|
|
||||||||
|
First published online June 7, 2007; 10.1104/pp.106.094946 Plant Physiology 144:1786-1796 (2007) © 2007 American Society of Plant Biologists Exclusion of Na+ via Sodium ATPase (PpENA1) Ensures Normal Growth of Physcomitrella patens under Moderate Salt Stress1Plant Biochemistry Laboratory, Department of Plant Biology, Faculty of Life Sciences, University of Copenhagen, DK–1871 Frederiksberg C, Copenhagen, Denmark (C.L.,); and Australian Centre for Plant Functional Genomics, University of Adelaide, Waite Campus, Glen Osmond, South Australia 5064, Australia (D.P.D., A.K.J., M.T.)
The bryophyte Physcomitrella patens is unlike any other plant identified to date in that it possesses a gene that encodes an ENA-type Na+-ATPase. To complement previous work in yeast (Saccharomyces cerevisiae), we determined the importance of having a Na+-ATPase in planta by conducting physiological analyses of PpENA1 in Physcomitrella. Expression studies showed that PpENA1 is up-regulated by NaCl and, to a lesser degree, by osmotic stress. Maximal induction is obtained after 8 h at 60 mM NaCl or above. No other abiotic stress tested led to significant increases in PpENA1 expression. In the gametophyte, strong expression was confined to the rhizoids, stem, and the basal part of the leaf. In the protonemata, expression was ubiquitous with a few filaments showing stronger expression. At 100 mM NaCl, wild-type plants were able to maintain a higher K+-to-Na+ ratio than the PpENA1 (ena1) knockout gene, but at higher NaCl concentrations no difference was observed. Although no difference in chlorophyll content was observed between ena1 and wild type at 100 mM NaCl, the impaired Na+ exclusion in ena1 plants led to an approximately 40% decrease in growth.
Soil salinity represents a growing problem in agriculture because high sodium concentrations are toxic to most plants, causing reduced growth and productivity (Munns et al., 1999
Na+ is the main toxic ion in saline soils for most plants, including the major cereals (Tester and Davenport, 2003
Soil fungi are like plants in that they are exposed to similar challenges arising from close contact to a changing ionic environment. Phylogenetic analyses have shown that plant and fungal cells share many ion transporters; however, one major difference is the apparent absence of the ENA-type Na+-ATPases in vascular plants. In plants, maintaining nontoxic levels of Na+ appears to rely solely upon Na+/H+ antiporters. A surprising exception was the recent identification of two Na+-ATPases (PpENA1 and PpENA2) in the bryophyte, Physcomitrella patens (Benito and Rodríguez-Navarro, 2003
Although PpENA1 activity has been characterized in a heterologous system by Benito and Rodríguez-Navarro (2003)
Induction of PpENA1 under NaCl Stress To determine over what time frame and under which salt concentrations PpENA1 plays a physiologically important role, quantitative reverse transcription (qRT)-PCR was performed on protonemata exposed to various NaCl concentrations (5–400 mM) for different times (30 min to 3 d). Exposing protonemata to low NaCl concentrations (530 mM) caused a 3- to 8-fold increase in expression. However, increasing the NaCl concentration to 60 mM caused a much higher, 30-fold, induction in PpENA1 mRNA levels after 8 h (Fig. 1A ). Longer exposure to higher NaCl concentrations caused no further changes in PpENA1 expression (data not shown). The response to increasing Na+ was nonlinear, suggesting the induction response is saturated by 60 mM NaCl (Fig. 1, A and B). In contrast, exposure to KCl had no effect on PpENA1 expression (data not shown).
qRT-PCR was also performed for PpENA2, but the level of expression was too low in the protonemata to allow proper analysis (Table I ).
To determine whether the induction of PpENA1 was specific to Na+ stress, protonemata were exposed to NaCl, osmotic stress, cold, oxidative stress, or ABA. Only NaCl treatment caused significant induction of PpENA1 mRNA (Fig. 1B). To test whether the Na+-induced up-regulation of PpENA1 was due to ionic or osmotic effects, protonemata were exposed to a similar decrease in water potential using either 60 mM NaCl or 30 mM polyethylene glycol (PEG) 1,500 for 4 and 8 h (Fig. 1C). After 8 h, osmotic treatment led to a 10-fold induction, compared to a 30-fold induction with NaCl, indicating that the induction of PpENA1 expression under Na+ stress is due to a combination of osmotic and ionic effects.
The expression of PpENA1 and PpENA2 in protonema and gametophyte were analyzed using RT-PCR and mRNA levels were compared to a selection of control genes (Table I). BLAST searches in the recently released draft of the genomic sequences (http://moss.nibb.ac.jp) confirmed that single copies of PpENA1 and PpENA2 are present in the Physcomitrella genome. The primers used for RT-PCR were designed to the 3' end of the genes based on publicly available EST sequences. Besides the nonspliced PpENA2 mRNA, three putative splice variants have been identified (Benito and Rodríguez-Navarro, 2003
To determine whether PpENA1 expression was confined to certain cell types, wild-type Physcomitrella was transformed with a construct containing a PpENA1 promoter-GUS fusion. The promoter-GUS construct consisted of 1,311 bp upstream of the putative transcription start site and a 137-bp 5'-untranslated region (UTR). The publicly available EST sequences originate from a cDNA library with mainly full-length cDNAs and 5' UTR is defined as the sequence included in the ESTs (BJ188922 and BJ191872; Nishiyama et al., 2003
In silico analysis of the promoter was performed to identify putative cis-regulatory elements, which could be responsible for the observed expression pattern (Fig. 2G). Several elements were identified that are known to be up-regulated under dehydration stress (Myb, Myc, and CE-1 coupling elements; Yamaguchi-Shinozaki and Shinozaki, 2005
To determine the importance of PpENA1 in Physcomitrella, mutants lacking Na+-ATPase were generated. The nptII selective gene was inserted into a cDNA clone of PpENA1 using a ClaI site situated 1,189 bp downstream of the start ATG. This knockout cassette was used for transformation of wild-type Physcomitrella. After selection, 15 stable transformants were obtained. The stable transformants were PCR screened using genomic DNA as a template and primers specific to either side of the ClaI restriction site (Fig. 3A ). A short PCR fragment (488 bp) would be generated if the wild-type PpENA1 gene was still present. A primer pair annealing to the nptII cassette was also included in the PCR reaction (792 bp) as a positive control. For three independent lines (ena1-7, -14, and -15), PCR reactions consistently gave the 792-bp nptII fragment and no 488-bp PpENA1 fragment (Fig. 3B). To confirm that the knockout cassette had replaced the PpENA1 gene, mRNA was purified from wild-type and ena1 protonemata exposed to 100 mM NaCl. A clear increase in PpENA1 mRNA was observed over time in the wild type, whereas the PpENA1 transcript levels remained at the background level in the ena1 mutants (Fig. 3C).
One of the reasons Na+ is toxic to plants is that Na+ can replace K+ in certain enzymes, rendering them nonfunctional. To test whether the lack of PpENA1 affected the K+-to-Na+ ratio in Physcomitrella under NaCl stress, gametophytes were placed on medium containing 100, 200, or 400 mM NaCl for 1, 3, or 7 d. The K+-to-Na+ ratio in the untreated wild type was 30 ± 6 (n = 6), whereas the ena1 lines had a slightly higher K+-to-Na+ ratio of 39 ± 1 (n = 9; P < 0.05). Within 1 d of exposure to high levels of NaCl, the K+-to-Na+ ratio decreased dramatically (Fig. 4A ). At 200 and 400 mM NaCl, the K+-to-Na+ ratio remained low and, even after 7 d, no significant recovery was observed. Upon exposure to 100 mM NaCl, however, the wild type was able to improve the K+-to-Na+ ratio by 50% after 3 d. In contrast, no significant recovery was observed in the ena1 lines. To determine whether the ability of the wild-type plants to improve the K+-to-Na+ ratio at 100 mM was due to exclusion of Na+, the intracellular Na+ and K+ concentrations were measured. Both wild type and ena1 mutants experienced a dramatic increase in intracellular Na+ concentration in the first 24 h after transfer to 100 mM NaCl. In the wild-type gametophytes, however, no further increase was observed (Fig. 4B). In contrast, the intracellular Na+ concentration increased further by 60% to 100% in the ena1 mutants (Fig. 4C; P < 0.001) to be almost the same as the external Na+ concentration. The intracellular K+ concentration increased to the same extent in both wild type and ena1 mutants.
Growth of Wild-Type and ena1 Plants under Salt Stress To establish whether the inability to improve the K+-to-Na+ ratio had a negative effect on fitness, wild-type and ena1 plants were grown on standard or salt-containing medium. The growth experiment was initiated using protoplasts to ensure that the starting material was homogeneous. Protoplasts were allowed to regenerate for 2 weeks before being transferred to medium containing 0, 100, or 200 mM NaCl. Growth was followed for 4 to 8 weeks by measuring the diameter of moss colonies. On standard medium without added NaCl, no statistically significant difference in growth was observed between wild-type and ena1 plants, although ena1 appeared to grow marginally better (Fig. 5, A and D ). When tissue was transferred to medium containing 100 mM NaCl, ena1 grew significantly slower and, after 4 weeks, the diameter of the ena1 colonies were 36% smaller than wild type (Fig. 5, B and C; P < 0.005). No growth impairment was observed for the wild type, which grew at a similar rate on standard or 100 mM NaCl medium. When tissue was transferred to medium containing 100 mM KCl and growth was followed for 4 weeks, no significant difference was observed between wild-type and ena1 plants (colony diameter of wild type = 6.8 ± 0.9 mm [n = 47]; ena1 = 6.9 ± 0.8 mm [n = 44]). When wild-type and ena1 tissue was transferred to medium containing 200 mM of NaCl or KCl, both lines grew significantly slower than on standard medium, but no difference in growth was observed. Even after an extended growth period, none of the colonies exposed to 200 mM NaCl or KCl formed thallus, but remained in the protonemal state.
Exposure to stressful levels of NaCl often leads to loss of chlorophyll and development of chlorotic areas. Although ena1 growth was impaired at 100 mM NaCl, the colonies did not appear paler or more chlorotic than wild type under these conditions. Total chlorophyll was extracted from wild-type and ena1 plants grown on standard or 100 mM NaCl medium to determine more precisely whether the total level or composition of chlorophyll was changed. The chlorophyll in nonstressed tissue was 21 ± 3 and 19 ± 1 mg chl/g dry weight for ena1 and wild type, respectively. No significant difference was observed between ena1 and wild-type plants grown at 100 mM NaCl having 18 ± 2 and 19 ± 1 mg chl/g dry weight, respectively. However, a small decrease in the chl a/b ratio was observed in the ena1 tissue compared to wild type grown at 100 mM being 2.01 ± 0.03 and 2.14 ± 0.09, respectively (P < 0.05).
Physcomitrella is tolerant of high levels of NaCl in the surrounding medium and can maintain growth at Na+ concentrations that would be detrimental to most vascular plants (Benito and Rodríguez-Navarro, 2003
The large (25- to 30-fold) transcriptional up-regulation, specifically in response to NaCl, implies an important functional role of PpENA1 in salinity tolerance (Fig. 1). This up-regulation is much more substantial than the 2- to 5-fold up-regulation of the salt-responsive Na+/H+ antiporters observed in vascular plants (Shi et al., 2002
A 6-nucleotide element (GT-1) was recently identified in the promoter of a calmodulin from soybean (Glycine max; Park et al., 2004
In vascular plants, regulation of the two Na+/H+ antiporters (NHX1 and SOS1) appears to be very similar to PpENA1, although differences are also apparent. In Arabidopsis, AtNHX1 is up-regulated after exposure to high levels of NaCl or KCl (Gaxiola et al., 1999
In vascular plants, the salt-specific response is also posttranslationally coordinated via the SOS pathway consisting of a Ser-Thr kinase (SOS2) and a calcium-binding protein (SOS3; Shi et al., 2000
The capacity of plants to maintain a high K+-to-Na+ ratio is likely to be a key determinant in salt tolerance. The steady-state level of both ions will ultimately reflect the sum of the many transporters involved in uptake, efflux, and compartmentation. To determine the physiological advantage of having Na+-ATPase in planta, the K+-to-Na+ ratio was determined at different NaCl concentrations (Fig. 4A). The salt stress experiment clearly showed that wild-type Physcomitrella was able to maintain a higher K+-to-Na+ ratio at 100 mM NaCl than the ena1 mutant. However, at higher NaCl concentrations, the advantage of having PpENA1 disappeared and the K+-to-Na+ ratio in wild type and ena1 was similar. Under severe stress (200–400 mM NaCl), it appears that PpENA1 is overwhelmed and no difference in the growth or K+-to-Na+ ratio of ena1 and wild-type plants could be observed (Figs. 4A and 5C).
Growth impairment correlated well with the intracellular K+-to-Na+ ratio; when the ratio was 3 or above, growth was similar to the nonstressed control, but at 2 or below, growth was impaired. A similar observation has been made in yeast, where normal growth was observed only when the K+-to-Na+ ratio was above 2 (Bañuelos et al., 1998
One of the reasons for Na+ toxicity is that Na+ can replace K+ in essential enzymes and thereby inactivate them. Under severe Na+ toxicity, metabolism and photosynthesis will be affected, leading to decreased levels of chlorophyll. No difference in chlorophyll content per unit dry weight was observed between stressed and nonstressed tissue or between ena1 and wild-type plants. Hence, it appears that, although ena1 plants contain more intracellular Na+, it is able to protect the sensitive components either by sequestering the Na+ in the vacuole, synthesizing compatible osmolytes, or up-regulating levels of protective proteins. Up-regulation of a dehydrin-like protein essential for the recovery of Physcomitrella after salt stress and of an enzyme involved in protection against reactive oxygen species has recently been shown (Lunde et al., 2006
In Arabidopsis, AtSOS1 is mainly expressed in the epidermis cells of the root tip, the pericycle, and the parenchyma cells bordering the xylem, suggesting that AtSOS1 is involved in xylem loading-unloading of Na+ and some exclusion into the soil (Shi et al., 2002
The functional role, if any, of the PpENA1 homolog, PpENA2, is still unknown. However, it is clear that PpENA2 expression is significantly lower than PpENA1 and this low expression level is not able to complement the PpENA1 knockout at 100 mM NaCl (Table I; Fig. 5, B and E). This is in line with previous experiments showing that PpENA2, in contrast to PpENA1, could not complement a salt-sensitive yeast strain (ena1-4, nha1) on high-salt medium (Benito and Rodríguez-Navarro, 2003
When PpENA1 apparently gives Physcomitrella a clear selective advantage under moderate salt stress, it is intriguing that Na+-ATPases are absent in vascular plants. The presence of both a Na+,K+-ATPase and a SOS1 homolog in the red alga, Porphyra, living in the sea at high salinity and alkaline pH also suggests that having both types of pumps is important. The early land on which plants evolved was likely to be oligotrophic and low in Na+ (Rodríguez-Navarro and Rubio, 2006
One explanation for why PpENA1 apparently has been conserved in Physcomitrella could be that moss and fungi, unlike vascular plants, are able to undergo significant water loss and still be viable (Frank et al., 2005
The correlation between PpENA1 expression and salt tolerance raises the possibility that heterologous expression of PpENA1 may improve the salt tolerance of crop plants. Heterologous expression of AtNHX1 in diverse plants like Brassica, tomato (Solanum lycopersicum), and wheat (Triticum aestivum) allowed all three crops to grow under highly saline conditions and even produced a higher yield with similar properties to wild-type plants growing under nonstressful conditions (Zhang et al., 2001
Plant Material and Growth Conditions
Physcomitrella patens (Hedw.) derived from a wild-type specimen collected in Gransden Wood in Huntingdonshire, UK (Ashton and Cove, 1977
The growth rate of wild-type and ena1 knockout lines under salt stress was determined by generating protoplasts (Schaefer and Zryd, 1997
Total RNA was extracted from protonemata or gametophytes using TRIzol (Invitrogen) according to the manufacturer's instructions. Purified RNA was treated with DNaseI using the DNA-free kit (Ambion). RNA integrity was checked on a 1% (w/v) agarose gel containing ethidium bromide. cDNA was synthesized using SuperScript III first-strand synthesis system (Invitrogen) and 2.5 µM oligo(dT) (18–20) primer according to the manufacturer's protocol. Four control genes—histone3 (BT003326), elongation factor 1
Genomic DNA was purified as in Schlink and Reski (2002)
To obtain stable knockouts of PpENA1, a cassette containing p35S-nptII-CamVter was excised from pMBL6 (http://www.biology.wustl.edu/moss/pmbl6.jpg) using ClaI and inserted into a unique ClaI site in the PpENA1 gene (Benito and Rodríguez-Navarro, 2003
The 1,448-bp DNA fragment directly upstream from the PpENA1 coding region was obtained by nested PCR using genomic DNA as template. The first PCR was done using oCL136 (CTTGTCCCCAGAGCCCTCC) and oCL138 (GCAGGTAGCTTCCAAATTCTCT), and the second PCR using oCL137 (CACCTTCGCAACTTCGCAAC) and oCL139 (CGTACACCAGCAGACATTAGTG). The fragment was cloned into PCR8/GW/TOPO (Invitrogen) and transferred to a destination vector containing the GUS reporter gene (pMDC162; Curtis and Grossniklaus, 2003
Five-week-old gametophytes were transferred from standard medium to medium containing 100, 200, or 400 mM NaCl. In the standard medium, 1 mM CaCl2 was added and 1.3, 1.7, 2.0 mM CaCl2, respectively, were added to the NaCl-containing medium to keep the level of available Ca2+ constant (see above). After 1, 3, or 7 d of exposure, gametophytes were washed for 5 s in 10 mM CaCl2 and allowed to drain briefly on Whatman filter paper. The single short wash was selected to minimize leakage and loss of intracellular K+ and Na+ during washing. Preliminary experiments had shown that, for tissue exposed to 100 or 200 mM NaCl for 4 h, a 5-s wash led to a 75% and 87% reduction in NaCl compared to an unwashed control. A subsequent second washing step led to only a further 2% to 4% decrease in tissue Na+. The water content of the gametophytes was determined by weighing the samples before and after drying overnight at 80°C. Na+ and K+ content was determined after digestion in 10 mM nitric acid overnight at 80°C and analyses using a flame photometer (Sherwood 420).
The total chlorophyll content of protonemata was determined by measuring the absorbance of acetone extracts at 652, 647, and 663 nm (Arnon, 1949 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number EF683141.
We acknowledge Dr. Jesse Machuka as part of the Physcomitrella EST Program at the University of Leeds and Washington University for supplying pMBL6. We also thank Neil J. Shirley for excellent technical assistance and Alonso Rodríguez-Navarro for kindly supplying the vector containing PpENA1. Received December 20, 2006; accepted June 4, 2007; published June 7, 2007.
1 This work was supported by the Australian Research Council and the State Government of South Australia (grants to D.P.D., A.K.J., M.T.) and by the Danish Research Council (grant to C.L.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Christina Lunde (chlu{at}life.ku.dk). www.plantphysiol.org/cgi/doi/10.1104/pp.106.094946 * Corresponding author; e-mail chlu{at}life.ku.dk; fax 45–35–33–33–33.
Apse MP, Aharon GS, Snedden WA, Blumwald E (1999) Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285: 1256–1258 Arnon DI (1949) Copper enzymes in isolated chloroplasts—polyphenoloxidase in Beta vulgaris. Plant Physiol 24: 1–15[Medline] Ashton NW, Cove DJ (1977) Isolation and preliminary characterization of auxotrophic and analog resistant mutants of moss, Physcomitrella patens. Mol Gen Genet 154: 87–95[CrossRef][Web of Science] Ashton NW, Grimsley NH, Cove DJ (1979) Analysis of gametophytic development in the moss Physcomitrella patens using auxin and cytokinin resistant mutants. Planta 144: 427–435[CrossRef][Web of Science] Bañuelos MA, Quintero FJ, Rodríguez-Navarro A (1995) Functional expression of the ENA1(PMR2)-ATPase of Saccharomyces cerevisiae in Schizosaccharomyces pombe. Biochim Biophys Acta 1229: 233–238[Medline] Bañuelos MA, Sychrova H, Bleykasten-Grosshans C, Souciet JL, Potier S (1998) The Nha1 antiporter of Saccharomyces cerevisiae mediates sodium and potassium efflux. Microbiology 144: 2749–2758 Barkla BJ, Vera-Estrella R, Maldonado-Gama M, Pantoja O (1999) Abscisic acid induction of vacuolar H+-ATPase activity in Mesembryanthemum crystallinum is developmentally regulated. Plant Physiol 120: 811–819 Benito B, Garciadeblas B, Rodríguez-Navarro A (2002) Potassium- or sodium-efflux ATPase, a key enzyme in the evolution of fungi. An Microbiol (Rio J) 148: 933–941 Benito B, Rodríguez-Navarro A (2003) Molecular cloning and characterization of a sodium-pump ATPase of the moss Physcomitrella patens. Plant J 36: 382–389[CrossRef][Web of Science][Medline] Burton RA, Shirley NJ, King BJ, Harvey AJ, Fincher GB (2004) The CesA gene family of barley: quantitative analysis of transcripts reveals two groups of co-expressed genes. Plant Physiol 134: 224–236 Chinnusamy V, Jagendorf A, Zhu JK (2005) Understanding and improving salt tolerance in plants. Crop Sci 45: 437–448 Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133: 462–469 Frank W, Ratnadewi D, Reski R (2005) Physcomitrella patens is highly tolerant against drought, salt and osmotic stress. Planta 220: 384–394[CrossRef][Web of Science][Medline] Fukuda A, Nakamura A, Tagiri A, Tanaka H, Miyao A, Hirochika H, Tanaka Y (2004) Function, intracellular localization and the importance in salt tolerance of a vacuolar Na+/H+ antiporter from rice. Plant Cell Physiol 45: 146–159 Garciadeblas B, Rubio F, Quintero FJ, Bañuelos MA, Haro R, Rodríguez-Navarro A (1993) Differential expression of 2 genes encoding isoforms of the ATPase involved in sodium-efflux in Saccharomyces cerevisiae. Mol Gen Genet 236: 363–368[CrossRef][Web of Science][Medline] Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL, Fink GR (1999) The Arabidopsis thaliana proton transporters, AtNhx1 and Avp1, can function in cation detoxification in yeast. Proc Natl Acad Sci USA 96: 1480–1485 Gong DM, Guo Y, Schumaker KS, Zhu JK (2004) The SOS3 family of calcium sensors and SOS2 family of protein kinases in Arabidopsis. Plant Physiol 134: 919–926 Hahnenberger KM, Jia ZP, Young PG (1996) Functional expression of the Schizosaccharomyces pombe Na+/H+ antiporter gene, sod2, in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 93: 5031–5036 Jefferson RA (1989) The GUS reporter gene system. Nature 342: 837–838[CrossRef][Medline] Kamisugi Y, Cuming AC (2005) The evolution of the abscisic acid-response in land plants: comparative analysis of group 1 LEA gene expression in moss and cereals. Plant Mol Biol 59: 723–737[CrossRef][Web of Science][Medline] Kant S, Kant P, Raveh E, Barak S (2006) Evidence that differential gene expression between the halophyte, Thellungiella halophila, and Arabidopsis thaliana is responsible for higher levels of the compatible osmolyte proline and tight control of Na+ uptake in T-halophila. Plant Cell Environ 29: 1220–1234[CrossRef][Medline] Kishor PBK, Hong ZL, Miao GH, Hu CAA, Verma DPS (1995) Overexpression of delta-pyrroline-5-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants. Plant Physiol 108: 1387–1394[Abstract] Knight CD, Sehgal A, Atwal K, Wallace JC, Cove DJ, Coates D, Quatrano RS, Bahadur S, Stockley PG, Cuming AC (1995) Molecular responses to abscisic acid and stress are conserved between moss and cereals. Plant Cell 7: 499–506[Abstract] Lunde C, Baumann U, Shirley NJ, Drew DP, Fincher GB (2006) Gene structure and expression pattern analysis of three monodehydroascorbate reductase (Mdhar) genes in Physcomitrella patens: implications for the evolution of the MDHAR family in plants. Plant Mol Biol 60: 259–275[CrossRef][Web of Science][Medline] Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405–410[CrossRef][Web of Science][Medline] Munns R, Cramer R, Ball MC (1999) Interactions between rising CO2, soil salinity and plant growth. In Y Luo, HA Mooney, eds, Carbon Dioxide and Environmental Stress. Academic Press, London, pp 139–167 Nishiyama T, Fujita T, Shin-I T, Seki M, Nishide H, Uchiyama I, Kamiya A, Carninci P, Hayashizaki Y, Shinozaki K, et al (2003) Comparative genomics of Physcomitrella patens gametophytic transcriptome and Arabidopsis thaliana: implications for land plant evolution. Proc Natl Acad Sci USA 100: 8007–8012 Pardo JM, Cubero B, Leidi EO, Quintero FJ (2006) Alkali cation exchangers: roles in cellular homeostasis and stress tolerance. J Exp Bot 57: 1181–1199 Park HC, Kim ML, Kang YH, Jeon JM, Yoo JH, Kim MC, Park CY, Jeong JC, Moon BC, Lee JH, et al (2004) Pathogen- and NaCl-induced expression of the SCaM-4 promoter is mediated in part by a GT-1 box that interacts with a GT-1-like transcription factor. Plant Physiol 135: 2150–2161 Qiu QS, Guo Y, Quintero FJ, Pardo JM, Schumaker KS, Zhu JK (2004) Regulation of vacuolar Na+/H+ exchange in Arabidopsis thaliana by the salt-overly-sensitive (SOS) pathway. J Biol Chem 279: 207–215 Reski R (1998) Development, genetics and molecular biology of mosses. Bot Acta 111: 1–15[Web of Science] Rodríguez-Navarro A, Rubio F (2006) High-affinity potassium and sodium transport systems in plants. J Exp Bot 57: 1149–1160 Saavedra L, Svensson J, Carballo V, Izmendi D, Welin B, Vidal S (2006) A dehydrin gene in Physcomitrella patens is required for salt and osmotic stress tolerance. Plant J 45: 237–249[CrossRef][Web of Science][Medline] Sakamoto A, Murata N (2002) The role of glycine betaine in the protection of plants from stress: clues from transgenic plants. Plant Cell Environ 25: 163–171[CrossRef][Medline] Schaefer DG, Zryd JP (1997) Efficient gene targeting in the moss Physcomitrella patens. Plant J 11: 1195–1206[CrossRef][Web of Science][Medline] Schlink K, Reski R (2002) Preparing high-quality DNA from moss. Plant Mol Biol Rep 20: 423a–423f[CrossRef] Shen JQ, Casaretto JA, Zhang P, Ho THD (2004) Functional definition of ABA-response complexes: the promoter units necessary and sufficient for ABA induction of gene expression in barley (Hordeum vulgare L.). Plant Mol Biol 54: 111–124[CrossRef][Web of Science][Medline] Shi HZ, Ishitani M, Kim CS, Zhu JK (2000) The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proc Natl Acad Sci USA 97: 6896–6901 Shi HZ, Lee BH, Wu SJ, Zhu JK (2003) Overexpression of a plasma membrane Na+/H+ antiporter gene improves salt tolerance in Arabidopsis thaliana. Nat Biotechnol 21: 81–85[CrossRef][Web of Science][Medline] Shi HZ, Quintero FJ, Pardo JM, Zhu JK (2002) The putative plasma membrane Na+/H+ antiporter SOS1 controls long-distance Na+ transport in plants. Plant Cell 14: 465–477 Shi HZ, Zhu JK (2002) Regulation of expression of the vacuolar Na+/H+ antiporter gene AtNHX1 by salt stress and abscisic acid. Plant Mol Biol 50: 543–550[CrossRef][Web of Science][Medline] Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA (1995) An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res 23: 1087–1088 Tarczynski MC, Jensen RG, Bohnert HJ (1993) Stress protection of transgenic tobacco by production of the osmolyte mannitol. Science 259: 508–510 Tester M, Davenport R (2003) Na+ tolerance and Na+ transport in higher plants. Ann Bot (Lond) 91: 503–527 Wu SJ, Ding L, Zhu JK (1996) SOS1, a genetic locus essential for salt tolerance and potassium acquisition. Plant Cell 8: 617–627[Abstract] Xu DP, Duan XL, Wang BY, Hong BM, Ho THD, Wu R (1996) Expression of a late embryogenesis abundant protein gene, HVA1, from barley confers tolerance to water deficit and salt stress in transgenic rice. Plant Physiol 110: 249–257[Abstract] Xue ZY, Zhi DY, Xue GP, Zhang H, Zhao YX, Xia GM (2004) Enhanced salt tolerance of transgenic wheat (Triticum aestivum L.) expressing a vacuolar Na+/H+ antiporter gene with improved grain yields in saline soils in the field and a reduced level of leaf Na+. Plant Sci 167: 849–859 Yamaguchi-Shinozaki K, Shinozaki K (2005) Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters. Trends Plant Sci 10: 88–94[CrossRef][Web of Science][Medline] Yokoi S, Quintero FJ, Cubero B, Ruiz MT, Bressan RA, Hasegawa PM, Pardo JM (2002) Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant J 30: 529–539[CrossRef][Web of Science][Medline] Zhang HX, Blumwald E (2001) Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nat Biotechnol 19: 765–768[CrossRef][Web of Science][Medline] Zhang HX, Hodson JN, Williams JP, Blumwald E (2001) Engineering salt-tolerant Brassica plants: characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation. Proc Natl Acad Sci USA 98: 12832–12836 Related articles in Plant Physiol.:
This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|