jelly and were completely filled with flesh. An overview of all the phenotypes found is shown in Figure 7.


Plant Pollen Tube Growth and Fertility

Because flavonoids were shown to play an essential role in pollen germination and pollen tube growth in Petunia and maize (Mo et al., 1992Go; Ylstra et al., 1992Go, 1996Go), we investigated whether these processes were affected in Chs RNAi plants as well. Fertilized carpels of wild-type, Chs RNAi (line 24), and reciprocal crossed plants were histochemically stained specific for callose present in growing pollen tubes 2 d after pollination. In wild-type, self-pollinated plants, pollen tubes reached the ovules 2 d after pollination (Fig. 9, B, F, and J ). Within the same time period, pollen tubes of Chs RNAi self-pollinated plants germinated but did not grow well. In these plants, callose staining was clearly visible in the stigma and absent further down the style, indicating an inhibited pollen tube growth (Fig. 9, D, H, and L). Pollen tube growth could be (partially) rescued by crossing wild-type and Chs RNAi plants in both directions. Pollen tube growth in wild-type female plants pollinated with Chs RNAi pollen reached the base of the style 2 d after pollination (Fig. 9, B, F, and J). The reciprocal crossing, i.e. Chs RNAi pistils pollinated with wild-type pollen, was less efficient (Fig. 9, C, G, and K). Here, the pollen tubes grew only to about nine-tenths of the way down the style, and some of the tube tips were swollen.


Figure 9
View larger version (136K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 9. Histochemical staining of wild-type and Chs RNAi (line 24) pollen tube growth in carpels 2 d after pollination. Fertilized carpels were stained with aniline blue to specifically stain callose present in growing pollen tubes. A, E, and I, Wild-type carpels crossed with wild-type pollen; B, F, and J, wild-type carpels x Chs RNAi pollen; C, G, and K, Chs RNAi x wild type; D, H, and L, Chs RNAi self-crossings. A to D, Pollen at the stigma. Note in D, callose in the pollen tubes is still visible at the stigma (arrow), indicating inhibited growth. E to H, Proliferation of pollen tube growth in the middle of the style, except for H, which is only one-quarter of the way down the style from the stigma. No pollen tubes were visible in the middle of the styles from Chs RNAi selfed plants. I to L, Pollen tube growth at the base of the style, except K, which grew only nine-tenths of the way down the style. In K, the tips of the pollen tubes are swollen (arrow). Pollen tubes are not visible at the base of the style in K (not shown) or L. All micrographs are the same magnification. [See online article for color version of this figure.]

 
Several cross-fertilized flowers were allowed to give fruits to see if the rescued pollen tube growth was able to yield fruits with normal seed production (Table II ). Seed production was fully rescued when wild-type female plants were pollinated with Chs RNAi pollen. Wild-type pollen was also able to give rise to seed production in Chs RNAi female plants; however, this was less efficient. Interestingly, the size of fruit obtained after Chs RNAi flowers were pollinated with wild-type pollen increased to normal, and the fruits gained their velvet sheen, although they were still more reddish (Fig. 7D) compared to wild type due to the absence of NAR-chalcone as a result of Chs RNAi inhibition (Fig. 5A). It is likely that seed set and fruit shininess result from complex interactions between more development factors. Apparently, flavonoids present in wild-type pollen are sufficient to give rise to seed set, and, possibly, they also trigger directly or indirectly signals involved in fruit peel formation. The wild-type flowers that were pollinated with Chs RNAi pollen gave rise to fruits that were indistinguishable from normal wild-type fruits.


View this table:
[in this window]
[in a new window]

 
Table II. Tomato fruit seed set

Fruit seed set (mean ± SD) resulting from crossings between wild type and CHS RNAi tomato line 39 and 44 (fruits of both lines were totally seedless after self-pollination).

 

Transgene Stability and Offspring

A few offspring plants (F1) obtained from transgenic line 34 and several obtained from crossings of Chs RNAi with wild-type plants were selected for further evaluation of inheritance stability of the transgene. Both the low flavonoid and the parthenocarpic phenotype were shown to segregate with the Chs RNAi transgene in all plants tested (n = 8); fruits of transgenic offspring contained very low flavonoid levels (less than 1% of nontransgenic fruits, data not shown) and were devoid of seeds.

The segregation of the transgene could already be seen in light-stressed seedlings. Nontransgenic seedlings accumulated anthocyanins in stems and leaf axis when grown under high light conditions and became purple. In contrast, in Chs RNAi transgenic seedlings, the inhibition of flavonoid biosynthesis resulted in the absence of anthocyanins and likewise remained green.


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
In this study, we have shown that the flavonoid pathway in tomato can be efficiently down-regulated by RNAi-mediated suppression of CHS gene expression. In fruits, this led to a strong decrease in expression of both Chs1 and Chs2 genes and CHS activity. As a consequence, an up to 99% reduction in total flavonoids was measured. This was mainly due to reduced levels of NAR-chalcone and rutin, the predominant flavonoids in tomato peel. Chs RNAi fruits showed an altered fruit color and a dull appearance due to aberrations in the epidermal cell layers. Also, pollen development was hampered, resulting in a strongly reduced seed set. Surprisingly, all strong Chs RNAi lines yielded parthenocarpic fruits. We suggest the use of Chs RNAi as a novel approach to obtain this desirable trait in plants.

Although a relation between flavonoids and parthenocarpic fruit development has never been described, it is well known that flavonoids present in the sculptured cavities of the pollen exine, the so-called pollen coat (Edlund et al., 2004Go), are essential for pollen development, germination, and pollen tube growth and, hence, play an essential role in plant reproduction. For example, mutation of the two Chs genes in maize as well as the Petunia wha mutant resulted in white, flavonoid-lacking pollen that showed to be sterile. Furthermore, Petunia plants harboring a complete block of flavonoid production due to anti-sense Chs or sense Chs cosuppression had white flowers and were male sterile (Van der Meer et al., 1992Go; Napoli et al., 1999Go) In contrast, flavonoids appeared not to be essential for fertility in the tt4 (Chs) mutant of Arabidopsis (Arabidopsis thaliana; Burbulis et al., 1996Go), although also in this mutant a small but significant reduction in seed set was observed (Ylstra et al., 1996Go). Apparently, the role of flavonoids in plant reproduction varies between different plant species.

To our knowledge, natural Chs mutants have not been found in tomato so far. However, several other tomato mutants with reduced flavonoid levels in vegetative tissues have been described (Jorgensen and Dooner, 1986Go). For none of these mutants, however, has a seedless phenotype been reported. This is not surprising because: (1) these mutants were screened for reduced levels of flavonoids, in particular, anthocyanins, in vegetative tissues, and it is unclear if generative tissues were affected as well; and (2) only two of these mutants, al and af, showed a limited decrease in CHS enzyme activity (4- to 7-fold relative to wild type in hypocotyls), which was much less severe than we observed in Chs RNAi plants (up to 50-fold reduction in red fruits) and may not be sufficient to prevent fertilization.

Flavonoids belonging to the class of flavonols have especially been shown to have strong stimulatory effects on pollen development, germination, pollen tube growth, and seed set (Mo et al., 1992Go; Ylstra et al., 1992Go, 1996Go). The inability of pollen from the sterile wha mutant to germinate normally could be complemented by the introduction of a functional Chs transgene (Napoli et al., 1999Go) or by flavonol addition. When applied to wild-type stigmas, tube growth of Chs-deficient sterile pollen and seed set could be partly rescued (Mo et al., 1992Go; Taylor and Jorgensen, 1992Go). This has led to the assumption that Chs-deficient pollen lacks factors that are required for pollen tube growth and that wild-type stigmas can functionally complement with these factors (Mo et al., 1992Go).

In accordance to this, we observed that pollen tube growth was also strongly inhibited in self-pollinated Chs RNAi tomato plants, leading to parthenocarpic fruit development. Because both male and female Chs RNAi parents were hemizygous, and, hence, produced gametes segregating for the transgene, the observed effects on pollen tube growth, seed set, and parthenocarpic development are probably determined by parental tissues. The tapetum and, consequently, pollen wall assembly, as well as the maternal tissues such as stigma and the style, can play crucial roles in functional pollen rehydration, polarization, and pollen tube migration into the stigma. Control of these processes likely requires constant interaction between pollen tube and stigma (Mascarenhas 1993Go; Edlund et al., 2004Go).

Pollen tube growth and seed set was fully rescued when CHS-deficient pollen was applied on wild-type stigmas. The reciprocal crossing (wild-type pollen on Chs RNAi stigmas) resulted in only a partial rescue of pollen tube growth and seed set, indicating that in Chs RNAi tomatoes fertilization is mainly diminished due to the lack of flavonoids in the female reproductive organ.

Pollination appeared to be required for parthenocarpic fruit development in Chs RNAi lines because in the absence of pollination no fruits were obtained. This suggests that pollination is required and sufficient to trigger fruit setting and that fertilization and subsequent seed set are key determinants for normal fruit development and expansion.

Hormones play an important role in regulating fruit development. It is well known that pollen produces gibberellins and that application of gibberellins can induce an increase in the content of auxin in the ovaries of unpollinated flowers of the tomato plant, thereby triggering fruit set in the absence of fertilization (Sastry and Muir, 1963Go; Gorguet et al., 2005Go). A crucial role for auxin in seedless tomato fruit formation was directly demonstrated by ovule-specific overexpression of bacterial auxin biosynthetic genes, leading to seedless fruit production independent of pollination (Rotino et al., 1997Go). Furthermore, down-regulation of the tomato Aux/IAA transcription factor IAA9 resulted in auxin-hypersensitive tomato plants in which fruit development was triggered before fertilization and independent of pollination, leading to parthenocarpic fruits (Wang et al., 2005Go).

During normal fruit set, auxins are produced by the pollen tube as it grows through the style and later on by the embryo and endosperm in the developing seeds. The latter two sources of auxin are clearly diminished or even absent in Chs-deficient parthenocarpic tomato plants, suggesting that these auxin sources are not required to induce fruit setting but may be important in later stages of fruit development, such as fruit expansion.

A possible direct role for flavonoids in auxin distribution and GA synthesis has been proposed by several research groups, and there is accumulating evidence supporting this view. For example, loss of CHS activity in Arabidopsis caused an increase in polar auxin transport (Brown et al., 2001Go). Recently, additional evidence that flavonoids act as auxin transport inhibitors was obtained from experiments with Chs RNAi-silenced Medicago truncatula plants; the flavonoid-deficient roots of these plants showed increased auxin transport relative to wild type and were unable to initiate root nodulation (Wasson et al., 2006Go). So, it may well be that the reduction in flavonoid levels in Chs RNAi tomatoes affects the synthesis, stability, or distribution of hormones such as auxins or gibberellins, leading to parthenocarpic fruit development. Such an interaction, however, remains to be demonstrated.

Several tomato mutant genotypes resulting in parthenocarpic fruit growth have been described, of which pat (Mazzucato et al., 2003Go), pat2 (Philouze and Maisonneuve, 1978Go), pat3, and pat4 (Nuez et al., 1986Go) are the best characterized. In contrast to the Chs RNAi tomato, parthenocarpic fruit development of all these pat mutants is independent of pollination. At least some of these mutants (pat2, pat3, and pat4) contain increased GA levels in their parthenocarpic fruits, suggesting that the ability of these mutants to develop parthenocarpic fruits is due to alterations in GA metabolism (Fos et al., 2000Go, 2001Go). Clearly, fruit development is controlled by complex processes, including multiple plant growth hormones and cross talk between regulatory plant hormones.

In this article, we described the effect of decreasing flavonoid levels in Chs RNAi transgenic tomato plants on pollination, fertility, and fruit development. This approach may provide a new method to obtain parthenocarpic fruits.

Efficient RNAi silencing using flavonoid genes has been reported recently in Medicago and soybean (Glycine max; Subramanian et al., 2005Go; Wasson et al., 2006Go). In these studies, as well as the Chs RNAi tomato described here, relatively large RNAi constructs were used. Therefore, unintended effects due to aspecific silencing by small interfering RNAs derived from the larger RNAi construct (Jackson and Linsley, 2004Go; Schwab et al., 2006Go) cannot be completely ruled out. However, no putative unintended target genes of the tomato Chs RNAi were identified by in silico comparison of small (20 nucleotides) perfect matching stretches, derived from the Chs RNAi gene construct, to the Dana-Farber Cancer Institute tomato gene index (release 11.0; June 21, 2006) using Vmatch (Kurtz et al., 2001Go). Although the RNAi machinery in plants appeared to be much more specific than in animals (Schwab et al., 2006Go), silencing of unintended target genes, due to small interfering RNAs derived from Chs RNAi, is highly unlikely but cannot be excluded. Future experiments using smaller Chs RNAi constructs could provide more insight in the specificity of the Chs RNAi approach described here.

For a successful commercial application of this technology, it is an essential prerequisite that these parthenocarpic fruits have a good taste. To address whether or not the parthenocarpic phenotype dramatically affects fruit taste, we measured the levels of the most important taste- and flavor-related tomato metabolites (sugars, organic acids, and 16 volatiles; Yilmaz, 2001Go; Ruiz et al., 2005Go) in Chs RNAi and wild-type tomatoes. For both wild-type and Chs RNAi fruits, the levels of flavor-related volatile compounds fell well within the variation observed in a collection of 94 commercially available tomato cultivars (Tikunov et al., 2005Go). Similar results were obtained for sugars (Suc, Fru, and Glc) and organic acids (citric acid and malic acid; results not shown), suggesting that these parthenocarpic tomatoes potentially have a normal tomato-like taste.

Controllable parthenocarpic fruit development with minimal side effects would also be of great value for future commercial applications. This could be achieved by using flower- or early fruit-specific promoters to drive Chs RNAi gene expression. The latter strategy could also be important to avoid potential adverse effects of flavonoid down-regulation on, for example, disease resistance, as was reported for the RNAi-mediated inhibition of isoflavonoid synthase in soybean (Subramanian et al., 2005Go). There were, however, no indications for increased susceptibility to pathogens of the Chs RNAi tomato plants under the growth conditions used in this study.

Inducible parthenocarpy could also be achieved by using inducible promoters, such as the ethanol-inducible alc gene expression system (Deveaux et al., 2003Go). As an alternative to the Chs RNAi approach, parthenocarpic fruit development can also be achieved by overexpression of the grape stilbene synthase gene. The stilbene synthase enzyme competes with CHS for the same substrates, and overexpression resulted in decreased flavonoid levels and male sterile pollen in tobacco (Fischer et al., 1997Go). Using this strategy, a significantly decreased seed set in tomato fruits was observed (Giovinazzo et al., 2005Go; Schijlen et al., 2006Go).

Even more desirable for the breeding industry may be the development of parthenocarpic tomato lines with inducible seed set rather than inducible parthenocarpy. For example, seed set in parthenocarpic Chs RNAi plants could be rescued by stimulating the flavonoid pathway through inducible overexpression of the transcription factors Lc/C1 (Bovy et al., 2002Go) in Chs RNAi lines.

This report demonstrates the use of a flavonoid gene to induce parthenocarpic fruit development in tomato. The strict requirement for pollination to obtain parthenocarpic fruit development suggests a close mechanistic link to the essential role flavonoids play in pollen development. Further research is needed, however, to better understand the role of flavonoids in hormone-related processes such as parthenocarpic fruit development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plasmid Construction

A full-length cDNA-encoding tomato (Solanum lycopersicum) NAR-CHS-1 (Chs1; X55194) was obtained from a cDNA library of tomato fruits.

Two oligonucleotides, CHS-3'BamHI (GGATCCACTAAGCAGCAACAC) and CHS-5'SalI (GTCTCGTCGACATGGTCACCGTGGAGGA) were used to introduce a BamHI restriction site at the 3' end and a SalI site at the 5' end of the Chs1 sequence. The PCR product was digested and ligated as a BamHI/SalI fragment into pFLAP50, a pUC-derived vector containing a fusion of the double CaMV 35S promoter (Pd35S) and the Agrobacterium tumefaciens nos terminator (Tnos). The resulting plasmid was designated as pHEAP-02.

To create an inverted repeat construct, a sense cDNA fragment was cloned between the promoter sequence and the anti-sense Chs1. Therefore, an 801-bp fragment was obtained by PCR amplification using two primers with restriction sites for BglII (forward primer CCCAGATCTATGGTCACCGTGGAGGAGTA; reverse primer CCCAGATCTTCACGTAAGGTGTCCGTCAA) The BglII-digested PCR fragment was cloned in the BamHI-digested plasmid HEAP-02, resulting in the plasmid pHEAP-17. The Pd35S-Chs1 inverted repeat-Tnos construct was transferred as a PacI/AscI fragment into pBBC90, a derivative of the plasmid pGPTV-KAN(11), and the final binary plasmid was designated pHEAP-20.


Plant Transformation

The plasmid pHEAP-20 was transferred to A. tumefaciens strain COR308 by the freeze-thaw method (Gynheung et al., 1988Go). The Agrobacterium-mediated tomato (hypocotyls) transformation (‘Moneymaker’) was performed according to the standard protocol (Fillatti et al., 1987Go). Kanamycin-resistant shoots were grown under controlled greenhouse conditions in Wageningen, The Netherlands. Plants were grown on rock-wool plugs connected to an automatic irrigation system comparable to standard commercial cultivation conditions with a minimum temperature set point of 19°C during daytime and 17°C at night. To compensate for the lack of sunlight, between autumn and spring, supplementary high pressure sodium light was provided with a minimum light intensity of, on average, 17 W m–2 at a photoperiod of 16 h light:8 h dark. All plants were self-pollinated to produce fruits and offspring.

The transgenic status of tomato plants was confirmed by PCR analysis on young leaf material according to manufacturers protocol (X-amp PCR; Sigma-Aldrich).

High molecular weight genomic DNA was isolated from young leaves of tomato, as described by Dellaporta et al. (1983)Go. Insert copy number of transgenic plants was determined by Southern-blot hybridization according to manufacturer's protocol (DIG labeling; Roche) using 10 µg BglII-digested genomic DNA and npt-II as probe.

For further analysis (HPLC, DNA, and RNA), fruits were harvested when visually ripe. From each selected primary transformant, three cuttings were made and grown to maturity. From each plant, at least three fruits were pooled for extraction to minimize sample variation. The fruit peel (approximately 2 mm consisting of cuticula, epidermis, and subepidermis) was separated from the flesh tissue (i.e. columella; jelly parenchyma and seeds excluded) and immediately frozen in liquid nitrogen. In addition to fruit material, young leaves were also collected and frozen in liquid nitrogen to store at –80°C for later use.


HPLC Analysis

Flavonoid content was determined both as glycosides and aglycones by preparing nonhydrolyzed and acidic-hydrolyzed extracts, respectively. Nonhydrolyzed extracts were prepared in 75% (w/v) aqueous methanol using 15 min of sonication. Subsequent HPLC of the extracted flavonoids was performed with a gradient of 5% to 50% acetonitrile in 0.1% formic acid. Absorbance spectra and retention times of eluting peaks were compared with those of commercially available flavonoid standards (Apin Chemicals). Analysis of flavonoids in the extracts was performed by reverse phase HPLC (Phenomenex Luna 3 µm C18, 150 x 4, 50-mm column, at 40°C) with photodiode array detection (Waters 996).


RNA Isolation

Total RNA was isolated from tomato fruits as described previously (Bovy et al., 1995Go). After DNAse-I treatment and RNeasy column purification (Qiagen), the total RNA yield was measured by absorption at 260 nm. To determine the RNA quality, a small amount (1 µg) of each sample was evaluated on a 1% Tris-acetate EDTA agarose gel.


RT-PCR Gene Expression Analysis

Real-time quantitative RT-PCR analysis was performed to test the effect of the RNAi construct on the endogenous Chs gene expression levels. Sequence detection primers were designed based on the published tomato Chs sequences from tomato (Chs1; X55194 and Chs2; X55195) using the SDS 1.9 software (Applied Biosystems). All primers (Table I) were synthesized by Applied Biosystems. Then 2 µg total RNA was used for cDNA synthesis using Superscript II reverse transcriptase (Invitrogen) in a 100-µL final volume according to the standard protocol. For each of the three biological replicates of each transgenic line, Chs1 and Chs2 expression was measured in triplicate using SYBR-green RT-PCR on the ABI 7700 sequence detection system. Chs gene expression was expressed relative to the constitutively expressed ribosomal protein gene L33 (TC85035). Calculations of the expression in each sample were carried out according to the standard curve method (PE Applied Biosystems).


Enzyme Assay

NAR was from Roth. [2-14C]Malonyl-CoA (spec. act. 53 mCi/mmol) was from Hartmann Analytic. 4-Coumaryol-CoA was a gift from W. Heller (Neuherberg, Germany). [4a,6,8-14C]NAR was prepared as described by S. Martens (unpublished data) using recombinant CHS and chalcone isomerase. Radioactivity incorporated in labeled substrate was quantified by scanning sample aliquots after migration on cellulose plates (Merck) using a bio-Imaging Analyzer Fuji BAS FLA 2000 (Raytest) and by direct scintillation counting (LKB Wallac 1214 Rackbeta; PerkinElmer Wallac).

Proteins were extracted from grounded fruit tissue as follows: 200 mg tissue was homogenized with 100 mg sea sand, 200 mg Dowex 200-400 mesh (äquil. 0.1 M Tris-HCl, pH 7.5) in 1 mL of 0.1 M Tris-HCl, pH 7.5, containing 20 mM sodium ascorbate. After two centrifugation steps at 10,000g (Sorvall RMC 14; Du Pont Nemours) for 5 min at 4°C, the resulting supernatant was directly used for CHS assays. Protein concentration was determined according to Bradford (1976)Go using bovine serum albumin as a standard. For each sample, two independent preparations were performed.

Standard assays for CHS was performed in a final volume of 200 µL and contained: 140 µL of 0.1 M Tris-HCl, pH 7.5, 50 µL of crude extract (8–22 µg protein), 5 µL of [2-14C]malonyl-CoA (1.5 nmol; approximately 1,800 Bq), and 5 µL of 4-coumaroyl-CoA (1 nmol). After incubation, reactions were stopped and extracted twice with 100 µL ethyl acetate. The pooled ethyl acetate phase from each assay was directly subjected to scintillation counter for quantification or chromatographed on cellulose plates with either chloroform:acetic acid:water; 50:45:5) or 15% acetic acid. For each enzyme preparation, CHS assays were performed in triplicate. Labeled products were localized and quantified by scanning the plates as above described. Product identification was done by cochromatography with authentic samples.


In Vivo Pollen Tube Growth

Mature closed flowers were emasculated and pollinated. Two days after pollination, pistils were harvested and incubated overnight at 60°C in 1 M KOH. After rinsing with water, pistils were transferred to a microscope slide and stained with 0.005% aniline in 50% Gly. A coverslip was placed on top and pressed gently. Callose in the pollen tubes was visualized by UV light on a Zeiss Axioskop microscope and photographed using 400 ASA film. Slides were scanned with an AGFA duoscan scanner.


Cryo-Scanning Electron Microscopy

Small samples of material were dissected from fresh fruits, mounted on a stub, and subsequently frozen in liquid nitrogen. The samples were further prepared in an Oxford Alto 2500 cryo-system (Catan) and then analyzed in a JEOL JSM-6330F field emission electron scanning microscope. The frozen samples were fractionated inside the cryo system for cross views.

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers X55194 and X55195.

Received March 27, 2007; accepted April 27, 2007; published May 3, 2007.


    FOOTNOTES
 
The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Elio G.W.M. Schijlen (elio.schijlen{at}wur.nl).

[C] Some figures in this article are displayed in color online but in black and white in the print edition. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.107.100305

* Corresponding author; e-mail elio.schijlen{at}wur.nl; fax 31–317–41–80–94.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Abad M, Monteiro AA (1989) The use of auxins for the production of greenhouse tomatoes in mild winter conditions: a review. Sci Hortic (Amsterdam) 38: 167–192[CrossRef]

Brown DE, Rashotte AM, Murphy AS, Normanly J, Tague BW, Peer WA, Taiz L, Muday GK (2001) Flavonoids act as negative regulators of auxin transport in vivo in Arabidopsis. Plant Physiol 126: 524–535[Abstract/Free Full Text]

Bovy A, de Vos R, Kemper M, Schijlen E, Almenar Pertejo M, Muir S, Collins G, Robinson S, Verhoeyen M, Hughes S, et al (2002) High-flavonol tomatoes resulting from heterologous expression of the maize transcription factor gene Lc and C1. Plant Cell 14: 2509–2526[Abstract/Free Full Text]

Bovy A, van den Berg C, de Vrieze G, Thompson WF, Weisbeek P, Smeekens S (1995) Light-regulated expression of the Arabidopsis thaliana ferredoxin gene requires sequences upstream and downstream of the transcription initiation site. Plant Mol Biol 27: 27–39[CrossRef][Web of Science][Medline]

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254[CrossRef][Web of Science][Medline]

Burbulis IE, Iacobucci M, Shirley BW (1996) A null mutation in the first enzyme of flavonoid biosynthesis does not affect male fertility in Arabidopsis. Plant Cell 8: 1013–1025[Abstract]

Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version II. Plant Mol Biol Rep 1: 19–21[CrossRef]

Deveaux Y, Peaucelle A, Roberts GR, Coen E, Simon R, Mizukami Y, Traas J, Murray JA, Doonan JH, Laufs P (2003) The ethanol switch: a tool for tissue-specific gene induction during plant development. Plant J 36: 918–930[CrossRef][Web of Science][Medline]

Edlund AF, Swanson R, Preuss D (2004) Pollen and stigma structure and function: the role of diversity in pollination. Plant Cell (Suppl) 16: S84–S97

Falavigna A, Baldino M, Soressi GP (1978) Potential of the mono Mendelian factor pat in tomato breeding for industry. Genet Agrar 32: 159–160

Fillatti JJ, Kiser J, Rose R, Comai L (1987) Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium tumefaciens vector. Bio/Technol 5: 726–730[CrossRef]

Fischer R, Budde I, Hain R (1997) Stilbene synthase gene expression causes changes in flower colour and male sterility in tobacco. Plant J 11: 489–498[CrossRef][Web of Science]

Fos M, Nuez F, García-Martínez JL (2000) The pat-2 gene, which induces natural parthenocarpy, alters gibberellin content in unpollinated tomato ovaries. J Plant Physiol 122: 471–479[CrossRef]

Fos M, Proaño K, Nuez F, García-Martínez JL (2001) Role of gibberellins in parthenocarpic fruit development induced by the genetic system pat-3/pat-4 in tomato. Physiol Plant 111: 545–550[CrossRef][Medline]

Giovinazzo G, D'Amico L, Paradiso A, Bollino R, Sparvoli F, DeGara L (2005) Antioxidant metabolite profiles in tomato fruit constitutively expressing the grapevine stilbene synthase gene. Plant Biotechnol J 3: 57–69[CrossRef][Medline]

Gorguet B, van Heusden AW, Lindhout P (2005) Parthenocarpic fruit development in tomato. Plant Biol 7: 131–139[CrossRef][Medline]

Gustafson FG (1942) Parthenocarpy: natural and artificial. Bot Rev 8: 599–654[CrossRef]

Gynheung AN, Ebert PR, Mitra A, Ha SB (1988) Binary vectors. In S Gelvin, R Schilperoort, D Verma, eds, Plant Molecular Biology Manual. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp A3/1–19

Hunt JM, Baker EA (1980) Phenolic constituents of tomato fruit cuticles. Phytochemistry 19: 1415–1419[Web of Science]

Jackson AL, Linsley PS (2004) Noise amidst the silence: off-target effects of siRNAs? Trends Genet 20: 521–524[CrossRef][Web of Science][Medline]

Jorgensen RA, Dooner HK (1986) Activity of anthocyanin biosynthetic enzymes and CHS in anthocyanin deficient mutants in tomato. Tomato Genet Coop Rep 36: 6–7

Koes RE, Quattrocchio F, Mol JNM (1994) The flavonoid biosynthetic pathway in plants: function and evolution. Bioessays 16: 123–132[CrossRef][Web of Science]

Kurtz S, Choudhuri JV, Ohlebusch E, Schleiermacher C, Stoye J, Giegerich R (2001) REPuter: the manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res 29: 4633–4642[Abstract/Free Full Text]

Mascarenhas JP (1993) Molecular mechanisms of pollen tube growth and differentiation. Plant Cell 5: 1303–1314[Free Full Text]

Mazzucato A, Olimpieri I, Ciampolini F, Cresti M, Soressi GP (2003) A defective pollen-pistil interaction contributes to hamper seed set in the parthenocarpic fruit tomato mutant. Sex Plant Reprod 16: 157–164[CrossRef]

Mo Y, Nagel C, Taylor LP (1992) Biochemical complementation of chalcone synthase mutants defines a role for flavonols in functional pollen. Proc Natl Acad Sci USA 89: 7213–7217[Abstract/Free Full Text]

Mol J, Grotewold E, Koes R (1998) How genes paint flowers ands seeds. Trends Plant Sci 3: 212–217[CrossRef][Web of Science]

Muir SR, Collins GJ, Robinson S, Hughes S, Bovy S, De Vos CH, van Tunen AJ, Verhoeyen ME (2001) Overexpression of petunia chalcone isomerase in tomato results in fruit containing increased levels of flavonols. Nat Biotechnol 19: 470–474[CrossRef][Web of Science][Medline]

Napoli CA, Fahy D, Wang HY, Taylor LP (1999) White anther: a Petunia mutant that abolishes pollen flavonol accumulation, induces male sterility, and is complemented by a chalcone synthase transgene. Plant Physiol 120: 615–622[Abstract/Free Full Text]

Noda K, Glover BJ, Linstead P, Martin C (1994) Flower colour intensity depends on specialized cell shape controlled by a Myb-related transcription factor. Nature 369: 661–664[CrossRef][Medline]

Nuez F, Costa J, Cuartero J (1986) Genetics of the parthenocarpy for tomato varieties ‘Sub-Arctic Plenty’, ‘75/59’ and ‘Severianin’. Z Pflanzenzüchtung 96: 200–206

O'Neill SD, Tong Y, Sporlein B, Forkmann G, Yoder YI (1990) Molecular genetic analysis of chalcone synthase in Lycopersicon esculentum and an anthocyanin-deficient mutant. Mol Gen Genet 224: 279–288[CrossRef][Web of Science][Medline]

Philouze J, Maisonneuve B (1978) Heredity of the natural ability to set parthenocarpic fruits in the Soviet variety Severianin. Tomato Genet Coop Rep 28: 12–13

Rotino GL, Perri E, Zottini M, Sommer H (1997) Genetic engineering of parthenocarpic plants. Nat Biotechnol 15: 1398–1401[CrossRef][Web of Science][Medline]

Ruiz JJ, Alonso A, Garcia-Martinez S, Valer M, Blasco P, Ruiz-Bevia F (2005) Quantitative analysis of flavour volatiles detects differences among closely related traditional cultivars of tomato. J Sci Food Agric 85: 54–60[CrossRef][Web of Science]

Sastry K, Muir R (1963) Gibberellin: effect on diffusible auxin in fruit development. Science 140: 494–495[Abstract/Free Full Text]

Schijlen E, de Vos CHR, Jonker H, van den Broeck H, Molthoff J, van Tunen A, Martens S, Bovy A (2006) Pathway engineering for healthy phytochemicals leading to the production of novel flavonoids in tomato fruit. Plant Biotechnol J 4: 433–444[CrossRef][Medline]

Schwab R, Ossowski S, Riester M, Warthmann N, Weigel D (2006) Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cell 18: 1121–1133[Abstract/Free Full Text]

Subramanian S, Graham MY, Yu O, Graham TL (2005) RNA interference of soybean isoflavone synthase genes leads to silencing in tissue distal to the transformation site and to enhanced susceptibility to Phytophthora sojae. Plant Physiol 137: 1345–1353[Abstract/Free Full Text]

Taylor LP, Jorgensen R (1992) Conditional male fertility in chalcone synthase-deficient Petunia. J Hered 83: 11–17[Abstract/Free Full Text]

Tikunov Y, Lommen A, de Vos CHR, Verhoeven HA, Bino RJ, Hall RD, Bovy AG (2005) A novel approach for nontargeted data analysis for metabolomics. Large-scale profiling of tomato fruit volatiles. Plant Physiol 139: 1125–1137[Abstract/Free Full Text]

Van der Meer IM, Stam ME, Van Tunen AJ, Mol JN, Stuitje AR (1992) Antisense inhibition of flavonoid biosynthesis in Petunia anthers results in male sterility. Plant Cell 4: 253–262[Abstract/Free Full Text]

van Houwelingen A, Souer E, Spelt K, Kloos D, Mol J, Koes R (1998) Analysis of flower pigmentation mutants generated by random transposon mutagenesis in Petunia hybrida. Plant J 13: 39–50[CrossRef][Web of Science][Medline]

Varoquaux F, Blanvillain R, Delseny M, Gallois P (2000) Less is better; new approaches for seedless fruit production. Trends Biotechnol 18: 233–242[CrossRef][Web of Science][Medline]

Wang H, Jones B, Li Z, Frasse P, Delalande C, Regad F, Chaabouni S, Latche A, Pech J-C, Bouzayen M (2005) The tomato Aux/IAA transcription factor IAAg is involved in fruit development and leaf morphogenesis. Plant Cell 17: 2676–2692[Abstract/Free Full Text]

Wasson AP, Pellerone FI, Mathesius U (2006) Silencing the flavonoid pathway in Medicago truncatula inhibits root nodule formation and prevents auxin transport regulation by Rhizobia. Plant Cell 18: 1617–1629[Abstract/Free Full Text]

Wiermann R (1979) Stage specific phenylpropanoid metabolism during pollen development. In M Luckner, L Schreiber, eds, Regulation of Secondary Product and Plant Hormone Metabolism. Pergamon Press, Oxford, pp 231–239

Yilmaz E (2001) The chemistry of fresh tomato flavor. Turk J Agric For 25: 149–155

Ylstra B, Muskens M, van Tunen AJ (1996) Flavonols are not essential for fertilization in Arabidopsis thaliana. Plant Mol Biol 32: 1155–1158[CrossRef][Web of Science][Medline]

Ylstra B, Touraev A, Benito Moreno RM, Stöger E, van Tunen AJ, Vicente O, Mol JNM, Heberle-Bors E (1992) Flavonols stimulate development, germination and tube growth of tobacco pollen. Plant Physiol 100: 902–907[Abstract/Free Full Text]

Yoder JI, Belzile F, Tong Y, Goldsbrough A (1994) Visual markers for tomato derived from the anthocyanin biosynthetic pathway. Euphytica 79: 163–167[CrossRef][Web of Science]


Related articles in Plant Physiol.:

On the Inside
Peter V. Minorsky
Plant Physiol. 2007 144: 1235-1236. [Full Text]  



This article has been cited by other articles:


Home page
J Exp BotHome page
K. Hanhineva, H. Kokko, H. Siljanen, I. Rogachev, A. Aharoni, and S. O. Karenlampi
Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragariaxananassa)
J. Exp. Bot., May 1, 2009; 60(7): 2093 - 2106.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
C. Ringli, L. Bigler, B. M. Kuhn, R.-M. Leiber, A. Diet, D. Santelia, B. Frey, S. Pollmann, and M. Klein
The Modified Flavonol Glycosylation Profile in the Arabidopsis rol1 Mutants Results in Alterations in Plant Growth and Cell Shape Formation
PLANT CELL, June 1, 2008; 20(6): 1470 - 1481.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S. Mintz-Oron, T. Mandel, I. Rogachev, L. Feldberg, O. Lotan, M. Yativ, Z. Wang, R. Jetter, I. Venger, A. Adato, et al.
Gene Expression and Metabolism in Tomato Fruit Surface Tissues
Plant Physiology, June 1, 2008; 147(2): 823 - 851.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/3/1520    most recent
pp.107.100305v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Plant Physiol.
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schijlen, E. G.W.M.
Right arrow Articles by Bovy, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schijlen, E. G.W.M.
Right arrow Articles by Bovy, A. G.
Agricola
Right arrow Articles by Schijlen, E. G.W.M.
Right arrow Articles by Bovy, A. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2007 by the American Society of Plant Biologists