Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online July 20, 2007; 10.1104/pp.107.102285

Plant Physiology 145:119-134 (2007)
© 2007 American Society of Plant Biologists

OPEN ACCESS ARTICLE
This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrowOA All Versions of this Article:
145/1/119    most recent
pp.107.102285v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saracco, S. A.
Right arrow Articles by Vierstra, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saracco, S. A.
Right arrow Articles by Vierstra, R. D.
Agricola
Right arrow Articles by Saracco, S. A.
Right arrow Articles by Vierstra, R. D.
ENVIRONMENTAL STRESS AND ADAPTATION TO STRESS

Genetic Analysis of SUMOylation in Arabidopsis: Conjugation of SUMO1 and SUMO2 to Nuclear Proteins Is Essential1,[OA]

Scott A. Saracco, Marcus J. Miller, Jasmina Kurepa2 and Richard D. Vierstra*

Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706–1574


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The posttranslational addition of small ubiquitin-like modifiers (SUMOs) to other intracellular proteins has been implicated in a variety of eukaryotic functions, including modifying cytoplasmic signal transduction, nuclear import and subnuclear compartmentalization, DNA repair, and transcription regulation. For plants, in particular, both genetic analyses and the rapid accumulation of SUMO conjugates in response to various adverse environmental conditions suggest that SUMOylation plays a key role in the stress response. Through genetic analyses of various SUMO conjugation mutants, we show here that the SUMO1 and SUMO2 isoforms, in particular, and SUMOylation, in general, are essential for viability in Arabidopsis (Arabidopsis thaliana). Null T-DNA insertion mutants affecting the single genes encoding the SUMO-activating enzyme subunit SAE2 and the SUMO-conjugating enzyme SCE1 are embryonic lethal, with arrest occurring early in embryo development. Whereas the single genes encoding the SUMO1 and SUMO2 isoforms are not essential by themselves, double mutants missing both are also embryonic lethal. Viability can be restored by reintroduction of SUMO1 expression in the homozygous sum1-1 sum2-1 background. Various stresses, like heat shock, dramatically increase the pool of SUMO conjugates in planta. This increase involves SUMO1 and SUMO2 and is mainly driven by the SUMO protein ligase SIZ1, with most of the conjugates accumulating in the nucleus. Taken together, it appears that SIZ1-mediated conjugation of SUMO1 and SUMO2 to other intracellular proteins is essential in Arabidopsis, possibly through stress-induced modification of a potentially diverse pool of nuclear proteins.


In recent years, the posttranslational addition of ubiquitin (Ub)-fold proteins to other intracellular molecules has been implicated in the control of many aspects of eukaryotic development, homeostasis, and stress protection (Downes and Vierstra, 2005Go). Ub, the first of this group to be discovered, functions primarily in selective protein turnover, where the covalent attachment of multiple Ub monomers commits short-lived proteins for breakdown by the multicatalytic protease complex, the 26S proteasome (Smalle and Vierstra, 2004Go). In plants, at least seven other Ub-fold proteins have been discovered to date, including SMALL UBIQUITIN-LIKE MODIFIER (SUMO), RELATED TO UBIQUITIN1 (RUB1; or Nedd8), AUTOPHAGY8 (ATG8) and ATG12, UBIQUITIN-FOLD MODIFIER (UFM), HOMOLOGY TO UBIQUITIN (HUB), and MEMBRANE-ANCHORED UBIQUITIN-FOLD PROTEIN (MUB; Downes and Vierstra, 2005Go; Downes et al., 2006Go). Whereas some become conjugated to lipids (ATG8) and prenyl groups (MUB) to direct their membrane association, the rest become attached to other proteins to affect the functions, interactions, and/or half-lives of the modified targets.

Based on the number and diversity of protein substrates, one influential set of Ub-fold proteins encompasses the SUMO (or sentrin) family (Melchior, 2000Go; Johnson, 2004Go; Hay, 2005Go). Like Ub, SUMOs become covalently attached via their C-terminal Gly to accessible Lys in the target by an ATP-dependent E1 -> E2 -> E3 -> protein conjugation cascade. Whereas the Ub activation step uses a single E1 polypeptide (UBA1), SUMO activation is driven by a SUMO-activating enzyme (SAE1)/SAE2 heterodimer where the SAE1 and SAE2 polypeptides are equivalent to the N- and C-terminal halves of UBA1, respectively. Conversely, Ub attachment involves numerous conjugating enzymes (Smalle and Vierstra, 2004Go), but only a single SUMO-conjugating enzyme (SCE1 or E2) is used for SUMO. Myriad protein ligases (or E3s) assist in ubiquitination (more than 1,300 are predicted in Arabidopsis [Arabidopsis thaliana; Smalle and Vierstra, 2004Go]), but it is not yet clear how many ligases participate in SUMOylation. To date, only a few SUMO E3s have been described, including members of the SAP and Miz (SIZ1)/protein inhibitor of STAT (PIAS) family (Johnson and Gupta, 2001Go), the nuclear pore component Ran-binding protein 2 (RanBP2; Kirsh et al., 2002Go; Pichler et al., 2004Go), the polycomb complex 2 (Kagey et al., 2003Go), and the Smc5-6 complex (Andrews et al., 2005Go). In some cases, a consensus motif {Psi}KXE (where {Psi} indicates a hydrophobic residue and K represents the Lys that links the SUMO moiety [Rodriguez et al., 2001Go]) in the target helps direct SUMO attachment, likely through direct interaction of this sequence with SCE1. A number of deSUMOylating enzymes (or Ub-like proteases [ULPs]) also exist that can selectively cleave the isopeptide bond between the C-terminal Gly of SUMO and the target Lys (Hay, 2005Go; Bossis and Melchior, 2006Go). Through this activity, ULPs can reverse the action of SUMO addition. Arabidopsis, in particular, encodes numerous potential ULPs, suggesting that this step is especially important in the plant kingdom (Kurepa et al., 2003Go; Murtas et al., 2003Go; Colby et al., 2006Go; Chosed et al., 2007Go).

The functions of SUMOylation are best understood in yeast and animal cells, where roles in signal transduction, the cell cycle, DNA repair, transcription regulation, nuclear import and subnuclear compartmentalization, and viral pathogenesis have been observed (Johnson, 2004Go; Hay, 2005Go; Bossis and Melchior, 2006Go). In Saccharomyces cerevisiae, for example, mutations in the single genes that encode SUMO (SMT3), either of the E1 subunits (UBA2 and AOS1), or the E2 (UBC9) subunit are nonviable; the mutants display strong cell cycle defects and arrest at the G2/M boundary (Meluh and Koshland, 1995Go; Seufert et al., 1995Go; Johnson and Blobel, 1997Go; Johnson et al., 1997Go; Giaever et al., 2002Go). Mutations in equivalent subunits in Schizosaccharomyces pombe are viable, but display severely impaired growth, mitotic defects, and enhanced genome instability (Shayeghi et al., 1997Go; Tanaka et al., 1999Go; Ho et al., 2001Go). A role for SUMO in nuclear import was discovered from the first SUMO target identified, animal RanGAP (Mahajan et al., 1998Go; Matunis et al., 1998Go). This GTPase is reversibly bound to the nuclear pore using SUMOylation to help shuttle between the cytosolic and nuclear forms.

A number of transcription factors are rapidly modified with SUMOs in response to various stresses (Hong et al., 2001Go; Huang et al., 2003Go; Sramko et al., 2006Go). In some cases, SUMO addition promotes transcription factor activity, whereas for others activity is repressed, suggesting that SUMOylation helps globally alter, both positively and negatively, the transcriptome during the stress response. In a few cases, the SUMOylation machinery can even compete with ubiquitination for the same Lys (Hay, 2005Go). The best-understood examples are the I{kappa}B{alpha} repressor of nuclear factor-{kappa}B (NF-{kappa}B; Desterro et al., 1998Go) and the DNA damage regulator proliferating cell nuclear antigen (Hoege et al., 2002Go), which undergo ubiquitination or SUMOylation to either direct their degradation or stabilization, respectively.

Given that many SUMO functions are nuclear, it is not surprising that both components of the SUMO conjugation pathway and SUMO-conjugated proteins themselves are enriched in or near this compartment (Lehembre et al., 2000Go; Zhang et al., 2002Go; Hay, 2005Go; Bossis and Melchior, 2006Go). In fact, many nuclear proteins in yeast and animals were discovered by mass spectrometry to be SUMOylated (Panse et al., 2004Go; Vertegaal et al., 2004Go; Wohlschlegel et al., 2004Go; Zhao et al., 2004Go; Zhou et al., 2004Go; Hannich et al., 2005Go).

In plants, the roles of SUMO are less clear and in some cases remain enigmatic. Whereas yeast contains a single SUMO isoform and four isoforms are expressed in humans, eight potentially functional SUMO-encoding genes (SUM1–8) are present in the Arabidopsis genome (Kurepa et al., 2003Go; Lois et al., 2003Go). As in animals (Saitoh and Hinchey, 2000Go; Hong et al., 2001Go), one or more Arabidopsis SUMO isoforms are rapidly conjugated to various intracellular targets following exposure of the plants to various abiotic stresses, including heat shock, amino acid analogs, hydrogen peroxide, ethanol, and cold (Kurepa et al., 2003Go; Miura et al., 2007Go). Overexpression of HSP70, which enhances thermotolerance, concomitantly attenuates this heat-induced increase in SUMOylation (Kurepa et al., 2003Go). The only Arabidopsis SUMO conjugation pathway mutant reported to date affects SIZ1 E3, the sole member of the SIZ1/PIAS family detected thus far in the Arabidopsis genome. These siz1 plants are viable, but show a range of phenotypic defects, including hypersensitivity to phosphate deficiency (Miura et al., 2005Go) and reduced tolerance to high-temperature and freezing stress (Yoo et al., 2006Go; Miura et al., 2007Go). In addition, SUMOylation has been tentatively connected to photoperiodism with evidence that the Arabidopsis early in short days4 (esd4) mutant, which affects a predicted ULP, enhances flowering time (Murtas et al., 2003Go). Arabidopsis plants overexpressing SUMO1 have attenuated growth responses to abscisic acid (ABA), suggesting a role for SUMOylation in signaling by this hormone (Lois et al., 2003Go). Whereas it is possible that plants, like animals, SUMOylate RanGAP, there is no evidence that the plant version is modified with SUMO in vivo; in fact, Arabidopsis RanGAP is missing the consensus SUMOylation domain present in its mammalian counterparts (Rose and Meier, 2001Go).

Several studies have proposed that SUMOylation directly participates in plant pathogenesis. A tomato (Solanum lycopersicon) SUMO ortholog was found to interact with the effector ethylene-induced xylanase EIX from the fungus Trichoderma viridae, and when SUMO is overexpressed infection is reduced (Hanania et al., 1999Go). Arabidopsis siz1 mutants have elevated levels of salicylic acid (SA), a concomitant increase in pathogenesis-related proteins, and show increased resistance to certain pathogens, suggesting that SIZ1 negatively regulates basal defense through SUMOylation of one or more targets (Lee et al., 2007Go). Orth et al. (2000)Go first proposed that the Xanthomonas campestris type III-secreted effector AvrBsT is a SUMO protease based on limited sequence homology with ULPs. However, subsequent studies revealed that AvrBsT and related proteins may actually be protein acetyltransferases and not SUMO hydrolases (Mukherjee et al., 2006Go). More recent studies have implicated two other Xanthomonas effectors, XopD and AvrXv4, in pathogen-directed host deSUMOylation, but their targets remain unknown (Hotson et al., 2003Go; Roden et al., 2004Go; Chosed et al., 2007Go). At least for AvrXv4, its SUMO isopeptidase activity has been confirmed in planta (Roden et al., 2004Go).

To further define the range of plant processes regulated by SUMOylation, we initiated a reverse-genetics analysis of the dominant SUMOs, SUMO1 and SUMO2, components of the SUMO E1 heterodimer (SAE1/2), and the SUMO E2 SCE1 in Arabidopsis. We show here that these proteins are essential and that their absence causes early embryonic arrest. In combination with an available null allele of the SUMO E3 SIZ1 (siz1-2; Miura et al., 2005Go), we demonstrate that SIZ1 is the major ligase responsible for the conjugation of SUMO1 and SUMO2 during heat stress in Arabidopsis and show that this stress-induced accumulation may be essential. Most of the heat-inducible SUMO1/2 conjugates are nuclear localized, indicating that the stress-induced SUMOylation of nuclear proteins may represent an important early step in the plant stress response.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Expression of SUMO Pathway Components

Prior genomic analyses identified numerous components of the Arabidopsis SUMO conjugation system using animal and yeast counterparts as queries (Kurepa et al., 2003Go; Lois et al., 2003Go; Murtas et al., 2003Go), several of which were subsequently confirmed by biochemical assays (Chosed et al., 2006Go; Colby et al., 2006Go). These include eight SUM genes (SUM1–8) that appear to have intact coding regions and one partial coding region that is a likely pseudogene (SUM9), two genes encoding SAE1 (SAE1a and b; At4g24940 and At5g50580) and one encoding SAE2 (At2g21470) of the E1 heterodimer, a single SCE1 gene (At3g57870) encoding the E2 along with one likely pseudogene (SCE1b; between At5g02240 and At5g02250), a single gene encoding the SIZ1 E3 (At5g60410), and at least 13 genes encoding potential deSUMOylating enzymes.

To help analyze the expression patterns for the SUMOs, the cognate E1 and E2, and the SIZ1 E3, we mined the Arabidopsis ESTs (http://www.arabidopsis.org) and the Genevestigator DNA microarray databases (https://www.genevestigator.ethz.ch; Zimmermann et al., 2004Go) for the transcriptional profiles of the corresponding genes, and employed immunoblot analysis to detect several of the encoded proteins. Identical to previous work (Kurepa et al., 2003Go), we confirmed by reverse transcription (RT)-PCR that SUM1 (At4g26840), SUM2 (At5g55160), SUM3 (At5g55170), and SUM5 (At2g32765) are the only loci that appear to be transcribed. (Coupled with the absence of the C-terminal di-Gly motif needed for conjugation [Kurepa et al., 2003Go] and the lack of expression data, it is likely that SUM4, SUM6, and SUM7 loci are pseudogenes.) Among the expressed loci, SUM1 and SUM2 are the most similar (93.5% amino acid sequence identity) and the most transcriptionally active. To date, 92 and 87 cDNAs for SUM1 and SUM2, respectively, are present in the Arabidopsis EST database (http://www.arabidopsis.org) versus only two and 31 cDNAs for SUM3 and SUM5, respectively. This trend was confirmed by the Genevestigator DNA microarray database where the signals generated by the SUM1 and SUM2 mRNAs from a variety of tissues/developmental stages were 2- to 50-fold higher than those for SUM3 or SUM5 (Fig. 1A ). Of all the RNA samples examined, those from roots and several floral tissues had substantially higher transcript levels for SUM3 and SUM5, respectively. This selective expression could reflect isoform-specific roles for SUMO3 and SUMO5 in roots and flowers. We note that the Genevestigator database also detected possible, albeit it low, expression of SUM4 (data not shown). Given the lack of confirmatory EST/cDNA/RT-PCR data that the SUM4 locus is actually transcribed, it is likely that these microarray signals represent cross-hybridization with other SUM transcripts.


Figure 1
View larger version (50K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Tissue-specific expression of SUMO and SUMO-conjugating enzymes. A and B, Transcript profiles of SUMOs and SUMO-conjugating enzymes by DNA microarray expression analysis. Data were extracted from Genevestigator (Zimmermann et al., 2004Go) for SUM1 to 3 and SUM5 (A), and SAE1a, SAE1b, SAE2, SCE1, and SIZ1 (B). C, Levels of SUMO, SUMO conjugates, and SUMO-conjugating enzymes in various Arabidopsis tissues. Tissues were extracted directly into 2 mL/g fresh weight of SDS-PAGE sample buffer, and equal volumes were subjected to SDS-PAGE and immunoblot analysis with anti-SUMO1, SAE1a, and SCE1 antibodies. An overexposure of the SUMO conjugate blot was included to better show the levels of free SUMO. Immunoblot analysis with antibodies against the 26S proteasome subunit PBA1 was included to show protein loading.

 
When the mRNA profiles of SAE1a, SAE1b, SAE2, SCE1, and SIZ1 in the Genevestigator database were analyzed similarly, we found that each is expressed in all tissues examined with little variation in their relative levels, indicating that the SUMO conjugation pathway is ubiquitously present (Fig. 1B). SAE1a and SAE1b, which encode very similar polypeptides (81% amino acid sequence identity), have comparable expression patterns, suggesting that they are functionally redundant. The E2 SCE1 locus appears to be the most highly expressed gene, with mRNA levels 2 to 10 times higher than the other components based on DNA microarray analysis and EST numbers (96 ESTs versus 43, 42, 14, and eight for SIZ1, SAE1a, SAE1b, and SAE2, respectively; http://www.arabidopsis.org). The low levels of the SAE2 transcript relative to those for SAE1a and SAE1b as judged by both EST numbers and DNA microarray analyses could indicate that the corresponding polypeptide is better translated and/or more stable relative to the two SAE1 subunit isoforms, which we presume would accumulate in stoichiometric amounts to form the E1 heterodimer.

When crude extracts derived from various tissues were subjected to SDS-PAGE and probed by immunoblotting, we also confirmed accumulation of several of the corresponding proteins. An antibody raised against recombinant SUMO1, which primarily cross-reacts with SUMO1 and SUMO2 (Kurepa et al., 2003Go), detected both SUMO and SUMO protein conjugates in all tissues (Fig. 1C). Interestingly, both conjugate abundance and profile differed substantially among the samples when equal amounts of tissue fresh weight were analyzed, indicating that SUMOylation varies widely in Arabidopsis tissues and that some conjugates may be tissue/cell specific. We also detected SAE1 and SCE1 proteins with apparent molecular masses close to their calculated sizes (36.1, 35.7, and 18.0 kD for SAE1a, SAE1b, and SCE1, respectively) using antibodies prepared against recombinant SAE1a and SCE1 (Fig. 1C). Along with free SUMO and SUMO conjugates, the levels of SCE1 were particularly high in flowers and siliques, whereas SAE1 levels were slightly elevated in flowers.


Genetic Analysis of SUMO Conjugation

To help define the importance of SUMOylation in plants, we searched for Arabidopsis T-DNA insertion mutants that should strongly impair expression of the cognate E1 and E2 proteins. Whereas useful lines were not available for SAE1b, we acquired one or more alleles disrupting the SAE1a, SAE2, or SCE1 loci within or near the predicted transcribed regions from the SIGNAL collection generated with the Columbia (Col)-0 background (Alonso et al., 2003Go; Figs. 2A and 3A ).


Figure 2
View larger version (57K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Characterization of the sae1a-1 mutant. A, Gene diagram of the SAE1a and SAE1b genes. Exons and introns are represented by boxes (black, coding region; white, UTR) and lines, respectively. Number of amino acids in each protein is indicated on the right. Insertion positions of the sae1a-1 and sae1a-2 T-DNA mutants are shown. Arrows show the positions of the RT-PCR primers used in B. B, RT-PCR analysis of wild-type Col-0 and homozygous sae1a-1 seedlings. RNA was subjected to first-strand cDNA synthesis with primers specific to either the 3'-UTR of SAE1a (primer 5) or an internal site in SAE1a (primer 4) and then to PCR using the indicated gene-specific primers. RT-PCR of the PAE2 mRNA encoding the 26S proteasome {alpha}5 subunit and genomic PCR of the SAE1a loci were included as controls. C, RNA gel-blot analysis with a SAE1a probe of total RNA extracted from wild-type Col-0 and homozygous sae1a-1 plants. RNA gel-blot with a beta-TUB4 probe was used to confirm equal RNA loading. D, Immunoblot detection of the SAE1 protein. Protein extracts from 7-d-old wild-type Col-0 and homozygous sae1a-1 plants were separated by SDS-PAGE and subjected to immunoblot analysis with affinity-purified anti-SAE1a antibodies. The anti-PBA1 antibody blot was included to confirm equal protein loading. E, Affinity-purified SAE1a antibodies preferentially recognize recombinant SAE1a protein. The indicated amount of recombinant SAE1a and SAE1b were separated by SDS-PAGE and either subjected to immunoblot analysis with anti-SAE1a antibodies (top) or silver-stained for protein (bottom).

 

Figure 3
View larger version (29K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Genetic analysis of the single genes encoding the SAE2 subunit of the SUMO-activating enzyme and the SUMO-conjugating enzyme SCE1. A, Gene diagram of SAE2 and SCE1. Exons and introns are represented by boxes (black, coding region; white, UTR) and lines, respectively. Number of amino acids in each protein is indicated on the right. Insertion positions of the various T-DNA mutants are shown; insertions that result in null alleles are depicted in red, whereas insertions that produce viable homozygous plants are in green. Positions of the active-site Cys (C) are marked with arrowheads. B and C, Exon insertion mutants of SAE2 and SCE1 are embryonic lethal. B, Immature siliques from self-fertilized wild-type Col-0, SAE2/sae2-1, SCE1/sce1-5, and SCE1/sce1-6 plants. White and shriveled brown seeds have undergone developmental arrest. C, Microscopic examination of embryos from green seeds that presumably contain at least one wild-type allele of SAE2 or SCE1 and white/brown seeds that are presumably homozygous for the sae2-1 or sce1-5 mutations from the same heterozygous sae2-1 or sce1-5 silique. Predicted genotypes are indicated. D, RNA gel-blot analysis with a SCE1 probe of total RNA extracted from wild-type Col-0 and homozygous sce1-4 and sce1-7 plants. RNA gel-blot with a beta-TUB4 probe was used to confirm equal RNA loading. E, Homozygous sce1-4 and sce1-7 seedlings have reduced levels of SCE1 proteins and accumulate less SUMO conjugates during heat stress. Seven-day-old liquid-grown wild-type Col-0, sce1-4, and sce1-7 plants were either kept at 24°C or subjected to 30-min heat shock at 37°C and returned to 24°C to recover for 30 min. Total protein extracts were separated by SDS-PAGE and subjected to immunoblot analysis with anti-SUMO1, SCE1a, and PBA1 antibodies. SUMO conjugates are indicated by the bracket.

 
For the SAE1a locus, two T-DNA insertion lines were found. The sae1a-1 allele (Salk_060834) contains a T-DNA within the penultimate exon, 233 bp upstream from the stop codon, which when inserted caused a 7-bp deletion of exonic sequence surrounding the insertion site that might shift the reading frame (bp 2,089–2,095 downstream of the translation start site; Fig. 2A). RT-PCR of RNA isolated from homozygous sae1a-1 seedlings failed to amplify the full-length SAE1a mRNA, but detected partial transcripts both upstream and downstream of the insertion site (Fig. 2B). The potential absence of full-length mRNA was supported by gel-blot analysis of total RNA using a SAE1a coding region probe (Fig. 2C). Only a faint signal was evident at the migration position of the SAE1a mRNA, which likely represents weak cross-hybridization with the SAE1b mRNA. Similarly, the amount of SAE1 protein was dramatically reduced in the sae1a-1 background based on immunoblot analysis with affinity-purified anti-SAE1a antibodies. These antibodies recognize recombinant SAE1a approximately 5 times better than its paralog SAE1b (Fig. 2E). Whereas an approximately 40-kD SAE1 protein was easily detected in wild-type seedlings, only a small amount of a slightly lower molecular mass species was detected in homozygous sae1a-1 seedlings, which is either a truncated form of SAE1a potentially missing the C-terminal end, the remaining SAE1b isoform, or a cross-reacting protein (Fig. 2D). Taken together, it appears that the sae1a-1 mutant represents a strong, if not null, allele.

Homozygous sae1a-1 plants displayed no abnormal phenotypes when grown under standard growth conditions, suggesting that the SAE1a gene is not essential by itself and likely functionally redundant with SAE1b (data not shown). A sae1a-2 allele (Salk_001140) was also found that contains a T-DNA inserted 40 bp upstream of the predicted transcription start site and 190 bp upstream of the translation start site. Given the lack of phenotypic effects for the sae1a-1 allele and the predicted weaker consequences for the sae1a-2 allele, based on the greater distance of the T-DNA from the coding region, we did not characterize this mutant further.

Several T-DNA insertion mutants were identified within or near SAE2. The most useful allele, sae2-1 (Salk_053023), contains a T-DNA within the fourth intron and is missing 31 bp of genomic sequence flanking the left-border and right-border junctions (bp 1,186–1,217 downstream of the translation start site; Fig. 3A). The insertion is upstream of the codon for the active-site Cys (Cys-168). Whereas truncated mRNAs produced by the native promoter upstream of the T-DNA should encode inactive polypeptides, transcripts produced downstream of the insertion site could generate truncated, but active, enzymes. Two other T-DNA mutants were found within the 3'-untranslated region (UTR). For the sae2-2 (Salk_020830) and sae2-3 (Salk_020005) alleles, the left border of the T-DNA sequence is positioned 33 and 44 bp downstream of the translation stop codon, respectively. We obtained viable homozygous sae2-2 and sae2-3 plants, suggesting that these alleles do not dramatically reduce SAE2 expression (data not shown).

Despite being the smallest gene target of the group, a number of T-DNA insertion mutants were available for the SCE1 locus. Three mutants contained a T-DNA upstream of the 5'-UTR, which starts 68 bp from the translation start site (Fig. 3A). The sce1-3 (Salk_058401), sce1-4 (Salk_006164), and sce1-7 (Salk_022200) alleles have T-DNA left-border sequences located 230, 87, and 92 bp upstream of the SCE1 initiation codon, respectively. Two additional lines, sce1-5 and sce1-6, have T-DNA insertions within the coding sequence very close to the translation start site (58 and 43 bp downstream of the initiation codon) and upstream of the codon for the active-site Cys (Cys-94) and thus should represent strong mutant alleles.

Phenotypic analysis of strong alleles affecting SAE2 (sae2-1) and SCE1 (sce1-5 and sce1-6) revealed that the SUMO conjugation pathway is essential in Arabidopsis. Both classes of mutants could be easily transferred through the pollen or egg when the alleles were out-crossed to wild-type Col-0, indicating that male and female gametogenesis proceeds normally. However, when heterozygous lines of each were self-fertilized, we could not recover homozygous progeny as determined by genomic PCR (data not shown). Examination of the developing siliques identified a large percentage of seeds that failed to develop normally and became brown and shriveled, in addition to the plump green seeds characteristic of those from self-fertilized wild-type siliques (Fig. 3B). Approximately 23% of the seeds from the heterozygous sae2-1, sce1-5, and sce1-6 plants showed this aborted phenotype, strongly suggesting that seeds homozygous for the mutant loci underwent embryo arrest following fertilization (Table I ). To determine the stage of embryo arrest, we collected immature white and green seeds from the defective siliques and examined the embryos by differential contrast microscopy following clearing of the seeds with Hoyer's solution (Gingerich et al., 2005Go). Whereas the various stages of embryo development (globular, heart, torpedo, walking stick; Przemeck et al., 1996Go) could be easily identified in the green seeds, only early-stage embryos (globular, heart, early torpedo) were detected in the white/shriveled brown seeds, suggesting that homozygous sae1-1, sce1-5, and sce1-6 seeds arrest early in development, but not at a defined stage (Fig. 3C).


View this table:
[in this window]
[in a new window]

 
Table I. SUMO conjugation mutants inhibit seed developmenta

 
Phenotypically normal homozygous plants were obtained from selfed heterozygous sce1-3, sce1-4, and sce1-7 seedlings, indicating that these upstream T-DNA insertion mutants did not inactivate the SCE1 gene (see Fig. 6; data not shown). However, the sce1-4 and sec1-7 mutants depressed accumulation of the SCE1 transcript and corresponding protein. As shown in Figure 3D, gel-blot analysis of total RNA collected from liquid-grown seedlings revealed a substantial decrease in SCE1 mRNA as compared to that in wild-type Col-0 seedlings. A reduced amount of SCE1 protein was also evident by immunoblot analysis with anti-SCE1 antibodies; the homozygous sce1-4 and sce1-7 backgrounds had approximately one-fourth the amount of SCE1 protein as wild type (Fig. 3E).


Figure 6
View larger version (90K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. siz1 mutants show dramatic growth defects at maturity. Plants with the indicated genotypes were grown under SD for 10 weeks (top) or under LD for 8 weeks (bottom).

 
This reduced amount of the SUMO E2 in homozygous sce1-4 and sce1-7 plants also dampened the conjugation of SUMO1/2 to other proteins. Our prior work showed that heat shock (37°C) of young liquid-grown Arabidopsis seedlings rapidly and substantially elevates the amount of SUMO conjugates with a concomitant reduction in the amount of free SUMO (Kurepa et al., 2003Go; Fig. 3E). This accumulation of SUMO conjugates and simultaneous drop in the free SUMO pool following a 30-min heat shock at 37°C was noticeably reduced in both the sce1-4 and sce1-7 lines (Fig. 3E). Despite this effect on SUMO conjugation, we failed to observe any increase in thermal sensitivity for homozygous sce1-4 and sce1-7 plants, suggesting that these knockdown plants retained sufficient SUMOylation activity for stress protection (data not shown).


Genetic Analysis of SUMO1 and SUMO2

The embryonic lethality of E1 and E2 mutants implied that conjugation of one or more SUMO isoforms is essential for Arabidopsis development. To help identify which of the four expressed SUMO variants is responsible (SUMO1, SUMO2, SUMO3, and SUMO5), we attempted to collect T-DNA mutants affecting each paralog. At the time of this study, neither the SIGNAL (Alonso et al., 2003Go), Syngenta Arabidopsis Insertion Library (SAIL; Sessions et al., 2002Go), nor Wisconsin (Krysan et al., 1999Go; Woody et al., 2007Go) collections had potential T-DNA mutants affecting SUM5. A number of insertions located within or near the transcribed region of SUM3 were listed on the T-DNA express Web site (http://signal.Salk.edu/cgi-bin/tdnaexpress), but none yielded useful alleles. The most promising was a SIGNAL line (sum3-1; Salk_123673) that contains an insertion 26 bp downstream of the SUM3 stop codon; a full-length mRNA was still detected by RT-PCR in homozygous sum3-1 plants, suggesting that this mutation has little, if any, affect on transcription (data not shown).

Fortunately, useful T-DNA lines were identified that disrupt the closely related and best-expressed SUM1 and SUM2 pair (Fig. 4A ). The sum1-1 allele (296_C12) was found in the SAIL collection; it contains a T-DNA sequence and a 34-bp deletion of genomic sequence within the second intron of SUM1, with its right border placed 822 bp downstream of the ATG start codon. The sum2-1 allele (SALK_129775) was found in the SIGNAL collection; it harbors a T-DNA within the third exon 958 bp downstream of the translation start site. RT-PCR failed to detect the corresponding full-length mRNAs in the appropriate single-homozygous sum1-1 and sum2-1 plants, strongly suggesting that the mutants represent null alleles of each locus (Fig. 4B).


Figure 4
View larger version (58K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. SUMO1 and SUMO2 are essential in Arabidopsis. A, Gene diagram of the SUM1 and SUM2 genes and location of the T-DNA insertions (arrowheads) in sum1-1 and sum2-1. Exons and introns are represented by boxes (black, coding region; white, UTR) and lines, respectively. Number of amino acids in each protein is indicated on the right. Arrows show the positions of the RT-PCR primers used in B. B, RT-PCR analysis of wild-type Col-0 and homozygous sum1-1 and sum2-1 seedlings. RNA was subjected to first-strand cDNA synthesis with primers specific to either the 3'-UTR of SUM1 or SUM2 and then to PCR using the indicated gene-specific primers. RT-PCR of the PAE2 mRNA and genomic PCR of the SUM1 and SUM2 loci were included as controls. C, Double-homozygous sum1-1 sum2-1 plants are embryonic lethal. Shown are immature siliques from self-fertilized homozygous sum1-1 and sum2-1 plants and a self-fertilized plant that was heterozygous for sum1-1 and homozygous for sum2-1. White and shriveled brown seeds have undergone developmental arrest. D, Microscopic examination of embryos from green seeds that presumably contain at least one wild-type allele of SUM1 and white/brown seeds that are presumably homozygous for the sum1-1 from the same silique from a SUM1 sum1-1 sum2-1 sum2-1 plant. Predicted genotypes are indicated.

 
Unlike strong mutants of SAE2 and SCE1 (Fig. 3, B and C), we could easily generate single-homozygous progeny from selfed heterozygous sum1-1 or sum2-1 plants. The homozygous plants were phenotypically normal and highly fertile, with siliques full of healthy green seeds, indicating that neither SUMO1 nor SUMO2 is essential by itself (Fig. 4, C and D; Table I; data not shown). Given the likelihood that SUM1 and SUM2 are functionally redundant genes, we attempted to create the double-homozygous mutant by initially crossing a sum1-1/sum1-1 plant to a sum2-1/sum2-1 mutant to generate double-heterozygous individuals and then identifying double-homozygous progeny following self-fertilization. We failed to find any double-homozygous plants by PCR genotyping 58 progeny, suggesting that the double homozygote is nonviable. This dihybrid cross did generate both SUM1/sum1-1 sum2-1/sum2-1 and sum1-1/sum1-1 SUM2/sum2-1 homozygous/heterozygous plants that were fertile. Again, when 24 progeny from each of these selfed parents were screened, no double-homozygous plants were found.

Inspection of the siliques from the selfed SUM1/sum1-1 sum2-1/sum2-1 and sum1-1/sum1-1 SUM2/sum2-1 plants detected a large percentage of white and shriveled brown seeds indicative of embryos that aborted development following fertilization (Fig. 4C; Table I). We then determined the stage of embryo arrest by differential contrast microscopy of both green and white embryos. Like the sae2-1, sce1-5, and sce1-6 mutants analyzed in Figure 3, embryos arrested at various early stages of development were detected in the white/brown and presumed double-homozygous sum1-1/sum1-1 sum2-1/sum2-1 seeds. In some defective seeds, possible embryo reabsorption was evident, suggesting problems very early in embryogenesis (Fig. 4D; data not shown). In contrast, approximately 75% of the remaining embryos from the selfed SUM1/sum1 sum2/sum2 parent and 80% of the remaining embryos from the selfed sum1/sum1 SUM2/sum2 parent were green and appeared to develop normally (Table I), demonstrating that Arabidopsis embryogenesis can often proceed normally if at least one wild-type copy of SUM1 or SUM2 is present. Likewise, the homozygous/heterozygous and heterozygous/homozygous plants grew normally from these seeds under standard growth conditions (see Fig. 6).


Heat Stress Induces Accumulation of SUMO1 and SUMO2 Conjugates

Prior studies implicated SUMO1 and SUMO2 in the stress-induced rapid accumulation of SUMO conjugates in Arabidopsis. Key observations included the facts that these conjugates can be detected with anti-SUMO1 antibodies that preferentially recognize SUMO1 and SUMO2, but not their next closest paralog, SUMO3, and could be artificially increased by overexpression of SUMO2 (Kurepa et al., 2003Go). To further confirm the involvement of SUMO1 and SUMO2, we analyzed the heat-induced accumulation of SUMOylated proteins in single-homozygous sum1-1 and sum2-1 populations and in plants that are heterozygous for sum1-1 and homozygous for sum2-1. The SUM1/sum1-1 sum2-1/sum2-1 seedlings were first identified by BASTA resistance associated with the sum1-1 T-DNA in a segregating population obtained from a heterozygous/homozygous parent; resistant plants were then transferred to BASTA-free medium to recover before application of the heat stress. (Similar analysis of sum1-1/sum1-2 SUM2/sum2-1 plants was not performed given the lack of kanamycin resistance associated with the sum1-1 T-DNA, which in turn precluded our ability to easily detect such individuals in segregating populations.)

When wild-type Col-0 seedlings were exposed to a 30-min heat shock at 37°C followed by recovery at 24°C, they rapidly accumulated SUMOylated proteins and consumed the pool of free SUMO (Fig. 5 ; Kurepa et al., 2003Go). Conjugate abundance peaked between 30 and 60 min, followed by a steady decline over approximately 4 h back to the levels existing before the heat stress. Consistent with the inactivation of either the SUM1 or SUM2 genes, the single-homozygous sum1-1 and sum2-1 seedlings had both less free SUMO and accumulated fewer SUMO conjugates upon heat shock (Fig. 5). The decrease was particularly striking for the sum1-1 mutant, which could reflect a slight preferential reaction of this SUMO isoform with the anti-SUMO1 antibody or suggests that the SUM1 gene provides the majority of the free SUMO involved in this thermal response. A further reduction in SUMO conjugates was evident in the SUM1/sum1-1 sum2-1/sum2-1 seedlings (Fig. 5). This reduction was mirrored by near-complete depletion in the free SUMO pool at the end of the 30-min heat shock, suggesting that the amount of SUMO became limiting when these heterozygous/homozygous plants were stressed. However, some SUMO conjugation remained in these SUM1/sum1-1 sum2-1/sum2-1 seedlings. A likely source for the free SUMO was the wild-type allele of SUM1, but contributions from SUM5 could not be discounted.


Figure 5
View larger version (47K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Heat shock-induced accumulation of SUMO conjugates in various mutant combinations affecting SUM1 and SUM2. Seedlings were grown in liquid medium, subjected to 37°C heat shock for 30 min, and then returned to 24°C to recover. Seedlings collected at the indicated times were homogenized directly in SDS-PAGE sample buffer and the extracts were separated via SDS-PAGE and subjected to immunoblot analysis with anti-SUMO1 antibodies. An overexposure of the SUMO conjugate blot was included to better show the levels of free SUMO. The anti-PBA1 antibody blot was included to confirm equal protein loading. SUMO conjugates are indicated by the bracket.

 

SIZ1 Participates in Heat-Induced SUMOylation of SUMO1 and SUMO2

Whereas it is expected that multiple SUMO E3s exist in plants, to date only the SIZ1 E3 has been described (Kurepa et al., 2003Go; Miura et al., 2005Go). Previous studies revealed that siz1 mutants accumulate less conjugates as detected with anti-SUMO1 antibodies, suggesting that the corresponding E3 is active with both SUMO1 and SUMO2 (Miura et al., 2005Go). A number of highly specific defects have been reported for strong siz1 alleles, including hypersensitivity to phosphate starvation, reduced thermal and freezing tolerance, and increased SA-mediated pathogen resistance (Miura et al., 2005Go, 2007Go; Yoo et al., 2006Go). However, unlike SUM1 SUM2 double mutants and SAE2 and SCE1 single mutants, plants lacking SIZ1 are viable. As previously reported (Miura et al., 2005Go), plants homozygous for the null siz1-2 allele were noticeably smaller than wild type within the first several weeks of seedling growth (data not shown). However, beyond the seedling stage, the siz1-2 plants became substantially compromised, indicating that loss of SIZ1 affects a wider range of growth and developmental processes than previously appreciated (Fig. 6 ). When grown to maturity in a long-day (LD) photoperiod (16 h light/8 h dark), homozygous siz1-2 seedlings were substantially dwarfed. Their shoot development was even more perturbed in a short-day (SD) photoperiod (8 h light/16 h dark), and basically grew as a small clump of disorganized irregular leaves with very short petioles and little or no organized phylotaxy. Surprisingly, siz1-2 plants produced an inflorescence in both LD and SD at approximately the same time as wild-type Col-0, but fewer flowers were generated and their fecundity was substantially depressed (Fig. 6; data not shown).

To confirm that SIZ1 ligates SUMO1/2, we compared the heat-induced accumulation of SUMO conjugates in young siz1-2 seedlings to those in wild-type Col-0, single-homozygous sum1-1 and sum2-1, and the heterozygous/homozygous SUM1/sum1-1 sum2-1/sum2-1 seedlings. The kinetics for heat-induced SUMOylation in the siz1-2 seedlings was indistinguishable to wild-type Col-0, but the siz1-2 plants accumulated much less conjugates and failed to appreciably consume the free SUMO pool at the peak of the response (Fig. 7A ). Compared to the homozygous sum1-1 and sum2-1 and heterozygous/homozygous sum1-1 sum2-1 backgrounds, siz1-2 seedlings also showed a severely dampened heat stress response (Fig. 7B). However, small amounts of SUMO conjugates did accumulate in siz1-2 seedlings between 30 and 60 min after the start of the heat stress, suggesting that other SUMO E3s participate and/or that this stress-induced accumulation can occur to a limited degree in an E3-independent manner.


Figure 7
View larger version (39K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. The SIZ1 SUMO protein ligase is required for heat shock-induced conjugation of SUMO1/2. Plants of the indicated genotypes were grown for 7 d on solid medium, then transferred to liquid culture for 4 d and subjected to 37°C heat shock for 30 min, and then returned to 24°C to recover. Seedlings collected at the indicated times were homogenized directly in SDS-PAGE sample buffer and the extracts were subjected to immunoblot analysis with anti-SUMO1, SAE1a, and SCE1 antibodies. Anti-PBA1 blot was used to confirm equal protein loading. SUMO conjugates are indicated by the bracket. A, Kinetics of SUMO conjugate accumulation following 37°C heat shock. B, Direct comparison of SUMO conjugate levels. Seedlings were either kept at 24°C or subjected to 30-min heat shock at 37°C and returned to 24°C to recover for 30 min.

 
In addition to dampened SUMO conjugation, we also detected increases in the levels of free SUMO and the E2 SCE1 in siz1-2 seedlings both before and after heat shock (Fig. 7B). We presume that part of the increase in free SUMO in the mutant background reflected a failure to incorporate the tag into conjugates in the absence of SIZ1. In contrast, the marked increase in SCE1 levels suggests that the siz1-2 plants attempted to overcome this block in conjugation by elevating E2 abundance. However, this block did not universally up-regulate the entire SUMOylation cascade because no increase in the SAE1 E1 level was evident in siz1-2 plants. Similar increases in SCE1 abundance were not apparent in the single-homozygous sum1-1 or sum1-2 plants or in the SUM1/sum1-1 sum2-1/sum2-1 plants, suggesting that this up-regulation is not activated by milder constraints on SUMOylation.


Complementation of the sum1-1 sum2-1 Mutant with SUM1

To confirm that SUMO1 and SUMO2 are together essential in Arabidopsis, we attempted to rescue the embryo lethality of the double-homozygous sum1-1 sum2-1 plants by complementation with an Arabidopsis SUM1 transgene (SUM1-T). SUM1-T was introduced into the SUM1/sum1-1 sum2-1/sum2-1 background; heterozygous/homozygous individuals containing the transgene were first selected by kanamycin resistance linked to SUM1-T and then for the sum1-1 allele by genomic PCR (Fig. 8B ). Double-homozygous progeny harboring the transgene were then identified by PCR with an array of gene-specific primers (Fig. 8, A and B). First attempts to complement the mutant using a SUM1 coding region expressed under the direction of the cauliflower mosaic virus 35S promoter failed (data not shown). Because the 35S promoter is purported to work poorly in embryos (Sunilkumar et al., 2002Go), we suspected that insufficient SUMO1 was expressed early in embryogenesis to rescue the double-homozygous mutants. In a subsequent attempt, we used a genomic fragment of SUM1 that included a sequence 1 kb upstream of the start codon through 280 bp downstream of the stop codon of the SUM1 locus, which would presumably express SUMO1 from its native promoter (Fig. 8A). By using this native promoter construction, sum1-1/sum1-1 sum2-1/sum2-1 SUM1-T plants were readily generated that were fully fertile (Fig. 8B; data not shown). The presence of SUM1-T also restored the level of SUMO conjugates formed during heat shock to that seen in wild type, indicating that the SUM1-T locus directed the synthesis of the functional SUMO1 protein (Fig. 8C).


Figure 8
View larger version (22K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 8. Complementation of the sum1/sum1 sum2/sum2 mutant with SUM1. A, Diagrams of SUM1 and SUM2 loci and the SUM1 transgene (SUM1-T) used for complementation. Dashed black lines represent UTRs, gray boxes represent promoter regions, white boxes indicate genomic regions, solid lines represent introns, and black boxes represent exons. Hatched boxes represent vector DNA. T-DNA insertions are marked by triangles. Numbered arrows show the positions of primers used for PCR genotyping in B. B, Genomic PCR of wild-type Col-0, and heterozygous and homozygous sum1-1 sum2-1 plants with and without SUM1-T. C, Heat shock-induced accumulation of SUMO conjugates in the double-homozygous sum1-1 sum2-1 plants harboring SUM1-T as compared to wild-type Col-0 and sum1-1 SUM1 sum2-1 sum2-1 plants. Seedlings were either kept at 24°C or subjected to 30-min heat shock at 37°C and returned to 24°C to recover for 30 min.

 

Heat Shock-Induced SUMO Conjugates Accumulate in the Nucleus

Previous studies showed that both SUMOs and the SCE1 E2 are nuclear enriched in Arabidopsis, suggesting that many SUMOylation targets in plants reside in this compartment (Kurepa et al., 2003Go; Lois et al., 2003Go). Given the dramatic increase in SUMO conjugates during stress, their possible concentration in the nucleus could in turn indicate that stress-induced SUMOylation affects one or more nuclear processes as seen for other eukaryotes (e.g. transcription and DNA repair [Hong et al., 2001Go; Hoege et al., 2002Go; Huang et al., 2003Go; Sramko et al., 2006Go]). To help support this hypothesis, we attempted to localize the pool of heat shock-induced SUMOylated proteins in Arabidopsis. Seedlings were homogenized either before or after 30-min heat stress at 37°C and then the crude extracts were separated into cytosol- and nuclear-enriched fractions by Percoll gradient centrifugation. The Cys-reactive agent iodoacetamide was included in the extraction and gradient buffers to minimize loss of SUMO conjugates by deSUMOylating enzymes (Kim et al., 2000Go). Equivalent amounts of total protein were then subjected to immunoblot analysis with anti-SUMO1 antibodies, as well as to antibodies recognizing a soluble cytoplasmic protein PUX1 (Rancour et al., 2004Go), the chloroplast marker Rubisco large subunit, and the nuclear protein histone H3.

As can be seen in Figure 9 , the protocol successfully enriched for nuclei (as judged by histone H3 levels) with little cytoplasmic and organellar contamination. When analyzed similarly with anti-SUMO1 antibodies, we found that most of the SUMO conjugates were in the nucleus in nonstressed plants, with little detected in the cytoplasmic fraction (Fig. 9). Similar strong nuclear enrichment was evident in heat-shocked plants despite the dramatic increase in SUMO conjugates (Fig. 9), suggesting that most, if not all, of the stress-induced targets are also in this compartment or reside in the nucleus after SUMOylation. In contrast, the free SUMO pool was present in the cytoplasmic fraction. This could indicate that much of the free SUMO is cytoplasmic or, more likely, that SUMO diffused out of the nuclei during fractionation because of its small size or rupture of the nuclear envelope. The total and cytosolic fraction from heat-shocked tissue also contained immunoreactive species at approximately 36 and 50 kD (Fig. 9). Intriguingly, these species could reflect dimeric and trimeric variants of free SUMO, suggesting that SUMO can be assembled into polymeric chains.


Figure 9
View larger version (48K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 9. Heat-induced SUMO conjugates are nuclear localized. Seven-day-old liquid-grown Col-0 seedlings were either kept at 24°C or heat shocked at 37°C for 30 min. Nuclei (N) were purified away from cytosol (S) by Percoll gradient centrifugation of total extracts (T) and the resulting samples were subjected to SDS-PAGE and immunoblot analysis with anti-SUMO1, histone-3 (H3), PUX1, or Rubisco large subunit antibodies. The asterisks identify potential dimeric and trimeric chains of free SUMO of 36 and 50 kD in the heat-shocked samples. Thirty-three micrograms of protein were loaded into each of the T and S lanes and 12 µg were loaded into each of the N lanes.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Previous genomic analysis revealed that Arabidopsis contains a complex SUMO conjugation system with multiple SUMO isoforms, at least two types of E1s distinguished by the incorporation of the SAE1a and SAE1b isoforms into the SAE1/SAE2 heterodimer, and numerous deSUMOylating enzymes (Kurepa et al., 2003Go; Lois et al., 2003Go; Murtas et al., 2003Go; Chosed et al., 2006Go; Colby et al., 2006Go). Some of the resulting SUMOylated proteins, in turn, play important roles in floral initiation, ABA signaling, and the plant response to various stresses, including heat and cold shock, phosphate deficiency, and pathogen resistance (Kurepa et al., 2003Go; Lois et al., 2003Go; Murtas et al., 2003Go; Miura et al., 2005Go, 2007Go; Yoo et al., 2006Go). Here, we present the first full-scale genetic analysis of the system in Arabidopsis and demonstrate that SUMOylation is essential in plants. Similar to prior observations in yeast (Meluh and Koshland, 1995Go; Seufert et al., 1995Go; Johnson and Blobel, 1997Go; Johnson et al., 1997Go; Giaever et al., 2002Go), double mutants blocking accumulation of the main SUMOs, SUMO1 and SUMO2, and mutants affecting the single genes encoding the E1 subunit SAE2 and the E2 SCE1 are nonviable. Whereas the mutants appear to undergo male and female gametogenesis normally, the fertilized zygotes abort at various stages in early embryogenesis. Given the importance of SUMOylation during the cell cycle of other eukaryotes (Melchior, 2000Go; Johnson, 2004Go; Hay, 2005Go), it is likely that embryogenesis is blocked in the Arabidopsis mutants by similar defects in cell division following zygote formation. The failure to arrest at a specific developmental stage could then reflect abortion of individual embryos only when the supply of one of these proteins falls below a critical threshold. However, both the near-ubiquitous expression patterns of SUMOs and the enzymes required for SUMO conjugation and the wide array of SUMO conjugates present in various tissues make it highly likely that SUMOylation plays important and pervasive roles throughout plant development and is not just restricted to embryogenesis.

Whereas eight potentially functional SUM genes exist in Arabidopsis, it appears that only four are actively transcribed—SUM1 to SUM3 and SUM5. Our genetic analysis of SUMO1 and SUMO2 indicates that these two isoforms together are essential. Whereas sum1-1 and sum2-1 single mutants are phenotypically normal, double-homozygous mutants are embryo lethal. Surprisingly, the sum1-1 sum2-1 homozygous/heterozygous and heterozygous/homozygous mutants are also normal, indicating that a single functional allele of SUM1 or SUM2 is sufficient to supply the free SUMO needed for viability and proper development.

During various stresses, like heat shock, a rapid and readily reversible accumulation of SUMO conjugates is evident that likely plays a role in stress protection (Kurepa et al., 2003Go; Yoo et al., 2006Go; Miura et al., 2007Go). This heat shock-induced accumulation is substantially abrogated in various combinations of sum1-1 and sum2-1 mutants, indicating that SUMO1 and SUMO2 are important contributors to this process. Whereas the double-homozygous plants are not viable, the heterozygous/homozygous and homozygous/heterozygous sum1-1 sum2-1 plants display normal thermal sensitivity (data not shown), indicating that the remaining pool of SUMO1 and SUMO2 conjugates is sufficient for heat protection. Like ubiquitination, it has been proposed that SUMOylation can assemble chains of SUMOs concatenated via internal Lys onto targets (Johnson and Gupta, 2001Go; Tatham et al., 2001Go; Bencsath et al., 2002Go). Our analysis of SUMO conjugates formed during heat shock (Fig. 9) suggests that similar chains might be formed in plants, thus potentially adding another layer of regulation to this protein modification system. Lys-10 of SUMO2, which is conserved in SUMO1, is required for SUMO chain formation in vitro (Colby et al., 2006Go).

In addition to SUMO1 and SUMO2, expression studies indicate that SUMO3 and SUMO5 also accumulate. At present, the functions of these two isoforms and their contributions to stress-induced SUMOylation are unknown. Prior analysis with SUMO3-specific antibodies did not find similar increases in SUMO3 conjugates upon stress (Kurepa et al., 2003Go). With respect to SUMO5, its expression at wild-type levels is clearly insufficient to maintain the viability of homozygous sum1-1 sum2-1 plants. Confirmation that SUMO5 cannot functionally replace SUMO1 and SUMO2 will ultimately require expression of SUMO5 under the control of the SUM1 and/or SUM2 promoters. Intriguingly, expression analyses show that SUMO3 and SUMO5 may preferentially accumulate in specific tissues/cells in Arabidopsis, suggesting that isoform-specific roles for these SUMOs are possible.

In Arabidopsis, the E1 heterodimer is assembled from two paralogous SAE1 polypeptides and a single SAE2 polypeptide. Whereas the SAE2 subunit harbors the active-site Cys, the SAE1 subunit also contributes a conserved Arg finger to the active site and is thus necessary for catalysis (Dye and Schulman, 2007Go). As predicted, SAE2 is essential with the loss-of-function mutant sae2-1 acting as an embryonic lethal. In contrast, a potentially null mutant affecting SAE1a is viable and displays no phenotypic abnormalities. Whereas we cannot rule out the possibility that small amounts of active SAE1a are generated from the sae1a-1 locus, the most likely explanation is that SAE1a is functionally redundant with SAE1b. These paralogs share 81% amino acid sequence identity and show strongly overlapping patterns of expression. Whether or not the SAE1a and SAE1b proteins also have isoform-specific functions (e.g. nuclear versus cytoplasmic) awaits strong mutants disrupting the activity of the SAE1b gene.

Prior studies in yeasts and metazoans have demonstrated that SCE1 E2 is essential for viability and proper development (Epps and Tanda, 1998Go; Hayashi et al., 2002Go; Jones et al., 2002Go; Nacerddine et al., 2005Go; Nowak and Hammerschmidt, 2006Go). Here, we show that the single functional SCE1 gene is also essential in Arabidopsis. However, sce1-4 and sce1-7 mutants with moderately reduced SCE1 levels (approximately 25% of that found in wild type) were phenotypically normal when grown in nonstressed conditions, suggesting that reduced levels of SCE1 can be tolerated. The only detected change was a decrease in the amounts of SUMO conjugates formed after heat shock. Lois et al. (2003)Go previously generated, by transgene-mediated cosuppression, Arabidopsis lines with even lower SCE1 levels than those found here for sce1-4 and sce1-7 plants. These cosuppressed plants were also phenotypically normal, but did display mild hypersensitivity to ABA, as determined by reduced root growth. The Arabidopsis genome has a second locus that could encode a truncated form of SCE1 (Kurepa et al., 2003Go). Our analysis of sce1 mutants lends further support to the possibility that this locus is a pseudogene or, at the very least, has a minor role in SUMOylation.

Previous reports have implicated SIZ1 as the predominant SUMO E3 in Arabidopsis and showed that siz1 mutants are hypersensitive to thermal and cold stress and display increased SA-mediated pathogen resistance (Miura et al., 2005Go, 2007Go; Yoo et al., 2006Go; Lee et al., 2007Go). In our hands, the siz1-2 null allele is severely compromised phenotypically, suggesting that a wide range of other processes are perturbed as well. These pleiotropic defects are especially evident in adult plants, which exhibit substantial dwarfing and developmental abnormalities of the shoot. Consequently, caution should be used when attributing the siz1 phenotype directly to a single process because numerous secondary effects likely exist as well. For example, the up-regulation of SA-mediated defense in siz1 mutants could reflect indirect activation of other defense pathways in the absence of SIZ1-mediated SUMOylation.

Whatever the underpinning mechanisms for the pleiotropic siz1 defects, it is clear that SIZ1 is involved in the conjugation of SUMO1 and SUMO2 and appears responsible for most of their heat shock-induced SUMOylation. Whereas SUMO1 and SUMO2 are essential in Arabidopsis, SIZ1 is not. Possible explanations include the involvement of other SUMO E3s or SUMOylation directly by SCE1 via an E3-independent mechanism. In support of the latter, in vitro SUMOylation assays showed that yeast SIZ1 enhances, but is not required, for protein conjugation, and that SCE1 can directly transfer SUMO to targets by itself (Desterro et al., 1999Go; Okuma et al., 1999Go; Johnson and Gupta, 2001Go; Sampson et al., 2001Go). Our observed increase in SCE1 protein levels in the siz1-2 background could reflect an attempt to augment this E3-independent SUMOylation in the absence of SIZ1.

Cell fractionation studies revealed that the vast majority of SUMO conjugates in Arabidopsis are concentrated in the nucleus, both before and after heat shock. Such enrichment is not surprising given the nuclear localization of SUMOylation enzymes in Arabidopsis and other eukaryotes (Johnson and Blobel, 1999Go; Huh et al., 2003Go; Lois et al., 2003Go) and the fact that most SUMOylation substrates in yeast are nuclear proteins (Panse et al., 2004Go; Wohlschlegel et al., 2004Go; Zhou et al., 2004Go; Hannich et al., 2005Go). Why is an array of nuclear proteins SUMOylated during stresses like heat shock? Given the ability of SUMO addition to either enhance or depress the activity of various transcription factors (Hay, 2005Go), one possibility is that SUMOylation provides a rapid and reversible mechanism to alter the transcriptional profile of stressed cells. SUMO addition could have a direct effect by altering transcription factor activity or could have an indirect effect by enhancing protein stability via its ability to protect individual targets from ubiquitination and subsequent breakdown by the 26S proteasome. Based on the role of SUMO in nuclear import, it is also possible that these SUMO conjugates represent cytoplasmic factors that are rapidly shuttled to the nucleus after SUMOylation, as seen with RanGAP (Mahajan et al., 1998Go; Matunis et al., 1998Go). By any or all of these scenarios, the expression of genes involved in stress amelioration (e.g. heat shock proteins) could be globally increased, whereas those involved in general metabolism and cell division could be globally decreased to help shift the plant from a growth to a protective mode. A failure to balance such modes may explain the catastrophic consequences of SUMOylation mutants affecting SUMO1, SUMO2, SAE2, and SCE1 and the severe development defects associated with SIZ1 mutants. Such a role for SUMO conjugation in general stress protection may also explain the exploitation of deSUMOylating enzymes like XopD and AvrXv4 by plant pathogens as they attempt to circumvent this protective response to better colonize the host (Hotson et al., 2003Go; Roden et al., 2004Go; Chosed et al., 2007Go).

Clearly, identification of the array of proteins modified by SUMOylation both before and after stress is now critical to define how SUMO regulates plant development and the stress response. To date, only one SUMO target has been proposed in plants, that being ICE1, a key transcriptional regulator of freezing tolerance (Miura et al., 2007Go). The ICE1 protein can be SUMOylated when introduced into Arabidopsis protoplasts, but its confirmation as a bona fide SUMO target awaits analysis of the native protein. The library of SUMOylation mutants described here now should facilitate these identifications at several levels. By complementing the various E1, E2, and SUMO mutants with enzymatically impaired forms, genetic analyses to confirm the SUMOylation of specific targets may be possible. And like similar approaches successfully used in yeast (Panse et al., 2004Go; Vertegaal et al., 2004Go; Wohlschlegel et al., 2004Go; Zhao et al., 2004Go; Zhou et al., 2004Go; Hannich et al., 2005Go), the rescue of SUMO mutants with tagged, functional versions should greatly facilitate both the purification of native SUMO conjugates directly from Arabidopsis and their subsequent identification by various mass spectrometry approaches.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material and Genotypic Analysis

Arabidopsis (Arabidopsis thaliana) ecotype Col-0 T-DNA insertion mutants sum2-1 (Salk_129775), sum3-1 (Salk_123673), sae1a-1 (Salk_060834), sae1a-2 (Salk_001140), sae2-1 (Salk_053023), sae2-2 (Salk_020830), sae2-3 (Salk_020005), sce1-3 (Salk_058401), sce1-4 (Salk_006164), sce1-5 (Salk_138741), sce1-6 (Salk_071596), and sce1-7 (Salk_022200) were identified in the SIGNAL collection (Alonso et al., 2003Go) and obtained from the Arabidopsis Biological Resource Center (ABRC). The sce1-2 (SAIL_693_H01) and sum1-1 (SAIL_296_C12) T-DNA insertion mutant lines were identified in the SAIL T-DNA collection (Sessions et al., 2002Go) and obtained from Syngenta Biotechnology. The genotypes of the mutants were tracked by PCR of genomic DNA with 5'- and 3'-gene-specific primers together or in combination with T-DNA-specific left-border primers Lba1 (Alonso et al., 2003Go) and LB1 (Sessions et al., 2002Go) for the SALK and SAIL lines, respectively. Gene-specific primers were SUM1 (5'-AAGCCCATTATAACGAAACGACAG) and SUM1 (3'-TAGGATCCGATACCAAACGAACAA), SUM2 (5'-GGTAGGCATTTTTCGTTGTTGGT), and SUM2 (3'-GTATACGGCCGAAGAAGAATCCT); SAE1a (5'-TCCCAAGGCAGATACATACAACA), SAE1a (3'-TTACCGAAGGAAAATCACAACTG), SAE2 (5'-TTGGGCAGTCTAAGGCTAAGGTAA), and SAE2 (3'-AAAATTCATCGGCACATCAAAAAC); and SCE1 (5'-GTTTCACGCCACATTTATCCATTG) and SCE1 3'-CCATCCTGCCCCGTCTCC). The siz1-2 mutant in the Col-0 background was as described (Miura et al., 2005Go). The sum1-2, sum2-1, sae2-1, and sae1a-1 alleles were backcrossed three times to wild-type Col-0 to help remove extraneous T-DNAs and/or mutations.


RT-PCR and RNA Gel-Blot Analysis

RNA isolation from 7-d-old liquid-grown seedlings using TRIzol reagent (Invitrogen) and RNA gel-blot analyses were performed essentially as described (Smalle et al., 2002Go). Total RNA (10 µg) was separated in 1% agarose-formaldehyde gels, transferred to Hybond-XL nitrocellulose membranes (GE Healthcare), and probed with [32P]dUTP-labeled riboprobes synthesized with the Riboprobe SP6 system (Promega). The SCE1 probe was created by PCR amplification of the SCE1 cDNA using primers 5'-CAGATCTAGAATGGCTAGTGGAATCGCTCG and 3'-GCTCTAGATTAGACAAGAGCAGGATACTGC; the resulting product was then inserted into the plasmid pGEM-T (Promega). Similarly, the SAE1a probe was made by amplifying the SAE1a cDNA with primers 5'-GGTTCATATGGACGGAGAAGAGCT and 3'-ACGCTCGAGTTAAGAGGTAAAAGA and ligating the PCR product into pGEM-T. The beta-TUB4 probe was described previously (Fu et al., 1998Go).

RT-PCR was performed with total RNA (1 µg) pretreated with RQ1 DNAse (Promega). First-strand cDNA synthesis followed the manufacturer's protocol (SuperScript II; Invitrogen) employing the gene-specific reverse primers for SAE1a (Fig. 2A) primer 5 (TACCGAAGGAAAATCACAACTGATCC) and primer 4 (TTTAGTTCGCATTCCACCATCTCT), for SUM1 (Fig. 4A; GATCCGATACCAAACGAACAAGAC), and for SUM2 (TGATTCACATAGACTTTCACCAGT) or those described by Downes et al. (2003)Go for PAE2. Two microliters of the cDNA reactions were subsequently used in PCR with appropriate transcript-specific primers. All RT-PCR products were confirmed as correct by dideoxy DNA sequence analysis. Primer sequences used for PCR were as follows: for SAE1a (Fig. 2A) primer 1, GACTGCCTTGTACGACCGCCAG; primer 2, TGGAAATCAAAAAGCAACTCT; primer 3, ACAGGAGGTGATCAAAGCAGT; primer 4, TTTAGTTCGCATTCCACCATCTCT; for SUM1 (Fig. 4A), 5'-GAAGACAAGAAGCCAGGAGACGG and 3'-GATCCGATACCAAACGAACAAGAC; and for SUM2, 5'-AGAAGACAAGAAGCCTGACCA and 3'-TGATTCACATAGACTTTCACCAGT).


sum1-1 sum2-1 Complementation

To rescue the sum1-1 sum2-1 mutant, a plasmid encompassing a genomic fragment of SUM1 (from 979 bp upstream of the translation start site to 279 bp downstream of the stop codon) was PCR amplified from wild-type (Col-0) Arabidopsis chromosomal DNA using the primers 5'-CACCGGTTATTCTCGAGTGTATCTTCAGAAACAG and 3'-CAATAATTAATAGCTTTTTACCGTTACCATACCAACAAAC. The SUM1 product was recombined into the pENTR/TEV/D-TOPO vector (Invitrogen), verified as correct via dideoxy DNA sequencing, and then transferred into the plant transformation vector pMDC100 (Curtis and Grossniklaus, 2003Go) using LR Clonase (Invitrogen). The resulting plasmid was introduced into Agrobacterium tumefaciens strain GV3101 and transformed into sum1-1/SUM1 sum2-1/sum2-1 plants by the floral-dip method (Clough and Bent, 1998Go). Transformants were selected on solid Gamborg B5 growth medium (GM; Sigma) containing 50 µg/mL kanamycin (Sigma) and screened by genomic PCR to identify SUM1/sum1-1 sum2-1/sum2-1 individuals. T2 plants homozygous for the sum1-1 mutation and containing SUM1-T were identified and tracked by PCR genotyping and resistance to glufosinate ammonium (BASTA; Crescent Chemical Co.), respectively, and confirmed by segregation analysis of the T3 generation. Primers used to confirm complementation (Fig. 8A) were primer 1 (GAGCTACGTATATGTTAAGAGTCACAC); primer 2 (GAGCTACGTATATGTTAAGAGTCACAC); primer 3 (TAGGATCCGATACCAAACGAACAA); primer 4 (Lb1; GCCTTTTCAGAAATGGATAAATAGCC); primer 5 (GGTAGGCATTTTTCGTTGTTGGT); primer 6 (GTATACGGCCGAAGAAGAATCCT); primer 7 (Lba1; TGGTTCACGTAGTGGGCCATCG); primer 8 (CAAGCTTGCATGCCTGCAGGTCG); and primer 9 (TAGACGTCCGTGAAAGGTTCTCCGTCC).


Phenotypic Analysis

For seed production, plants were grown in a LD photoperiod (16 h light/8 h dark) at 23°C. Analysis of embryonic arrest was performed on developing seeds dissected from immature siliques. The seeds were fixed and cleared with Hoyer's solution (Gingerich et al., 2005Go) and observed by differential interference contrast microscopy using a Leica DMLB2 microscope (Leica Microsystems). Heat shock experiments were carried out essentially as described (Kurepa et al., 2003Go). Wild-type, sce1-4, and sce1-7 seedlings were germinated and grown under continuous light (60 µmol m–2 s–1) at 24°C for 7 d in liquid GM before heat shock. For heat shock experiments containing sum1-1 alleles, plants were germinated for 7 d on solid GM (for Col-0, homozygous sum2-1, and homozygous siz1-2) or GM containing 25 µg/mL glufosinate ammonium (for the homozygous sum1-1 and the sum1-1 SUM1 sum2-1 sum2-1 individuals) to identify plants containing the sum1-1 allele. Plants were then transferred to liquid GM lacking glufosinate ammonium for four additional days before heat shock.

Arabidopsis nuclei were isolated from 7-d-old control or heat-shocked (30 min at 37°C) wild-type Col-0 plants by the Percoll gradient method as described (Folta and Kaufman, 2000Go), with the following modifications: 10 mM iodoacetamide and 2 mM phenylmethanesulfonyl fluoride (Sigma) was added to the extraction and gradient buffers, the PIPES (Sigma) concentration was reduced to 50 mM, and the homogenates were filtered through Miracloth (EMD Biosciences) instead of cheesecloth. Equal amounts of total protein (determined by Bradford Assay; Bio-Rad) from control and heat-shocked plants were subjected to SDS-PAGE (12% for SUMO1 and Rubisco blots and 13.5% for histone H3 and PUX1 blots) and immunoblot analysis after electrophoretic transfer to polyvinylidene difluoride membranes (Millipore).


Antibody Production and Immunoblot Analysis

Anti-SAE1a and anti-SCE1 antisera were generated in rabbits using recombinant proteins expressed from the full-length coding regions. cDNAs were amplified using primers designed to contain 5' and 3' flanking NdeI and XhoI sites and cloned into pET28b(+) (EMD Biosciences) plasmids that were similarly digested. Following a 3-h induction with 1 mM isopropyl 1-thio-beta-D-galactopyranoside in the Escherichia coli strain BL21(DE3), crude extracts were subjected to preparative SDS-PAGE, and the recombinant proteins were excised from the gel and injected directly into rabbits. Recombinant SAE1a and SAE1b proteins were purified with nickel nitrilotriacetic acid agarose under denaturing conditions following the manufacturer's protocol (Qiagen). SAE1a antibodies were affinity purified with recombinant SAE1a protein immobilized on polyvinylidene difluoride membranes. Antibodies against SUMO1, PBA1, and PUX1 were as described (Smalle et al., 2002Go; Kurepa et al., 2003Go; Rancour et al., 2004Go). Anti-histone H3 antibodies (product no. ab1791) were purchased from Abcam. Antibodies against the large subunit of spinach (Spinacia oleracea) Rubisco were from Dr. Archie Portis. Goat anti-rabbit secondary immunoglobulins conjugated to alkaline phosphatase (for PBA1) or horseradish peroxidase (remainder of antibodies) were obtained from Kirkegaard and Perry Laboratories. Seedlings were frozen in liquid nitrogen and homogenized directly in SDS-PAGE sample buffer. Extracts were rapidly heated, clarified at 14,000g, and supernatants were used directly for SDS-PAGE and immunoblot analysis.


Note Added in Proof

The embryo lethality of the sae2-1, sce1-5, and sce1-6 mutants agrees with prior analysis of independent alleles for SAE2 and SCE1 presented in the SeedGenes database (http://www.seedgenes.org/; Tzafrir I, Dickerman A, Brazhnik O, Nguyen Q, McElver J, Frye C, Patton D, Meinke D [2003] The Arabidopsis SeedGenes Project. Nucleic Acids Res 31: 90–93).


    ACKNOWLEDGMENTS
 
We thank Benjamin Harrison and Dr. Patrick Masson for help with microscopy; Dr. Ray Bressan for the siz1-2 mutant; Drs. David Rancour and Sebastian Bednarek and Dr. Archie Portis for anti-PUX1 and Rubisco antibodies, respectively; and Reza Ahmadi, Neal Englert, and Robert Schmitz for technical assistance.

Received May 11, 2007; accepted July 5, 2007; published July 20, 2007.


    FOOTNOTES
 
1 This work was supported by the National Science Foundation Arabidopsis 2010 Program (grant no. MCB–0115870 to R.D.V.) and a National Institutes of Health predoctoral training fellowship to the University of Wisconsin Genetics Training Program (to M.J.M.). Back

2 Present address: Department of Plant and Soil Sciences, University of Kentucky, KTRDC Room 104A, Cooper and University Drives, Lexington, KY 40546–0312. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Richard D. Vierstra (vierstra{at}wisc.edu).

[OA] Open Access articles can be viewed online without a subscription. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.107.102285

* Corresponding author; e-mail vierstra{at}wisc.edu.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657[Abstract/Free Full Text]

Andrews EA, Palecek J, Sergeant J, Taylor E, Lehmann AR, Watts FZ (2005) Nse2, a component of the Smc5-6 complex, is a SUMO ligase required for the response to DNA damage. Mol Cell Biol 25: 185–196[Abstract/Free Full Text]

Bencsath KP, Podgorski MS, Pagala VR, Slaughter CA, Schulman BA (2002) Identification of a multifunctional binding site on Ubc9p required for Smt3p conjugation. J Biol Chem 277: 47938–47945[Abstract/Free Full Text]

Bossis G, Melchior F (2006) SUMO: regulating the regulator. Cell Div 1: 13[CrossRef][Medline]

Chosed R, Mukherjee S, Lois LM, Orth K (2006) Evolution of a signalling system that incorporates both redundancy and diversity: Arabidopsis SUMOylation. Biochem J 398: 521–529[CrossRef][Web of Science][Medline]

Chosed R, Tomchick DR, Brautigam CA, Mukherjee S, Negi VS, Machius M, Orth K (2007) Structural analysis of Xanthomonas XopD provides insights into substrate specificity of ubiquitin-like protein proteases. J Biol Chem 282: 6773–6782[Abstract/Free Full Text]

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline]

Colby T, Matthai A, Boeckelmann A, Stuible HP (2006) SUMO-conjugating and SUMO-deconjugating enzymes from Arabidopsis. Plant Physiol 142: 318–332[Abstract/Free Full Text]

Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133: 462–469[Abstract/Free Full Text]

Desterro JM, Rodriguez MS, Hay RT (1998) SUMO-1 modification of IkappaBalpha inhibits NF-kappaB activation. Mol Cell 2: 233–239[CrossRef][Web of Science][Medline]

Desterro JM, Rodriguez MS, Kemp GD, Hay RT (1999) Identification of the enzyme required for activation of the small ubiquitin-like protein SUMO-1. J Biol Chem 274: 10618–10624[Abstract/Free Full Text]

Downes B, Vierstra RD (2005) Post-translational regulation in plants employing a diverse set of polypeptide tags. Biochem Soc Trans 33: 393–399[CrossRef][Web of Science][Medline]

Downes BP, Saracco SA, Lee SS, Crowell DN, Vierstra RD (2006) MUBs, a family of ubiquitin-fold proteins that are plasma membrane-anchored by prenylation. J Biol Chem 281: 27145–27157[Abstract/Free Full Text]

Downes BP, Stupar RM, Gingerich DJ, Vierstra RD (2003) The HECT ubiquitin-protein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development. Plant J 35: 729–742[CrossRef][Web of Science][Medline]

Dye BT, Schulman BA (2007) Structural mechanisms underlying posttranslational modification by ubiquitin-like proteins. Annu Rev Biophys Biomol Struct 36: 131–150[CrossRef][Medline]

Epps JL, Tanda S (1998) The Drosophila semushi mutation blocks nuclear import of bicoid during embryogenesis. Curr Biol 8: 1277–1280[CrossRef][Web of Science][Medline]

Folta KM, Kaufman LS (2000) Preparation of transcriptionally active nuclei from etiolated Arabidopsis thaliana. Plant Cell Rep 19: 504–510[CrossRef][Web of Science]

Fu H, Doelling JH, Arendt CS, Hochstrasser M, Vierstra RD (1998) Molecular organization of the 20S proteasome gene family from Arabidopsis thaliana. Genetics 149: 677–692[Abstract/Free Full Text]

Giaever G, Chu AM, Ni L, Connelly C, Riles L, Véronneau S, Dow S, Lucau-Danila A, Anderson K, André B, et al (2002) Functional profiling of the Saccharomyces cerevisiae genome. Nature 418: 387–391[CrossRef][Medline]

Gingerich DJ, Gagne JM, Salter DW, Hellmann H, Estelle M, Ma L, Vierstra RD (2005) Cullins 3a and 3b assemble with members of the broad complex/tramtrack/bric-a-brac (BTB) protein family to form essential ubiquitin-protein ligases (E3s) in Arabidopsis. J Biol Chem 280: 18810–18821[Abstract/Free Full Text]

Hanania U, Furman-Matarasso N, Ron M, Avni A (1999) Isolation of a novel SUMO protein from tomato that suppresses EIX-induced cell death. Plant J 19: 533–541[CrossRef][Web of Science][Medline]

Hannich JT, Lewis A, Kroetz MB, Li SJ, Heide H, Emili A, Hochstrasser M (2005) Defining the SUMO-modified proteome by multiple approaches in Saccharomyces cerevisiae. J Biol Chem 280: 4102–4110[Abstract/Free Full Text]

Hay RT (2005) SUMO: a history of modification. Mol Cell 18: 1–12[CrossRef][Web of Science][Medline]

Hayashi T, Seki M, Maeda D, Wang W, Kawabe Y, Seki T, Saitoh H, Fukagawa T, Yagi H, Enomoto T (2002) Ubc9 is essential for viability of higher eukaryotic cells. Exp Cell Res 280: 212–221[CrossRef][Web of Science][Medline]

Ho JC, Warr NJ, Shimizu H, Watts FZ (2001) SUMO modification of Rad22, the Schizosaccharomyces pombe homologue of the recombination protein Rad52. Nucleic Acids Res 29: 4179–4186[Abstract/Free Full Text]

Hoege C, Pfander B, Moldovan GL, Pyrowolakis G, Jentsch S (2002) RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419: 135–141[CrossRef][Medline]

Hong Y, Rogers R, Matunis MJ, Mayhew CN, Goodson ML, Park-Sarge OK, Sarge KD (2001) Regulation of heat shock transcription factor 1 by stress-induced SUMO-1 modification. J Biol Chem 276: 40263–40267[Abstract/Free Full Text]

Hotson A, Chosed R, Shu H, Orth K, Mudgett MB (2003) Xanthomonas type III effector XopD targets SUMO-conjugated proteins in planta. Mol Microbiol 50: 377–389[CrossRef][Web of Science][Medline]

Huang TT, Wuerzberger-Davis SM, Wu ZH, Miyamoto S (2003) Sequential modification of NEMO/IKKgamma by SUMO-1 and ubiquitin mediates NF-kappaB activation by genotoxic stress. Cell 115: 565–576[CrossRef][Web of Science][Medline]

Huh WK, Falvo JV, Gerke LC, Carroll AS, Howson RW, Weissman JS, O'Shea EK (2003) Global analysis of protein localization in budding yeast. Nature 425: 686–691[CrossRef][Medline]

Johnson ES (2004) Protein modification by SUMO. Annu Rev Biochem 73: 355–382[CrossRef][Web of Science][Medline]

Johnson ES, Blobel G (1997) Ubc9p is the conjugating enzyme for the ubiquitin-like protein Smt3p. J Biol Chem 272: 26799–26802[Abstract/Free Full Text]

Johnson ES, Blobel G (1999) Cell cycle-regulated attachment of the ubiquitin-related protein SUMO to the yeast septins. J Cell Biol 147: 981–994[Abstract/Free Full Text]

Johnson ES, Gupta AA (2001) An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106: 735–744[CrossRef][Web of Science][Medline]

Johnson ES, Schwienhorst I, Dohmen RJ, Blobel G (1997) The ubiquitin-like protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J 16: 5509–5519[CrossRef][Web of Science][Medline]

Jones D, Crowe E, Stevens TA, Candido EP (2002) Functional and phylogenetic analysis of the ubiquitylation system in Caenorhabditis elegans: ubiquitin-conjugating enzymes, ubiquitin-activating enzymes, and ubiquitin-like proteins. Genome Biol 3: RESEARCH0002[Medline]

Kagey MH, Melhuish TA, Wotton D (2003) The polycomb protein Pc2 is a SUMO E3. Cell 113: 127–137[CrossRef][Web of Science][Medline]

Kim KI, Baek SH, Jeon YJ, Nishimori S, Suzuki T, Uchida S, Shimbara N, Saitoh H, Tanaka K, Chung CH (2000) A new SUMO-1-specific protease, SUSP1, that is highly expressed in reproductive organs. J Biol Chem 275: 14102–14106[Abstract/Free Full Text]

Kirsh O, Seeler JS, Pichler A, Gast A, Muller S, Miska E, Mathieu M, Harel-Bellan A, Kouzarides T, Melchior F, et al (2002) The SUMO E3 ligase RanBP2 promotes modification of the HDAC4 deacetylase. EMBO J 21: 2682–2691[CrossRef][Web of Science][Medline]

Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant Cell 11: 2283–2290[Free Full Text]

Kurepa J, Walker JM, Smalle J, Gosink MM, Davis SJ, Durham TL, Sung DY, Vierstra RD (2003) The small ubiquitin-like modifier (SUMO) protein modification system in Arabidopsis. Accumulation of SUMO1 and -2 conjugates is increased by stress. J Biol Chem 278: 6862–6872[Abstract/Free Full Text]

Lee J, Nam J, Park HC, Na G, Miura K, Jin JB, Yoo CY, Baek D, Kim DH, Jeong JC, et al (2007) Salicylic acid-mediated innate immunity in Arabidopsis is regulated by SIZ1 SUMO E3 ligase. Plant J 49: 79–90[CrossRef][Web of Science][Medline]

Lehembre F, Badenhorst P, Muller S, Travers A, Schweisguth F, Dejean A (2000) Covalent modification of the transcriptional repressor tramtrack by the ubiquitin-related protein Smt3 in Drosophila flies. Mol Cell Biol 20: 1072–1082[Abstract/Free Full Text]

Lois LM, Lima CD, Chua NH (2003) Small ubiquitin-like modifier modulates abscisic acid signaling in Arabidopsis. Plant Cell 15: 1347–1359[Abstract/Free Full Text]

Mahajan R, Gerace L, Melchior F (1998) Molecular characterization of the SUMO-1 modification of RanGAP1 and its role in nuclear envelope association. J Cell Biol 140: 259–270[Abstract/Free Full Text]

Matunis MJ, Wu J, Blobel G (1998) SUMO-1 modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex. J Cell Biol 140: 499–509[Abstract/Free Full Text]

Melchior F (2000) SUMO—nonclassical ubiquitin. Annu Rev Cell Dev Biol 16: 591–626[CrossRef][Web of Science][Medline]

Meluh PB, Koshland D (1995) Evidence that the MIF2 gene of Saccharomyces cerevisiae encodes a centromere protein with homology to the mammalian centromere protein CENP-C. Mol Biol Cell 6: 793–807[Abstract]

Miura K, Rus A, Sharkhuu A, Yokoi S, Karthikeyan AS, Raghothama KG, Baek D, Koo YD, Jin JB, Bressan RA, et al (2005) The Arabidopsis SUMO E3 ligase SIZ1 controls phosphate deficiency responses. Proc Natl Acad Sci USA 102: 7760–7765[Abstract/Free Full Text]

Miura K, Jin JB, Lee J, Yoo CY, Stirm V, Miura T, Ashworth EN, Bressan RA, Yun DJ, Hasegawa PM (2007) SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis. Plant Cell 19: 1403–1414[Abstract/Free Full Text]

Mukherjee S, Keitany G, Li Y, Wang Y, Ball HL, Goldsmith EJ, Orth K (2006) Yersinia YopJ acetylates and inhibits kinase activation by blocking phosphorylation. Science 312: 1211–1214[Abstract/Free Full Text]

Murtas G, Reeves PH, Fu YF, Bancroft I, Dean C, Coupland G (2003) A nuclear protease required for flowering-time regulation in Arabidopsis reduces the abundance of SMALL UBIQUITIN-RELATED MODIFIER conjugates. Plant Cell 15: 2308–2319[Abstract/Free Full Text]

Nacerddine K, Lehembre F, Bhaumik M, Artus J, Cohen-Tannoudji M, Babinet C, Pandolfi PP, Dejean A (2005) The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice. Dev Cell 9: 769–779[CrossRef][Web of Science][Medline]

Nowak M, Hammerschmidt M (2006) Ubc9 regulates mitosis and cell survival during zebrafish development. Mol Biol Cell 17: 5324–5336[Abstract/Free Full Text]

Okuma T, Honda R, Ichikawa G, Tsumagari N, Yasuda H (1999) In vitro SUMO-1 modification requires two enzymatic steps, E1 and E2. Biochem Biophys Res Commun 254: 693–698[CrossRef][Web of Science][Medline]

Orth K, Xu Z, Mudgett MB, Bao ZQ, Palmer LE, Bliska JB, Mangel WF, Staskawicz B, Dixon JE (2000) Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease. Science 290: 1594–1597[Abstract/Free Full Text]

Panse VG, Hardeland U, Werner T, Kuster B, Hurt E (2004) A proteome-wide approach identifies sumoylated substrate proteins in yeast. J Biol Chem 279: 41346–41351[Abstract/Free Full Text]

Pichler A, Knipscheer P, Saitoh H, Sixma TK, Melchior F (2004) The RanBP2 SUMO E3 ligase is neither HECT- nor RING-type. Nat Struct Mol Biol 11: 984–991[CrossRef][Web of Science][Medline]

Przemeck GK, Mattsson J, Hardtke CS, Sung ZR, Berleth T (1996) Studies on the role of the Arabidopsis gene MONOPTEROS in vascular development and plant cell axialization. Planta 200: 229–237[Web of Science][Medline]

Rancour DM, Park S, Knight SD, Bednarek SY (2004) Plant UBX domain-containing protein 1, PUX1, regulates the oligomeric structure and activity of Arabidopsis CDC48. J Biol Chem 279: 54264–54274[Abstract/Free Full Text]

Roden J, Eardley L, Hotson A, Cao Y, Mudgett MB (2004) Characterization of the Xanthomonas AvrXv4 effector, a SUMO protease translocated into plant cells. Mol Plant Microbe Interact 17: 633–643[Web of Science][Medline]

Rodriguez MS, Dargemont C, Hay RT (2001) SUMO-1 conjugation in vivo requires both a consensus modification motif and nuclear targeting. J Biol Chem 276: 12654–12659[Abstract/Free Full Text]

Rose A, Meier I (2001) A domain unique to plant RanGAP is responsible for its targeting to the plant nuclear rim. Proc Natl Acad Sci USA 98: 15377–15382[Abstract/Free Full Text]

Saitoh H, Hinchey J (2000) Functional heterogeneity of small ubiquitin-related protein modifiers SUMO-1 versus SUMO-2/3. J Biol Chem 275: 6252–6258[Abstract/Free Full Text]

Sampson DA, Wang M, Matunis MJ (2001) The small ubiquitin-like modifier-1 (SUMO-1) consensus sequence mediates Ubc9 binding and is essential for SUMO-1 modification. J Biol Chem 276: 21664–21669[Abstract/Free Full Text]

Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P, Bacwaden J, Ko C, et al (2002) A high-throughput Arabidopsis reverse genetics system. Plant Cell 14: 2985–2994[Abstract/Free Full Text]

Seufert W, Futcher B, Jentsch S (1995) Role of a ubiquitin-conjugating enzyme in degradation of S- and M-phase cyclins. Nature 373: 78–81[CrossRef][Medline]

Shayeghi M, Doe CL, Tavassoli M, Watts FZ (1997) Characterisation of Schizosaccharomyces pombe rad31, a UBA-related gene required for DNA damage tolerance. Nucleic Acids Res 25: 1162–1169[Abstract/Free Full Text]

Smalle J, Kurepa J, Yang P, Babiychuk E, Kushnir S, Durski A, Vierstra RD (2002) Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14: 17–32[Abstract/Free Full Text]

Smalle J, Vierstra RD (2004) The ubiquitin 26S proteasome proteolytic pathway. Annu Rev Plant Biol 55: 555–590[CrossRef][Medline]

Sramko M, Markus J, Kabat J, Wolff L, Bies J (2006) Stress-induced inactivation of the c-Myb transcription factor through conjugation of SUMO-2/3 proteins. J Biol Chem 281: 40065–40075[Abstract/Free Full Text]

Sunilkumar G, Mohr L, Lopata-Finch E, Emani C, Rathore KS (2002) Developmental and tissue-specific expression of CaMV 35S promoter in cotton as revealed by GFP. Plant Mol Biol 50: 463–474[CrossRef][Web of Science][Medline]

Tanaka K, Nishide J, Okazaki K, Kato H, Niwa O, Nakagawa T, Matsuda H, Kawamukai M, Murakami Y (1999) Characterization of a fission yeast SUMO-1 homologue, pmt3p, required for multiple nuclear events, including the control of telomere length and chromosome segregation. Mol Cell Biol 19: 8660–8672[Abstract/Free Full Text]

Tatham MH, Jaffray E, Vaughan OA, Desterro JM, Botting CH, Naismith JH, Hay RT (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem 276: 35368–35374[Abstract/Free Full Text]

Vertegaal AC, Ogg SC, Jaffray E, Rodriguez MS, Hay RT, Andersen JS, Mann M, Lamond AI (2004) A proteomic study of SUMO-2 target proteins. J Biol Chem 279: 33791–33798[Abstract/Free Full Text]

Wohlschlegel JA, Johnson ES, Reed SI, Yates JR III (2004) Global analysis of protein sumoylation in Saccharomyces cerevisiae. J Biol Chem 279: 45662–45668[Abstract/Free Full Text]

Woody ST, Austin-Phillips S, Amasino RM, Krysan PJ (2007) The WiscDsLox T-DNA collection: an Arabidopsis community resource generated by using an improved high-throughput T-DNA sequencing pipeline. J Plant Res 120: 157–165[CrossRef][Web of Science][Medline]

Yoo CY, Miura K, Jin JB, Lee J, Park HC, Salt DE, Yun DJ, Bressan RA, Hasegawa PM (2006) SIZ1 small ubiquitin-like modifier E3 ligase facilitates basal thermotolerance in Arabidopsis independent of salicylic acid. Plant Physiol 142: 1548–1558[Abstract/Free Full Text]

Zhang H, Saitoh H, Matunis MJ (2002) Enzymes of the SUMO modification pathway localize to filaments of the nuclear pore complex. Mol Cell Biol 22: 6498–6508[Abstract/Free Full Text]

Zhao Y, Kwon SW, Anselmo A, Kaur K, White MA (2004) Broad spectrum identification of cellular small ubiquitin-related modifier (SUMO) substrate proteins. J Biol Chem 279: 20999–21002[Abstract/Free Full Text]

Zhou W, Ryan JJ, Zhou H (2004) Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses. J Biol Chem 279: 32262–32268[Abstract/Free Full Text]

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004) GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol 136: 2621–2632[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Plant CellHome page
T. Ishida, S. Fujiwara, K. Miura, N. Stacey, M. Yoshimura, K. Schneider, S. Adachi, K. Minamisawa, M. Umeda, and K. Sugimoto
SUMO E3 Ligase HIGH PLOIDY2 Regulates Endocycle Onset and Meristem Maintenance in Arabidopsis
PLANT CELL, August 1, 2009; 21(8): 2284 - 2297.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
S. Okada, M. Nagabuchi, Y. Takamura, T. Nakagawa, K. Shinmyozu, J.-i. Nakayama, and K. Tanaka
Reconstitution of Arabidopsis thaliana SUMO Pathways in E. coli: Functional Evaluation of SUMO Machinery Proteins and Mapping of SUMOylation Sites by Mass Spectrometry
Plant Cell Physiol., June 1, 2009; 50(6): 1049 - 1061.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Miura, J. Lee, J. B. Jin, C. Y. Yoo, T. Miura, and P. M. Hasegawa
Sumoylation of ABI5 by the Arabidopsis SUMO E3 ligase SIZ1 negatively regulates abscisic acid signaling
PNAS, March 31, 2009; 106(13): 5418 - 5423.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
R. Budhiraja, R. Hermkes, S. Muller, J. Schmidt, T. Colby, K. Panigrahi, G. Coupland, and A. Bachmair
Substrates Related to Chromatin and to RNA-Dependent Processes Are Modified by Arabidopsis SUMO Isoforms That Differ in a Conserved Residue with Influence on Desumoylation
Plant Physiology, March 1, 2009; 149(3): 1529 - 1540.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
L. Conti, G. Price, E. O'Donnell, B. Schwessinger, P. Dominy, and A. Sadanandom
Small Ubiquitin-Like Modifier Proteases OVERLY TOLERANT TO SALT1 and -2 Regulate Salt Stress Responses in Arabidopsis
PLANT CELL, October 1, 2008; 20(10): 2894 - 2908.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
Y. Lee, H.-S. Lee, J.-S. Lee, S.-K. Kim, and S.-H. Kim
Hormone- and light-regulated nucleocytoplasmic transport in plants: current status
J. Exp. Bot., September 1, 2008; 59(12): 3229 - 3245.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Garcia-Dominguez, R. March-Diaz, and J. C. Reyes
The PHD Domain of Plant PIAS Proteins Mediates Sumoylation of Bromodomain GTE Proteins
J. Biol. Chem., August 1, 2008; 283(31): 21469 - 21477.
[Abstract] [Full Text] [PDF]


This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrowOA All Versions of this Article:
145/1/119    most recent
pp.107.102285v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saracco, S. A.
Right arrow Articles by Vierstra, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saracco, S. A.
Right arrow Articles by Vierstra, R. D.
Agricola
Right arrow Articles by Saracco, S. A.
Right arrow Articles by Vierstra, R. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2007 by the American Society of Plant Biologists