Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online April 27, 2007; 10.1104/pp.107.100677

Plant Physiology 144:1546-1558 (2007)
© 2007 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/3/1546    most recent
pp.107.100677v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lemaitre, T.
Right arrow Articles by Hodges, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lemaitre, T.
Right arrow Articles by Hodges, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITROGEN
Agricola
Right arrow Articles by Lemaitre, T.
Right arrow Articles by Hodges, M.
BIOCHEMICAL PROCESSES AND MACROMOLECULAR STRUCTURES

NAD-Dependent Isocitrate Dehydrogenase Mutants of Arabidopsis Suggest the Enzyme Is Not Limiting for Nitrogen Assimilation1,[C]

Thomas Lemaitre2, Ewa Urbanczyk-Wochniak3, Valerie Flesch, Evelyne Bismuth, Alisdair R. Fernie and Michael Hodges*

Institute de Biotechnologie des Plantes, Unité Mixte de Recherche, Centre National de la Recherche Scientifique 8618, Université de Paris Sud-XI, 91405 Orsay cedex, France (T.L., V.F., E.B., M.H.); and Abteilung Willmitzer, Max-Planck-Institut für Molekulare Pflanzenphysiologie, 14476 Postdam-Golm, Germany (E.U.-W., A.R.F.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
NAD-dependent isocitrate dehydrogenase (IDH) is a tricarboxylic acid cycle enzyme that produces 2-oxoglutarate, an organic acid required by the glutamine synthetase/glutamate synthase cycle to assimilate ammonium. Three Arabidopsis (Arabidopsis thaliana) IDH mutants have been characterized, corresponding to an insertion into a different IDH gene (At5g03290, idhv; At4g35260, idhi; At2g17130, idhii). Analysis of IDH mRNA and protein show that each mutant lacks the corresponding gene products. Leaf IDH activity is reduced by 92%, 60%, and 43% for idhv, idhi, and idhii, respectively. These mutants do not have any developmental or growth phenotype and the reduction of IDH activity does not impact on NADP-dependent isocitrate dehydrogenase activity. Soil-grown mutants do not exhibit any alterations in daytime sucrose, glucose, fructose, citrate, ammonium, and total soluble amino acid levels. However, gas chromatography-mass spectrometry metabolic profiling analyses indicate that certain free amino acids are reduced in comparison to the wild type. These data suggest that IDH activity is not limiting for tricarboxylic acid cycle functioning and nitrogen assimilation. On the other hand, liquid culture-grown mutants give a reduced growth phenotype, a large increase in organic acid (citrate is increased 35-fold), hexose-phosphate, and sugar content, whereas ammonium and free amino acids are moderately increased with respect to wild-type cultures. However, no significant changes in 2-oxoglutarate levels were observed. Under these nonphysiological growth conditions, pyridine nucleotide levels remained relatively constant between the wild-type and the idhv line, although some small, but significant, alterations were measured in idhii (lower NADH and higher NADPH levels). On the other hand, soil-grown idhv plants exhibited a reduction in NAD and NADPH content.


Mitochondrial metabolism is an important source of carbon skeletons, via the tricarboxylic acid (TCA) cycle, which are used in anabolic processes such as porphoryin and amino acid synthesis. In photosynthetic tissues, respiratory decarboxylation is lower in the light than in the dark (Kirschbaum and Farquhar, 1987Go; Rebeille et al., 1988Go; Tcherkez et al., 2005Go). It is believed that modulation of the TCA cycle is mediated by regulation of certain enzymes, such as the pyruvate dehydrogenase (PDH) complex and different NAD-dependent dehydrogenases of the cycle (Tovar-Méndez et al., 2003Go; Fernie et al., 2004aGo). The PDH complex appears to be an important regulatory point for carbon entry into the cycle and it can be inactivated in the light (Budde and Randall, 1990Go) by the phosphorylation of the E1{alpha}-subunit (for review, see Tovar-Méndez et al., 2003Go). Recent isotopic discrimination experiments suggest that PDH activity is reduced by 27%, whereas the CO2 liberated by the action of the TCA cycle is inhibited by up to 95% in the light (Tcherkez et al., 2005Go). Whereas the exact degree of reduction of activity of the TCA cycle in the light remains controversial (Nunes-Nesi et al., 2007Go), inhibition is clearly apparent to some level. The fact that the genes encoding the enzymes of the pathway are only subject to minor diurnal oscillation (Blasing et al., 2005Go; Urbanczyk-Wochniak et al., 2005Go) suggests that this inhibition is mediated at the posttranslational level. One possible explanation could be that it reflects the effect of high NADH levels on the activity of mitochondrial NAD-dependent dehydrogenases. Indeed, in other organisms, NAD-dependent isocitrate dehydrogenase (IDH) is believed to be a key regulatory step of the TCA cycle due to its low extractable activity (and lower maximal capacity than other TCA cycle enzymes) and its regulation by key metabolites such as NADH, AMP, and ADP (Nichols et al., 1994Go; Zhao and McAlister-Henn, 1997Go). Given these facts, conversion of isocitrate to 2-oxoglutarate via the activity of IDH is often regarded as a major controlling point in plant mitochondria (Wiskich and Dry, 1985Go; Cornu et al., 1996Go; McIntosh, 1997Go; Igamberdiev and Gardeström, 2003Go). The reaction catalyzed by IDH transforms isocitrate to 2-oxoglutarate, which subsequently can be either reduced in the mitochondria, to give succinyl-CoA, or exported to the plastids, where it can be used in nitrogen metabolism by the Gln synthetase/Glu synthase (GS-GOGAT) cycle to produce Glu (Gálvez et al., 1999Go). Because TCA cycle activity is modified in the light, carbon skeletons for ammonium assimilation could come from a second pathway involving the action of the cytosol-located aconitase and NADP-dependent isocitrate dehydrogenase (ICDH; Chen and Gadal, 1990Go). Indeed, it has been shown that, in the light, citrate is the major organic acid exported from the mitochondria (Hanning et al., 1999Go). However, potato (Solanum tuberosum; Kruse et al., 1998Go) and tobacco (Nicotiana tabacum) plants (Gálvez et al., 1999Go) containing only 6% to 10% ICDH activity show neither growth nor developmental phenotypes, suggesting the activity to be nonessential. Intriguingly, this observation seems to hold true across kingdoms because it proved necessary to remove both cytosolic and mitochondrial ICDH in addition to IDH to obtain yeast (Saccharomyces cerevisiae) Glu auxotrophs (Zhao and McAlister-Henn, 1996Go). However, it should be noted that yeast cells lacking IDH activity are unable to grow on carbon sources, such as ethanol and acetate (Cupp and McAlister-Henn, 1991Go, 1992Go).

In yeast, two genes encode IDH subunits (Cupp and McAlister-Henn, 1991Go, 1992Go): IDH2 has been termed the catalytic subunit, whereas IDH1 is involved in regulating enzymatic activity (Lin and McAlister-Henn, 2003Go). Active yeast IDH is an octomer composed of IDH1-IDH2 dimers. In plants such as Arabidopsis (Arabidopsis thaliana) and tobacco, IDH is a heteromeric enzyme made up of at least one catalytic and one regulatory subunit (Lancien et al., 1998Go; Lemaitre and Hodges, 2006Go). The Arabidopsis genome contains five IDH genes (Lin et al., 2004Go; Lemaitre and Hodges, 2006Go) coding different subunits, whereas only three genes have been found in tobacco (Lancien et al., 1998Go) and rice (Oryza sativa; Abiko et al., 2005Go). It has been proposed from expression analyses that IDH could be the source of carbon skeletons for the assimilation of ammonium in tobacco (Lancien et al., 1999Go) and rice (Abiko et al., 2005Go). Recently, an Arabidopsis knockout mutant for AtIDHII was partially analyzed. This plant contained only 55% of the IDH activity found in its corresponding wild-type accession; however, this did not result in a growth or developmental phenotype. Further characterization revealed that both mitochondrial respiration and leaf photosynthesis were also invariant between the mutant and wild-type genotypes (Lin et al., 2004Go). In contrast, characterization of a range of transgenic plants exhibiting reduced activity of TCA cycle enzymes, including citrate synthase (Landschütze et al., 1995Go), aconitase (Carrari et al., 2003Go), and NAD-dependent malate dehydrogenase (Nunes-Nesi et al., 2005Go), showed that the TCA cycle was of major importance during the vegetative to generative transition, and suggested coordinate control of the major pathways of energy metabolism in actively photosynthesizing tissues (Raghavendra and Padmasree, 2003Go; Matsuo and Obokata, 2006Go).

Here we investigate the function of IDH in Arabidopsis by analysis of mutants affected in different IDH genes. The aim of this work was to understand the importance of IDH activity in the regulation of the TCA cycle and in producing 2-oxoglutarate for ammonium assimilation. Three mutants affecting the expression of IDH genes (AtIDHI [At4g35260], AtIDHII [At2g17130], and AtIDHV [At5g03290]; Lemaitre and Hodges, 2006Go) were isolated, characterized, and analyzed with respect to their growth and development, metabolic profiles (sugars, organic acids, and amino acids), and pyridine nucleotide levels under different growth conditions. The obtained results are discussed in the context of current models of the regulation of respiratory metabolism and nitrogen assimilation.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Isolation of IDH Insertion Mutants

Three IDH mutants have been isolated and characterized, each coming from a different mutant library (Fig. 1 ). A single AtIDHI (At4g35260) T-DNA insertion line (DYC 179) was identified in the Arabidopsis mutant collection of the Institut National de la Recherche Agronomique, Versailles (Bouchez et al., 1993Go), by sequential PCR screening of the available genomic DNA pools. A homozygous mutant for the insertion (idhi) was selected by PCR from T3 generation seed. The structure and localization of the T-DNA insertion was deduced from sequence analysis of the flanking PCR fragments using AtIDHI and T-DNA-specific primers. The insertion was located to the last intron of the AtIDHI gene (Fig. 1) and it led to a small deletion of 71 bp, 10 of these nucleotides being situated at the end of the third exon. The second AtIDH mutant (idhv) was identified in the Syngenta Arabidopsis Insertion Library (SAIL; Sessions et al., 2002Go). Seeds (line 806-A06) were obtained and a homozygous line was isolated by PCR. The T-DNA insertion was located to the fifth intron of AtIDHV (At5g03290), encoding the major catalytic subunit in leaves (Lemaitre and Hodges, 2006Go). Again, analysis of PCR-generated flanking regions showed a single T-DNA insertion and a 27-bp deletion in the intron (Fig. 1). The third AtIDH mutant (idhii) was identified as N100075 in the Ds-Institute of Molecular Agrobiology (IMA; Singapore) transposon-tagged library (Parinov et al., 1999Go). The insertion was located to the first exon of the AtIDHII gene (At2g17130), 77 bp downstream from the ATG initiation codon (Fig. 1). The insertion also led to a 2-bp deletion in the exon. This mutant has been described previously by Lin et al. (2004)Go. The analyzed homozygous line was obtained by crossing T4 seed-grown plants with the above-mentioned idhi mutant line (in an attempt to generate double mutants) and the consequent selfing of the resulting heterozygous AtIDHII/AtIDHI plants. No double mutants were obtained. Each homozygous mutant line appeared to contain a single insertion as judged by selection marker gene segregation analyses of selfed heterozygous plants that gave a ratio of one sensitive to three resistant plantlets.


Figure 1
View larger version (44K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Localization of the insertion within the AtIDH mutant lines studied in this work. Exons are given as arrows and introns as bent lines. The mutants originated from the following mutant libraries: idhv (SAIL), idhi (Versailles), and idhii (Ds-IMA). In the DNA sequences, the right border (RB) and left border (LB) of the insertions are given by the arrows. The deleted nucleotides are underlined. Exons are in capitals and the introns (or 5'-untranslated regions) are in lowercase letters.

 

IDH mRNA, Protein, and Activity in Mutant Lines Compared to Wild-Type Plants

To evaluate the impact of the insertions on the expression of the respective AtIDH genes, reverse transcription (RT)-PCR analyses were carried out with total RNA extracts from rosette leaves using AtIDH gene-specific primers (Fig. 2 ). Primers were chosen to amplify the entire coding region of each type of mRNA. This approach showed that the different mutant lines lacked IDH transcripts corresponding to the gene containing the insertion when compared to the respective wild-type plants (Fig. 2). To estimate the impact of reduced IDH gene expression on IDH protein levels, western-blot analyses were performed on mitochondrial-enriched soluble protein extracts from rosette leaves taken from each mutant line and compared to the equivalent wild-type leaf extract. This was carried out after protein separation by SDS-PAGE (Fig. 3A ) and by two-dimensional (2D) gel electrophoresis (Fig. 3B), the IDH protein being detected with antibodies raised against recombinant tobacco IDH antiserum (Lancien et al., 1998Go). These antibodies cross-react with each type of IDH subunit (catalytic and regulatory) and detect two major protein bands on SDS-PAGE, the lower one corresponding to the catalytic subunits. The identity of the bands being confirmed by the absence of the lower IDH band in leaf extracts from the idhv mutant (Fig. 3A). Furthermore, a reduced amount of the regulatory subunits (upper protein band) is apparent in this mutant in comparison to the wild type. Western-blot analysis of the two regulatory subunit mutants (idhi and idhii) using SDS-PAGE revealed the presence of the catalytic subunits and reduced level (idhi) or insignificant (idhii) difference in the upper IDH protein band (Fig. 3A). However, analysis of IDH protein by 2D electrophoresis/western-blot analyses showed that each mutant line was missing certain IDH protein spots. It can be seen that IDH antibodies cross-react with several proteins (separated between pH 5 and 8) that have the expected molecular mass (MM) of an IDH subunit (Fig. 3B, wild type). Interestingly, different protein spots appear to be lacking in each mutant line. In idhv leaf extracts, four major protein spots localized between pH 6 and 6.3 are missing (see box in Fig. 3B, idhv). In the idhi extracts, two protein spots have disappeared (between pH 7 and 7.4), whereas two different protein spots are lacking in the idhii leaf extracts (between pH 5.8 and 6; see Fig. 3B, idhi and idhii, respectively). These observations clearly show that each IDH mutant line is lacking different IDH proteins (as expected if the insertion disrupts the expression of a specific IDH gene). The exact reason for the presence on the 2D gels of several protein spots corresponding to a single gene product is, however, currently unknown.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. RT-PCR analysis of AtIDH expression in leaves of three insertion mutant lines. The presence of full-length IDH transcripts was investigated by RT-PCR using total RNA extracted from rosette leaves of the different IDH (idhv, idhi, and idhii) mutant lines (m) and their respective control plants (wild type [WT]). PCR was carried out using IDH gene-specific primers.

 

Figure 3
View larger version (42K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Western-blot analyses of IDH protein in leaves of the three AtIDH insertion mutant lines. Soluble proteins from mitochondrial-enriched leaf extracts were separated by SDS-PAGE (12% acrylamide; A) and 2D electrophoresis (isoelectric focusing, pH 5–8, and SDS-PAGE; B). IDH subunits were detected using antibodies raised against the recombinant tobacco IDH (Lancien et al., 1998Go). WT, Wild-type control extracts; idhv, idhi, and idhii, IDH mutant line extracts. Boxes show the absence of IDH proteins in the different mutant lines. IDH proteins migrated in between the 36.5- and 48.5-kD MM markers, thus indicating an approximate MM of 38 to 40 kD.

 
To evaluate the impact of the absence of a specific IDH subunit on IDH activity, in vitro IDH activity was measured using mitochondrial-enriched fractions of rosette leaves. This analysis revealed that idhi leaves contained 40% of wild-type IDH activity, idhii leaves exhibited an inhibition of 43% (as already reported by Lin et al., 2004Go), and the idhv mutant contained only 8% of the wild-type leaf IDH activity (Table I ). ICDH activity was unaltered in the same extracts used to measure IDH activity (Table I). Furthermore, total ICDH activity was measured in crude soluble protein extracts from rosette leaves of soil-grown plants. This ICDH activity reflects the major leaf isoform that is located to the cytosol (Gálvez et al., 1994Go; Chen, 1998Go). No differences in total soluble ICDH activity were observed between the idhv and Columbia (Co) extracts and between the idhi and Wassilevskija (WS) extracts (Table II ). Therefore, reduction in IDH activity does not bring about a compensatory increase in the NADP-dependent isoforms.


View this table:
[in this window]
[in a new window]

 
Table I. IDH and ICDH activity

Isocitrate dehydrogenase activity was measured in mitochondrial-enriched soluble protein fractions extracted from leaves of different mutant lines (idhi, idhii, and idhv) and their wild-type (WS, WSLer, and Co) counterparts grown under short-day conditions.

 

View this table:
[in this window]
[in a new window]

 
Table II. ICDH activity

Total ICDH activity was measured in total soluble protein extracts from leaves of different mutant lines (idhi, idhii, and idhv) and their wild-type (WS, WSLer, and Co) counterparts grown in soil or in liquid culture under short-day conditions. Measurements were carried out on three to four independent plants (soil) or three plant cultures each containing 50 plantlets (liquid culture) and SDs are given. nd, Not determined.

 

Growth and Development of AtIDH Mutants

Previous analyses of mutants affected in TCA cycle enzymes have shown effects on flower development (Landschütze et al., 1995Go), altered growth kinetics (Carrari et al., 2003Go), and enhanced fruit biomass (Nunes-Nesi et al., 2005Go). The different AtIDH mutants and their corresponding wild-type counterparts were grown under different conditions to investigate the effect of differing IDH activities on plant growth and development. When the three mutant lines were germinated and grown in the greenhouse under nonlimiting conditions of light, water, and mineral nutrition, no observable differences were detected in germination, plant growth, or development or flowering time. An absence of growth phenotype was also seen when the idhv mutant (only 8% of the wild-type IDH activity) was cultured in a controlled growth chamber under either high (500 µE m–2 s–1) or low (75 µE m–2 s–1) light. Because IDH has been reported to be a key TCA cycle enzyme and perhaps involved in the synthesis of 2-oxoglutarate for ammonium assimilation (Gálvez et al., 1999Go), it was decided that metabolic analysis of each mutant would be undertaken to better understand the impact of reduced IDH activity on carbon and nitrogen metabolism.


Metabolic Analyses

We first decided to investigate the sugar and nitrogen status of the different IDH mutants. Sugar (Glc, Fru, and Suc) and citrate content was measured before and after illumination and during the day period because it is known that these metabolites show diurnal changes in their extractable amounts (Blasing et al., 2005Go; Urbanczyk-Wochniak et al., 2005Go). It was hypothesized that perhaps the reduction in IDH activity might impact on the diurnal accumulation of these carbon metabolites. Figure 4 shows the results concerning the idhv mutant that contains a severe reduction in leaf IDH activity of 92%. Both wild-type and mutant plants exhibited an increase in Suc, Glc, and Fru levels during the light period that declined at the end of the day (Fig. 4A). However, no differences could be detected in rosette leaf sugar levels during the day between the idhv mutant and the wild-type rosette leaves. Similar observations were found for idhi and idhii mutants (data not shown). Surprisingly, leaf citrate levels were not modified in idhv mutant leaves when compared to the wild type (Fig. 4B), and this was also the case for the other two IDH mutants (data not shown). Soluble free amino acids and ammonium ion content were also invariant between the idhv mutant and Co (Table III ).


Figure 4
View larger version (22K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Daytime changes in sugar and citrate levels in growth chamber-grown wild-type and idhv rosette leaves. A, Suc, Glc, and Fru levels. B, Citrate levels were measured at different times of the day (1 h before and after illumination and during the 8-h light period of 500 µE m–2 s–1). Measurements were carried out on three independent plants and SDs are given. White bars, wild type; gray bars, idhv.

 

View this table:
[in this window]
[in a new window]

 
Table III. Free amino acid and ammonium levels in idhv and Co

Measurements were carried out on three to four independent plants (soil) or three liquid cultures each containing 50 plantlets grown under short-day conditions and SDs are given.

 
To gain further information about carbon and nitrogen metabolites, metabolic profiling analyses were carried out on leaf extracts from the three mutants and their respective control plants using an established gas chromatography (GC)-mass spectrometry (MS) protocol (Fernie et al., 2004bGo). These studies revealed no evidence of major alterations in sugar and organic acid levels, including 2-oxoglutarate between the mutant and wild-type plants (Table IV ). However, succinate, Ara, Rib, Xyl, and Glc appeared to be significantly reduced in idhv leaves, whereas maltose was found to be decreased in idhii mutant leaves (Table IV). In contrast, the levels of several amino acids were significantly decreased in the mutants when compared to the wild-type leaves (Table IV). This trend was more pronounced in the idhv mutant (lacking 92% of IDH activity), where significantly reduced soluble amino acid levels were detected for Arg, Asp, Cys, Gly, Ile, Leu, Thr, and Tyr (Table IV). This apparent reduction in amino acid levels did not impact on the measured total soluble amino acid content because the major amino acids (Glu and Gln) were not altered significantly.


View this table:
[in this window]
[in a new window]

 
Table IV. Metabolic profiling of different IDH mutants

Plants were grown under long-day conditions at Golm, Germany. Values are the mean ± SE of determinations made on six plants. The given values are relative to the respective wild-type controls (each metabolite = 1).

 

Phenotypic and Metabolic Analyses of Arabidopsis IDH Mutants Grown in Liquid Culture

With the aim to purify Arabidopsis mitochondria, different lines were grown in liquid medium under low light (75 µE m–2 s–1) and continuous shaking at 150 rpm. The three mutant lines and their respective wild-type counterparts could develop only in the presence of added Suc, indicating that they were not autotrophic. When grown under such nonphysiological conditions, the three mutant lines exhibited reduced growth phenotype when compared to wild-type plants. This was most pronounced for the idhv mutant (Fig. 5 ). The growth phenotype was observed at each of the tested Suc concentrations (from 0.1% to 2%; data not shown). Furthermore, the phenotype did not appear to be dependent on submergence of the plants because it was detected when the plants were grown under varying volumes of liquid culture (Fig. 5, idhv).


Figure 5
View larger version (120K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. The effect of liquid culture volume on the growth of wild-type (WT) and idhv plants. Seeds were allowed to germinate and develop in different volumes of liquid culture medium (10–70 mL) containing 2% Suc (constant agitation, 75 µE m–2 s–1; 8-h d/16-h night). [See online article for color version of this figure.]

 
As for greenhouse-grown plants, Glc, Fru, Suc, and citrate levels were measured in the leaves of the liquid culture-grown idhv and wild-type plants. Major differences were seen in the Suc and citrate levels between the idhv mutant and the wild type, and the mutant also contained higher levels of Glc and Suc (data not shown). These quantitative measurements were confirmed by metabolic profiling (using GC-MS) of leaf extracts from the liquid culture-grown plants (Figs. 6 and 7 ). These analyses showed that hexose-P levels were also modified in mutant leaves (approximately 3- to 6-fold increase depending on the mutant examined). In contrast to soil-grown plants, the liquid culture idhv mutants were greatly affected in their levels of TCA cycle organic acids. Indeed, isocitrate and citrate levels were found to be 25- and 35-fold higher, with aconitate (5.7-fold), fumarate and malate (2-fold), and succinate (1.4-fold) also increased when compared to wild-type plants (Fig. 6). Similar differences were seen in the idhii mutant; however, the increase in citrate (5.3-fold), isocitrate (4.3-fold), and aconitate (2.3-fold) was lower when compared to idhv, although similar changes were observed for the other TCA cycle organic acids. Surprisingly, 2-oxoglutarate levels were only slightly reduced in the idhv mutant line and doubled in the idhii plant extracts when compared to their wild-type controls (Fig. 6); however, these differences were not statistically significant.


Figure 6
View larger version (14K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. Comparison of the relative levels of sugars and organic acids between the liquid culture idhv (black) and idhii (white) mutants grown under short-day conditions. Data were normalized to the mean values of the wild-type plant extracts (see hashed line, each metabolite = 1). Values presented are mean ± SE of determinations on six independent cultures; an asterisk indicates values determined to be significantly different from the control; wild-type values by means of t tests (P < 0.05). Measurements were carried out as described in "Materials and Methods" by GC-MS.

 

Figure 7
View larger version (14K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. Comparison of the relative levels of amino acids and GABA between the liquid culture idhv (black) and idhii (white) mutants grown under short-day conditions. Data were normalized to the mean values of wild-type plant extracts (see hashed line; each metabolite = 1). Values presented are mean ± SE of determinations on six independent cultures; an asterisk indicates values determined to be significantly different from the control; wild-type values by means of t tests (P < 0.05). Measurements were carried out as described in "Materials and Methods" by GC-MS.

 
Liquid culture-grown idh mutants also showed differences in the levels of certain amino acids when compared to their wild-type counterparts (Fig. 7). In contrast to soil-grown plants, mutants mainly exhibited increased free amino acid levels (compare Table IV and Fig. 7). Significant increases were measured for Ala, Asp, Cys, Gly, Leu, Pro, Ser, and Val when idhv extracts were compared to those of the wild type (Fig. 7). This gave rise to an 18% increase in total free amino acids in the leaves of the idhv mutant, as well as a significant 45% increase in free ammonium ions (Table III). The small change in total amino acid levels can be explained by the fact that only minor amino acids were altered, whereas the two major amino acids (Glu [84 µmol/g fresh weight in wild-type extracts] and Gln [79.6 µmol/g fresh weight in wild-type extracts], accounting for 89% of the total amount of amino acids [183.6 µmol/g fresh weight in wild-type extracts]) were not significantly modified in the mutant extracts. On the other hand, Arg, Asn, and Lys appeared to be reduced in idhv, whereas only Asn was seen to be decreased in idhii plant extracts. On the whole, changes in idhv and idhii plants were quite similar, with the exception of those in Arg, {gamma}-aminobutyrate (GABA), Glu, Lys, and Tyr (which appeared to increase in idhii plants).


Pyridine Nucleotide Content

It might be expected that there are pronounced effects on redox balance in liquid culture-grown plants. Therefore, NAD(P) and NAD(P)H levels were measured in wild-type and mutant plant rosette leaf extracts and compared to those found in soil-grown plants. When idhv plants were grown in liquid culture, the only notable difference was detected in total NADP + NADPH levels due to lower amounts of NADPH when compared to wild-type extracts. No significant changes were seen in the NAD + NADH pools. On the other hand, idhii extracts contained lower levels of NADH, as well as altered NADP/NADPH balance (Table V ). Surprisingly, idhv mutants exhibited more pronounced alterations in pyridine nucleotide levels when grown under soil conditions (lower NAD and NADPH levels compared to wild-type extracts). The idhi plants only showed an increase in NADH levels under soil conditions, with no changes in NAD, NADP, and NADPH content (Table V).


View this table:
[in this window]
[in a new window]

 
Table V. Pyridine nucleotide levels in IDH mutants and their wild-type counterparts

NAD, NADH, NADP, and NADPH levels were measured in leaf extracts of different IDH mutants and their wild-type controls grown under short-day conditions in soil or liquid culture (LC). Measurements were carried out on three to four independent plants (soil) or three plant cultures each containing 50 plantlets (LC) and SDs are given. FW, Fresh weight.

 

Total ICDH Levels

Total extractable ICDH activity was measured in crude extracts from different liquid culture-grown plants (Table II). The idhv mutant contained similar ICDH activity to the Co control. On the other hand, idhii leaves exhibited a significant increase in total ICDH activity when compared to the control, WS x Landsberg erecta (WSLer) line.


Respiratory Activity

The uncoupled respiration of TCA cycle substrates (citrate, succinate, and malate) and NADH by mitochondria-enriched leaf extracts of liquid culture-grown plants was investigated using a Clarke-type oxygen electrode. These experiments indicated that there were no differences in in vitro respiratory capacity between the idhv mutant and the wild type, whatever the substrate tested (data not shown). While at first sight surprising, this result is not without precedence because reductions in activity of several enzymes of the TCA cycle produced only a minimal effect on the respiration rate (Lin et al., 2004Go; Nunes-Nesi et al., 2005Go).


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The aim of this work was to determine the importance of IDH in plant metabolism by isolating, characterizing, and analyzing Arabidopsis knockout mutants of IDH genes that gave rise to altered IDH activity. The Arabidopsis genome encodes five different IDH subunits (Lin et al., 2004Go; Lemaitre and Hodges, 2006Go), which have been proposed to have regulatory (three genes) or catalytic (two genes) functions. We have analyzed three IDH mutants, each having insertions in a different IDH gene. In these mutants, the corresponding mRNA was not detectable (Fig. 2), IDH protein levels were modified (Fig. 3, A and B), and leaf IDH activity was reduced by 43% to 92% (depending on the mutant studied). The highest inhibition of IDH activity was measured in the idhv mutant line, where T-DNA is inserted into At5g03290, encoding a catalytic subunit. It appeared that the reduction of IDH activity in each mutant correlated well to the expression level of the corresponding IDH gene in the wild-type context (Lemaitre and Hodges, 2006Go). Our data show that IDHI, IDHII, or IDHV are not essential to obtain IDH activity. This has been reported already for IDHII (Lin et al., 2004Go). Therefore, a single catalytic subunit and a single regulatory subunit are the minimal requirements to obtain in planta leaf IDH activity, thus confirming a hypothesis already put forward after the complementation of yeast IDH mutants with tobacco IDH-encoding cDNA (Lancien et al., 1998Go).

The quasi absence in the idhv mutant extract of the faster migrating protein band after SDS-PAGE confirmed that this protein is the major catalytic IDH subunit (encoded by At5g03290) of Arabidopsis leaves. Western-blot analysis of IDH proteins separated by 2D electrophoresis showed the presence of several forms for each IDH subunit. This could be explained by several phenomena, including posttranscriptional modifications, such as protein phosphorylation, or alternative splicing of RNA. Indeed, phosphorylation of potato IDH has been reported (Bykova et al., 2003Go) and we have retained potato tuber IDH on affinity columns designed to enrich fractions in phosphorylated proteins (T. Lemaitre, P. Meimoun, and M. Hodges, unpublished data). Furthermore, the tissue-dependent, alternative splicing of RNA encoding the mammalian IDH beta-subunit has been described (Weiss et al., 2000Go). In The Arabidopsis Information Resource database, a splice variant of AtIDHII (At2g17130.2) is cataloged that has a lower calculated pI value and a smaller MM compared to At2g17130.1. Such differences could explain the two IDHII protein spots detected in Figure 3B (the more acidic protein appearing to have a lower MM). However, more work is required to determine the exact origin and functional significance of the multiple protein spots for the different IDH subunits.

The major aim of this work was to elucidate the importance of IDH activity on cell functioning, with particular attention being paid to carbon and nitrogen metabolism. Indeed, it has been proposed that IDH is a major source of 2-oxoglutarate, the carbon skeleton required for functioning of the GS-GOGAT cycle (Lancien et al., 1999Go; Abiko et al., 2005Go). To our surprise, the three idh mutants did not exhibit a modified growth and development phenotype when grown under controlled conditions. This seems to indicate that IDH is not limiting for plant growth because plants containing only 8% of wild-type leaf IDH activity (idhv) had an unaffected developmental phenotype. Indeed, these plants did not exhibit changes in either citrate levels (Fig. 4B; Table IV) or sugar levels during the day (Fig. 4A; Table IV), thus suggesting that carbon flow through the glycolytic pathway and the TCA cycle were unaffected by the deficiency of IDH activity. The severe reduction in IDH activity did not alter the diurnal changes in sugar levels (Fig. 4A). Unlike potato plants containing 6% of normal citrate synthase activity (Landschütze et al., 1995Go), idh mutants were additionally not affected in the reproductive phase of their life cycle. However, it should be noted that the repression of citrate synthase activity in the potato did not alter vegetative growth, as with our IDH mutants. Again, idh mutants differ from the tomato (Lycopersicon esculentum) aconitase mutant (Aco-1) because plants having lower aconitase activities (40%) exhibited stunted phenotype at early growth stages, higher Suc levels during the day, and modified TCA cycle metabolite levels (higher isocitrate and citrate levels, lower succinate, fumarate, and 2-oxoglutarate levels; Carrari et al., 2003Go). However, idh and Aco-1 mutants were affected in amino acid content. Indeed, metabolite profiling of our idh mutants showed that, under controlled normal growth conditions, these plants appeared to contain lower relative soluble amino acid levels when compared to their respective wild-type plants (Table IV). This effect was more pronounced in the idhv mutant, where nearly one-half of the amino acids showed significantly reduced relative amounts. However, the two major amino acids (Glu and Gln) found in Arabidopsis leaf extracts (89% of the total soluble amino acids/g fresh weight; data not shown) were not affected and therefore the total soluble amino acid content was not significantly reduced (see Table III). Decreases in certain amino acids were also seen in the Aco-1 tomato mutant (including Asp, Leu, Gln), but others, such as Gly, differed in the opposite direction when compared to idhv. The reasons for such changes in amino acid profiles between idhv and wild-type leaves is not easy to explain. No particular class of amino acid was affected. More surprisingly, Glu and Gln levels were not significantly modified in the different idh mutant lines (Table IV), indicating that IDH is not essential (or limiting) in the production of the 2-oxoglutarate for ammonium assimilation via the GS-GOGAT cycle. Indeed, idh mutants were not significantly affected in their 2-oxoglutarate content (Table IV). This could be due to the nonlimiting IDH activity for TCA cycle functioning or due to the nonexclusive role of IDH in 2-oxoglutarate production. Several isoforms of ICDH exist in leaves and they could also play a role in synthesizing this key organic acid (Hodges et al., 2003Go). It should be noted that total leaf ICDH activity and the activity associated with mitochondrial-enriched extracts were unaltered in the idhv mutant under these growth conditions (Tables I and II). Chen and Gadal (1990)Go proposed cytosolic ICDH to be a key player in GS-GOGAT functioning. However, potato (Kruse et al., 1998Go) and tobacco (S. Gálvez and M. Hodges, unpublished data) plants containing only 8% to 10% of wild-type ICDH activity showed no growth phenotype, no differences in amino acid levels, and only small effects on the accumulation of citrate and isocitrate. It is thus probable that the 2-oxoglutarate production for nitrogen assimilation does not come from a privileged pathway. Such a situation has already been proposed in yeast, where IDH, cytosolic, and mitochondrial ICDH must be absent to generate Glu auxotrophic strains (Zhao and McAlister-Henn, 1996Go).

When the idh mutants were grown under nonphysiological conditions (liquid medium supplied with Suc and under low light), they showed a modified growth phenotype (Fig. 5). Similar conditions (except for day length) have been used to investigate the effect of nitrogen on genome reprogramming of primary and secondary plant metabolism (Scheible et al., 2004Go). Under our liquid culture conditions, addition of Suc was necessary for plant growth, thus indicating that they could not grow by photosynthesis alone. The metabolic analyses showed that the decrease of IDH activity appeared to become limiting for the carbon flux toward the TCA cycle and led to an accumulation of citrate and isocitrate in the leaves (Fig. 6). This bottleneck impacted on glycolytic metabolites (hexose-P) and sugar metabolism (Fig. 6). The increase in succinate, fumarate, and malate levels suggests that organic acids are fed into the Krebs cycle via cytosolic bypass pathways. However, under these nonphysiological conditions, no significant differences in 2-oxoglutarate levels were found (Fig. 6), most probably indicating that IDH activity has a limited impact on total 2-oxoglutarate levels and that 2-oxoglutarate can probably be produced by ICDH activity that was not modified in the idhv plants and increased in the idhii extracts (Table II). It is known that ICDH activity is inhibited by NADPH (Igamberdiev and Gardeström, 2003Go) and therefore the in planta activity might be reduced by changes in the pyridine nucleotide reduction state brought about by lower IDH activity and liquid culture conditions. Surprisingly, pyridine nucleotide levels (NADP and NADPH) were not greatly altered between mutant and wild-type leaves (Table V) and, therefore, they would not be expected to inhibit leaf ICDH activity in the mutants.

In addition, metabolite profiling of the idh mutants showed that the relative amounts of certain leaf-soluble amino acids accumulated under liquid culture conditions with respect to wild-type plants (Fig. 7). This apparent increase in soluble amino acids might reflect the lower growth rate of the mutant plants, where amino acids are produced, but not utilized, for protein synthesis. However, this observation could be due to the increase in sugar levels found in the mutant leaves (Fig. 6) because it has already been reported that high Suc levels activate the biosynthetic pathways of minor amino acids (Morcuende et al., 1998Go).

We first believed that O2 availability might be involved in generating the growth phenotype. Indeed, anoxia is known to affect respiration and mitochondrial enzymes (see Bologa et al., 2003Go; Geigenberger, 2003Go) due to stimulation of fermentation pathways and a decrease in ATP-utilizing pathways. However, when plants were grown on little or completely submerged in liquid medium, the decreased growth phenotype was still observed (Fig. 5). We also suspected that the high Suc content of the medium could be implicated in producing the phenotype because high sugar levels are known to inhibit photosynthesis (Koch, 1996Go) and act in many signaling pathways (Jang and Sheen, 1994Go; Smeekens, 2000Go). However, differences in growth were still observed when Suc concentration was varied (from 0.1% to 2%), so this is clearly not the predominant factor behind this change. In photosynthetically active plants grown on soil, reductant and ATP can be synthesized by the chloroplasts and the major role of leaf mitochondria could be to ensure efficient photosynthesis via its participation in photorespiration and redox balancing (Scheibe et al., 2005Go; Sweetlove et al., 2006Go). When grown in liquid culture, light intensity was very low and the leaf sugar concentration was 10-fold higher than under soil conditions. We suggest that, under such conditions, plants are not photosynthetically active; therefore, the reducing power and ATP necessary for growth and development must be provided by the mitochondria. This would be anticipated to increase the flux of carbon through glycolysis and the TCA cycle. Therefore, the decrease in IDH activity of the mutants becomes limiting for the required TCA cycle activity and thus leads to a decrease in growth and development (and an accumulation in organic acids and sugars).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Cultures

Wild-type and mutant Arabidopsis (Arabidopsis thaliana) plants were grown under several culture conditions. For mutant isolation and characterization, plants were germinated from sterilized seed on agar plates containing Murashige and Skoog (M-5519; Sigma) and 2% Suc. Plantlets were transferred to soil either in the greenhouse or controlled growth rooms and allowed to develop to seed. For metabolite studies carried out at Orsay (France), plants were grown in a controlled growth room under a short-day (8 h) photoperiod of 500 µE m–2 s–1 at 17°C and a hygrometry of 65%. Plants were grown also in liquid medium under short-day, low light (75 µE m–2 s–1) at 18°C in transparent, closed pots under constant agitation (150 rpm).

For metabolic profiling studies, plants were grown in soil in a culture room under 250 µE m–2 s–1 and a long-day photoperiod (Golm, Germany) or in liquid medium (as described above).


idh Mutant Lines

The three idh mutant lines studied in this work originated from different mutant libraries. The 806-A06 line containing an insertion in AtIDHV came from SAIL (Sessions et al., 2002Go), the DYC 179 line with an insertion in AtIDHI was from the Institut National de la Recherche Agronomique, Versailles, library (Bouchez et al., 1993Go), and the N100075 line with an insertion in AtIDHII was from the Ds-IMA library (Parinov et al., 1999Go).


Identification of Homozygous idh Mutant Lines

Mutants containing a homozygous insertion in the respective AtIDH gene were identified by PCR using genomic DNA extracted from leaves of T3 or T4 generation plants (grown on a selection marker antibiotic). Genomic DNA was extracted from 1 cm2 of a rosette leaf ground with sand in 200 mM Tris-HCl, pH 7.5, 250 mM NaCl, 25 mM EDTA, and 0.5% SDS. After 5-min incubation at room temperature and centrifugation (1 min, 11,000g), 350 µL of isopropanol were added to the supernatant, incubated for 15 min, and centrifuged at 11,000g for 5 min. The resulting pellet was dissolved in 10 mM Tris-HCl, pH 7.0, and 1 mM EDTA. PCR was performed with the following AtIDH-specific primers: IDHV, 5'-TCGAATCTTCTTTTGGGAGC, 3'-GAATCTTCTTGCCTTACGGCAG; IDHI, 5'-ATTACGTGTTCCCGCTCTGC, 3'-AGGCGCCAACATACGTAGC; IDHII, 5'-AAGCATCAGTCACACGTCGG, 3'-GCTCTGAGGCAGTTTTCAC; and either a T-DNA (TAG5 [for IDHI], CTACAAATTGCCTTTTCTTATCGCA; SYNLB3 [for IDHV], GCATCTGAATTTCATAACCAATCTCG) or a Dissociation transposon (for IDHII, CGATACCGTATTTATCCCGTTC) specific primer. The hybridization temperature was 50°C and 35 PCR cycles were carried out.


RT-PCR

RT-PCR was used to determine the presence of a full-length coding region AtIDH mRNA in the different idh mutant lines. One microgram of total leaf mRNA was used to amplify the corresponding cDNA (Promega 1x buffer, 0.4 mM dNTP, 250 µM oligonucleotides, 10 mM dithiothreitol, and 1 unit of reverse transcriptase [Moloney murine leukemia virus, RNase H minus; Promega] during 1 h at 42°C). PCR was performed using the following conditions: 45 s at 94°C, 45 s at 50°C, 1 min/kb at 72°C during 30 cycles. The following primers were used: IDHV, 5'-CGACCATGGCAACTCTCTTCCCTGGC, 3'-GAATCTTCTTGCCTTACGGCAG; IDHI, 5'-CACCCATGGTGACGCTGATCCCCGGA, 3'-AGGCGCCAACATACGTAGC; IDHII, 5'-CAACCATGGTGACGTTAATCCCCGGA, 3'-GCTGTGAGGCAGTTTTCAC.


Protein Extractions

Total soluble leaf proteins were extracted from 100 to 150 mg of frozen leaf material, ground in liquid nitrogen in extraction buffer (100 mM phosphate, 14 mM beta-mercaptoethanol, 5 mM MgCl2), and centrifuged at 12,000g for 15 min. The supernatant was used as the crude protein extract for ICDH activity measurements. Mitochondrial-enriched proteins were extracted from 1 to 4 g of leaves ground with glass beads at 4°C in an extraction buffer (100 mM HEPES, pH 7.4, 0.6 M sorbitol, 2 mM EDTA, 0.2% bovine serum albumin, and a protease inhibitor cocktail [Complete; Promega]). The extract was filtered (0.25-µm tissue), centrifuged at 2,000g for 10 min, and the resulting supernatant was further centrifuged at 12,000g for 20 min. The pellet was suspended in extraction buffer. The final soluble extract was obtained after three freeze-thaw cycles and centrifugation at 20,000g for 8 min. The extract was then diluted 2-fold with glycerol (to give a final glycerol concentration of 50%).


Protein Analyses

Fifty micrograms of soluble leaf mitochondrial-enriched proteins were separated by SDS-PAGE (12% acrylamide) according to Laemmli (1970)Go or 100 µg were separated by 2D electrophoresis according to Lemaitre (2005)Go. The first dimension separated the denatured proteins by their pI (range pH 5–8) and the second dimension by their MM (SDS-PAGE, 10% acrylamide). In each case, the proteins were transferred to nitrocellulose membranes as described by Towbin et al. (1979)Go. IDH protein was detected by enhanced chemiluminescence after incubation with IDH antiserum (diluted 2,000-fold) raised against recombinant IDHA from tobacco (Nicotiana tabacum; Lancien et al., 1998Go) and secondary antibodies raised against rabbit proteins and coupled to a peroxidase activity (dilution 50,000-fold).


IDH Activity and Mitochondrial Respiratory Capacity

The IDH activity of mitochondrial-enriched protein extracts was measured with a spectrophotometer by following the absorption change at 340 nm due to the production of NADH during the reaction. This was carried out in a buffer containing 50 mM HEPES, pH 7.4, 5 mM MnCl2, 10 mM isocitrate, 10 mM NADH, and 20% glycerol. ICDH activity was measured as described in Gálvez et al. (1994)Go.

Uncoupled respiratory activities were measured using the mitochondrial-enriched extracts (before the freeze-thaw cycles) and a Clarke-type oxygen electrode. Oxygen production was measured at 25°C using 100 µg of protein extract resuspended in 100 mM HEPES, 0.6 M sorbitol, 7.5 mM MgCl2, and 0.2% bovine serum albumin. The substrate concentrations used were 2 mM for NADH, succinate, malate, and pyruvate, and 4 mM for citrate in the presence of 2 µM carbonylcyanide m-chlorophenylhydrazone.


Metabolite Analyses

Sugar, free amino acid, and ammonium ion analyses were carried out using ground leaf extracts treated with 2% sulfosalicylic acid and centrifuged at 12,000g for 15 min at 4°C. Free amino acids were quantified by the method of Rosen (1957)Go using Gln as the reference compound. Free ammonium ions were measured by the phenol hypochlorite assay according to the Berthelot reaction (after 20 min of colorimetric reaction, NH4+ content was measured spectrophotometrically at 635 nm). Suc, Glc, and Fru levels were measured using the Suc/D-Glc/D-Fru kit (Roche), according to the manufacturer's instructions. Leaf extractions and metabolic profiling by GC-MS were carried out following the protocols described in Wagner et al. (2006)Go and Roessner et al. (2001)Go, respectively.


Pyridine Nucleotide Analyses

NAD and NADP pool sizes and reduction state were measured in acid and alkaline extracts using the protocol described in Queval and Noctor (2007)Go. The assays involve the phenazine methosulfate-catalyzed reduction of dichlorophenolindophenol in the presence of ethanol and alcohol dehydrogenase (for NAD and NADH) or Glc-6-P and Glc-6-P dehydrogenase (for NADP and NADPH). Reduced and oxidized forms are distinguished by preferential destruction in acid or base.


Statistical Analysis

Where two observations are described in the text as different, this means that they were determined to be statistically different by performing Student's t tests using the algorithm incorporated into Microsoft Excel 7.0.

Received April 6, 2007; accepted April 25, 2007; published April 27, 2007.


    FOOTNOTES
 
1 This work was supported by the Centre National de la Recherche Scientifique, the Université de Paris Sud-XI, and the French Ministry of Education (PhD fellowship to T.L.). Back

2 Present address: Unité de Nutrition Azotée des Plantes, Institut National de la Recherche Agronomique, Route de St. Cyr, 78026 Versailles, France. Back

3 Present address: Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK 73401. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Michael Hodges (michael.hodges{at}u-psud.fr).

[C] Some figures in this article are displayed in color online but in black and white in print. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.107.100677

* Corresponding author; e-mail michael.hodges{at}u-psud.fr; fax 33–1–69153424.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Abiko T, Obara M, Ushioda A, Hayakawa T, Hodges M, Yamaya T (2005) Localization of NAD-isocitrate dehydrogenase and glutamate dehydrogenase in rice roots: candidates for providing carbon skeletons to NADH-glutamate synthase. Plant Cell Physiol 46: 1724–1734[Abstract/Free Full Text]

Blasing OE, Gibon Y, Gunther M, Hohne M, Morcuende R, Osuna D, Thimm O, Usadel B, Scheible WR, Stitt M (2005) Sugars and circadian regulation make major contributions to the global regulation of diurnal gene expression in Arabidopsis. Plant Cell 17: 3257–3281[Abstract/Free Full Text]

Bologa KL, Fernie AR, Leisse A, Loureiro ME, Geigenberger P (2003) A bypass of sucrose synthase leads to low internal oxygen and impaired metabolic performance in growing potato tubers. Plant Physiol 132: 2058–2072[Abstract/Free Full Text]

Bouchez D, Camilleri C, Caboche M (1993) A binary vector based on basta resistance in planta transformation of Arabidopsis thaliana. C R Acad Sci III Sci Vie 316: 1188–1198

Budde RJ, Randall DD (1990) Pea leaf mitochondrial pyruvate dehydrogenase complex is inactivated in vivo in a light-dependent manner. Proc Natl Acad Sci USA 87: 673–676[Abstract/Free Full Text]

Bykova NV, Egsgaard H, Möller IM (2003) Identification of 14 new phosphoproteins involved in important plant mitochondrial processes. FEBS Lett 540: 141–146[CrossRef][Web of Science][Medline]

Carrari F, Nunes-Nesi A, Gibon Y, Lytovchenko A, Loureiro ME, Fernie AR (2003) Reduced expression of aconitase results in an enhanced rate of photosynthesis and marked shifts in carbon partitioning in illuminated leaves of wild species tomato. Plant Physiol 133: 1322–1335[Abstract/Free Full Text]

Cornu S, Pireaux JC, Gerard J, Dizengremel P (1996) NAD(P)(+)-dependent isocitrate dehydrogenases in mitochondria purified from Picea abies seedlings. Physiol Plant 96: 312–318[CrossRef]

Chen R (1998) Plant NADP-dependent isocitrate dehydrogenases are predominantly localized in the cytosol. Planta 207: 280–285[CrossRef][Web of Science][Medline]

Chen RD, Gadal P (1990) Do mitochondria provide the 2-oxoglutarate needed for synthesis in higher plant chloroplasts? Plant Physiol Biochem 28: 141–145[Web of Science]

Cupp JR, McAlister-Henn L (1991) NAD(+)-dependent isocitrate dehydrogenase: cloning, nucleotide sequence, and disruption of the IDH2 gene from Saccharomyces cerevisiae. J Biol Chem 266: 22199–22205[Abstract/Free Full Text]

Cupp JR, McAlister-Henn L (1992) Cloning and characterization of the gene encoding the IDH1 subunit of NAD(+)-dependent isocitrate dehydrogenase from Saccharomyces cerevisiae. J Biol Chem 267: 16417–16423[Abstract/Free Full Text]

Fernie AR, Carrari F, Sweetlove LJ (2004a) Respiratory metabolism: glycolysis, the TCA cycle and mitochondrial electron transport. Curr Opin Plant Biol 7: 254–261[CrossRef][Web of Science][Medline]

Fernie AR, Trethewey RN, Krotzky AJ, Willmitzer L (2004b) Metabolic profiling: from diagnostics to system biology. Nat Rev Mol Cell Biol 5: 763–769[CrossRef][Web of Science][Medline]

Gálvez S, Bismuth E, Sarda C, Gadal P (1994) Purification and characterization of chloroplast NADP-isocitrate dehydrogenase from mixotrophic tobacco cells (comparison with the cytosolic enzyme). Plant Physiol 105: 593–600[Abstract]

Gálvez S, Lancien M, Hodges M (1999) Are isocitrate dehydrogenases and 2-oxoglutarate involved in the regulation of glutamate synthesis? Trends Plant Sci 4: 484–490[CrossRef][Web of Science][Medline]

Geigenberger P (2003) Response of plant metabolism to too little oxygen. Curr Opin Plant Biol 6: 247–256[CrossRef][Web of Science][Medline]

Hanning I, Baumgarten K, Schott K, Heldt HW (1999) Oxaloacetate transport into plant mitochondria. Plant Physiol 119: 1025–1032[Abstract/Free Full Text]

Hodges M, Flesch V, Gálvez S, Bismuth E (2003) Higher plant NADP-dependent isocitrate dehydrogenases, ammonium assimilation and NADPH production. Plant Physiol Biochem 41: 577–585[CrossRef][Web of Science]

Igamberdiev AU, Gardeström P (2003) Regulation of NAD- and NADP-dependent isocitrate dehydrogenases by reduction levels of pyridine nucleotides in mitochondria and cytosol of pea leaves. Biochim Biophys Acta 1606: 117–125[Medline]

Jang JC, Sheen J (1994) Sugar sensing in higher plants. Plant Cell 6: 1665–1679[Abstract]

Kirschbaum MU, Farquhar GD (1987) Investigation of the CO2 dependence of quantum yield and respiration in Eucalyptus pauciflora. Plant Physiol 83: 1032–1036[Abstract/Free Full Text]

Koch KE (1996) Carbohydrate-modulated gene expression in plants. Annu Rev Plant Physiol Plant Mol Biol 47: 509–540[CrossRef][Web of Science][Medline]

Kruse A, Fieuw S, Heineke D, Müller-Röber B (1998) Antisense inhibition of cytosolic NADP-dependent isocitrate dehydrogenase in transgenic potato plants. Planta 205: 82–91[CrossRef][Web of Science]

Laemmli UK (1970) Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227: 680–685[CrossRef][Medline]

Lancien M, Ferrario-Méry S, Roux Y, Bismuth E, Macslaux C, Hirel B, Gadal P, Hodges M (1999) Simultaneous expression of NAD-dependent isocitrate dehydrogenase and other Krebs cycle genes after nitrate resupply to short-term nitrogen-starved tobacco. Plant Physiol 120: 717–726[Abstract/Free Full Text]

Lancien M, Gadal P, Hodges M (1998) Molecular characterization of higher plant NAD-dependent isocitrate dehydrogenase: evidence for a heteromeric structure by the complementation of yeast mutants. Plant J 16: 325–333[CrossRef][Web of Science][Medline]

Landschütze V, Willmitzer L, Müller-Röber B (1995) Inhibition of flower formation by antisense repression of mitochondrial citrate synthase in transgenic potato plants leads to a specific disintegration of the ovary tissues of flowers. EMBO J 14: 660–666[Web of Science][Medline]

Lemaitre T (2005) Caractérisation de l'isocitrate déshydrogénase à NAD+ chez Arabidopsis thaliana. PhD thesis. Université de Paris Sud-XI, Orsay, France

Lemaitre T, Hodges M (2006) Expression analysis of Arabidopsis thaliana NAD-dependent isocitrate dehydrogenase genes shows the presence of a functional subunit that is mainly expressed in the pollen and absent from vegetative organs. Plant Cell Physiol 47: 634–643[Abstract/Free Full Text]

Lin AP, McAlister-Henn L (2003) Homologous binding sites in yeast isocitrate dehydrogenase for cofactor (NAD+) and allosteric activator (AMP). J Biol Chem 278: 12864–12872[Abstract/Free Full Text]

Lin M, Behal RH, Oliver DJ (2004) Characterization of a mutation in the IDH-II subunit of the NAD+-dependent isocitrate dehydrogenase from Arabidopsis thaliana. Plant Sci 166: 983–988

Matsuo M, Obokata J (2006) Remote control of photosynthetic genes by the mitochondrial respiratory chain. Plant J 47: 873–882[CrossRef][Web of Science][Medline]

McIntosh CA (1997) Partial purification and characteristics of membrane-associated NAD(+)-dependent isocitrate dehydrogenase activity from etiolated pea mitochondria. Plant Sci 129: 9–20

Morcuende R, Krapp A, Hurry V, Stitt M (1998) Sucrose-feeding leads to increased rates of nitrate assimilation, increased rates of {alpha}-oxoglutarate synthesis, and increased synthesis of a wide spectrum of amino acids in tobacco leaves. Planta 206: 394–409[CrossRef][Web of Science]

Nichols BJ, Rigoulet M, Denton RM (1994) Comparison of the effects of Ca2+, adenine nucleotides and pH on the kinetic properties of mitochondrial NAD(+)-isocitrate dehydrogenase and oxoglutarate dehydrogenase from the yeast Saccharomyces cervisiae and rat heart. Biochem J 303: 461–465[Web of Science][Medline]

Nunes-Nesi A, Carrari F, Lytovchenko A, Smith AM, Loureiro ME, Ratcliffe RG, Sweetlove LJ, Fernie AR (2005) Enhanced photosynthetic performance and growth as a consequence of decreasing mitochondrial malate dehydrogenase activity in transgenic tomato plants. Plant Physiol 137: 611–622[Abstract/Free Full Text]

Nunes-Nesi A, Sweetlove LJ, Fernie AR (2007) Operation and function of the tricarboxylic acid cycle in the illuminated leaf. Physiol Plant 129: 45–56[CrossRef]

Parinov S, Sevugan M, Ye D, Yang WC, Kumaran M, Sundaresan V (1999) Analysis of flanking sequences from dissociation insertion lines: a database for reverse genetics in Arabidopsis. Plant Cell 11: 2263–2270[Abstract/Free Full Text]

Queval G, Noctor G (2007) A plate reader method for the measurement of NAD, NADP, glutathione, and ascorbate in tissue extracts: application to redox profiling during Arabidopsis rosette development. Anal Biochem 363: 58–69[CrossRef][Web of Science][Medline]

Raghavendra AS, Padmasree K (2003) Beneficial interactions of mitochondrial metabolism with photosynthetic carbon assimilation. Trends Plant Sci 8: 546–553[CrossRef][Web of Science][Medline]

Rebeille F, Gans P, Chagvardieff P, Pean M, Tapie P, Thibault E (1988) Mass spectrometric determination of the inorganic carbon species assimilated by photoautotrophic cells of Europhorbia characias L. J Biol Chem 263: 12373–12377

Roessner U, Luedemann A, Brust D, Fiehn O, Linke T, Willmitzer L, Fernie AR (2001) Metabolic profiling allows comprehensive phenotyping of genetically or environmentally modified plant systems. Plant Cell 13: 11–29[Abstract/Free Full Text]

Rosen H (1957) A modified ninhydrin colorimetric analysis for amino acids. Arch Biochem Biophys 67: 10–15[CrossRef][Web of Science][Medline]

Scheibe R, Backhausen JE, Emmerlich V, Holtgrefe S (2005) Strategies to maintain redox homeostasis during photosynthesis under changing conditions. J Exp Bot 56: 1481–1489[Abstract/Free Full Text]

Scheible WR, Morcuende R, Czechowski T, Fritz C, Osuna D, Palacios-Rojas N, Schindelasch D, Thimm O, Udvardi MK, Stitt M (2004) Genome-wide reprogramming of primary and secondary metabolism, protein synthesis, cellular growth processes and regulatory infrastructure of Arabidopsis in response to nitrogen. Plant Physiol 136: 2483–2499[Abstract/Free Full Text]

Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P, Bacwaden J, Ko C, et al (2002) A high-throughput Arabidopsis reverse genetics system. Plant Cell 14: 2985–2994[Abstract/Free Full Text]

Smeekens S (2000) Sugar-induced signal transduction in plants. Annu Rev Plant Physiol Plant Mol Biol 51: 49–81[CrossRef][Web of Science][Medline]

Sweetlove LJ, Lytovchenko A, Morgan M, Nunes-Nesi A, Taylor NL, Baxter CJ, Eickmeier I, Fernie AR (2006) Mitochondrial uncoupling protein is required for efficient photosynthesis. Proc Natl Acad Sci USA 103: 19587–19592[Abstract/Free Full Text]

Tcherkez G, Cornic G, Bligny R, Gout E, Ghashghaie J (2005) In vivo respiratory metabolism of illuminated leaves. Plant Physiol 138: 1596–1606[Abstract/Free Full Text]

Tovar-Méndez A, Miernyk JA, Randall DD (2003) Regulation of pyruvate dehydrogenase complex activity in plant cells. Eur J Biochem 270: 1043–1049[Web of Science][Medline]

Towbin H, Staehlin T, Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76: 4350–4354[Abstract/Free Full Text]

Urbanczyk-Wochniak E, Baxter C, Kolbe A, Kopka J, Sweetlove LJ, Fernie AR (2005) Profiling of diurnal patterns of metabolite and transcript abundance in potato (Solanum tuberosum) leaves. Planta 221: 891–903[CrossRef][Web of Science][Medline]

Wagner S, Bernhardt A, Leuendorf JE, Drewke C, Lytovchenko A, Mujahed N, Gurgui C, Frommer WB, Leistner E, Fernie AR, et al (2006) Analysis of the Arabidopsis rsr4-1/pdx1-3 mutant reveals the critical function of the PDX1 protein family in metabolism, development, and vitamin B6 biosynthesis. Plant Cell 18: 1722–1735[Abstract/Free Full Text]

Weiss C, Zeng Y, Huang J, Sobocka MB, Rushbrook JI (2000) Bovine NAD+-dependent isocitrate dehydrogenase: alternative splicing and tissue-dependent expression of subunit 1. Biochemistry 39: 1807–1816[CrossRef][Medline]

Wiskich JT, Dry IB (1985) The tricarboxylic acid cycle in plant mitochondria: its operation and regulation. In R Douce, DA Day, eds, Encyclopedia of Plant Physiology, Higher Plant Cell Respiration 18. Springer-Verlag, Berlin, pp 281–313

Zhao WN, McAlister-Henn L (1996) Expression and gene disruption analysis of the isocitrate dehydrogenase family in yeast. Biochemistry 35: 7873–7878[CrossRef][Medline]

Zhao WN, McAlister-Henn L (1997) Affinity purification and kinetic analysis of mutant forms of yeast NAD(+)-specific isocitrate dehydrogenase. J Biol Chem 272: 21811–21817[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J Exp BotHome page
A. Kosmala, A. Bocian, M. Rapacz, B. Jurczyk, and Z. Zwierzykowski
Identification of leaf proteins differentially accumulated during cold acclimation between Festuca pratensis plants with distinct levels of frost tolerance
J. Exp. Bot., August 1, 2009; 60(12): 3595 - 3609.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
H. Roschzttardtz, I. Fuentes, M. Vasquez, C. Corvalan, G. Leon, I. Gomez, A. Araya, L. Holuigue, J. Vicente-Carbajosa, and X. Jordana
A Nuclear Gene Encoding the Iron-Sulfur Subunit of Mitochondrial Complex II Is Regulated by B3 Domain Transcription Factors during Seed Development in Arabidopsis
Plant Physiology, May 1, 2009; 150(1): 84 - 95.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. J. van der Merwe, S. Osorio, T. Moritz, A. Nunes-Nesi, and A. R. Fernie
Decreased Mitochondrial Activities of Malate Dehydrogenase and Fumarase in Tomato Lead to Altered Root Growth and Architecture via Diverse Mechanisms
Plant Physiology, February 1, 2009; 149(2): 653 - 669.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
W. L. Araujo, A. Nunes-Nesi, S. Trenkamp, V. I. Bunik, and A. R. Fernie
Inhibition of 2-Oxoglutarate Dehydrogenase in Potato Tuber Suggests the Enzyme Is Limiting for Respiration and Confirms Its Importance in Nitrogen Assimilation
Plant Physiology, December 1, 2008; 148(4): 1782 - 1796.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
C. P. Lee, H. Eubel, N. O'Toole, and A. H. Millar
Heterogeneity of the Mitochondrial Proteome for Photosynthetic and Non-photosynthetic Arabidopsis Metabolism
Mol. Cell. Proteomics, July 1, 2008; 7(7): 1297 - 1316.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
E. Giraud, L. H.M. Ho, R. Clifton, A. Carroll, G. Estavillo, Y.-F. Tan, K. A. Howell, A. Ivanova, B. J. Pogson, A. H. Millar, et al.
The Absence of ALTERNATIVE OXIDASE1a in Arabidopsis Results in Acute Sensitivity to Combined Light and Drought Stress
Plant Physiology, June 1, 2008; 147(2): 595 - 610.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
A. Nunes-Nesi, R. Sulpice, Y. Gibon, and A. R. Fernie
The enigmatic contribution of mitochondrial function in photosynthesis
J. Exp. Bot., May 1, 2008; 59(7): 1675 - 1684.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
A. Sienkiewicz-Porzucek, A. Nunes-Nesi, R. Sulpice, J. Lisec, D. C. Centeno, P. Carillo, A. Leisse, E. Urbanczyk-Wochniak, and A. R. Fernie
Mild Reductions in Mitochondrial Citrate Synthase Activity Result in a Compromised Nitrate Assimilation and Reduced Leaf Pigmentation But Have No Effect on Photosynthetic Performance or Growth
Plant Physiology, May 1, 2008; 147(1): 115 - 127.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/3/1546    most recent
pp.107.100677v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lemaitre, T.
Right arrow Articles by Hodges, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lemaitre, T.
Right arrow Articles by Hodges, M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NITROGEN
Agricola
Right arrow Articles by Lemaitre, T.
Right arrow Articles by Hodges, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2007 by the American Society of Plant Biologists