|
|
||||||||
|
First published online July 20, 2007; 10.1104/pp.107.102285 Plant Physiology 145:119-134 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Genetic Analysis of SUMOylation in Arabidopsis: Conjugation of SUMO1 and SUMO2 to Nuclear Proteins Is Essential1,[OA]Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706–1574
The posttranslational addition of small ubiquitin-like modifiers (SUMOs) to other intracellular proteins has been implicated in a variety of eukaryotic functions, including modifying cytoplasmic signal transduction, nuclear import and subnuclear compartmentalization, DNA repair, and transcription regulation. For plants, in particular, both genetic analyses and the rapid accumulation of SUMO conjugates in response to various adverse environmental conditions suggest that SUMOylation plays a key role in the stress response. Through genetic analyses of various SUMO conjugation mutants, we show here that the SUMO1 and SUMO2 isoforms, in particular, and SUMOylation, in general, are essential for viability in Arabidopsis (Arabidopsis thaliana). Null T-DNA insertion mutants affecting the single genes encoding the SUMO-activating enzyme subunit SAE2 and the SUMO-conjugating enzyme SCE1 are embryonic lethal, with arrest occurring early in embryo development. Whereas the single genes encoding the SUMO1 and SUMO2 isoforms are not essential by themselves, double mutants missing both are also embryonic lethal. Viability can be restored by reintroduction of SUMO1 expression in the homozygous sum1-1 sum2-1 background. Various stresses, like heat shock, dramatically increase the pool of SUMO conjugates in planta. This increase involves SUMO1 and SUMO2 and is mainly driven by the SUMO protein ligase SIZ1, with most of the conjugates accumulating in the nucleus. Taken together, it appears that SIZ1-mediated conjugation of SUMO1 and SUMO2 to other intracellular proteins is essential in Arabidopsis, possibly through stress-induced modification of a potentially diverse pool of nuclear proteins.
In recent years, the posttranslational addition of ubiquitin (Ub)-fold proteins to other intracellular molecules has been implicated in the control of many aspects of eukaryotic development, homeostasis, and stress protection (Downes and Vierstra, 2005
Based on the number and diversity of protein substrates, one influential set of Ub-fold proteins encompasses the SUMO (or sentrin) family (Melchior, 2000
The functions of SUMOylation are best understood in yeast and animal cells, where roles in signal transduction, the cell cycle, DNA repair, transcription regulation, nuclear import and subnuclear compartmentalization, and viral pathogenesis have been observed (Johnson, 2004
A number of transcription factors are rapidly modified with SUMOs in response to various stresses (Hong et al., 2001
Given that many SUMO functions are nuclear, it is not surprising that both components of the SUMO conjugation pathway and SUMO-conjugated proteins themselves are enriched in or near this compartment (Lehembre et al., 2000
In plants, the roles of SUMO are less clear and in some cases remain enigmatic. Whereas yeast contains a single SUMO isoform and four isoforms are expressed in humans, eight potentially functional SUMO-encoding genes (SUM1–8) are present in the Arabidopsis genome (Kurepa et al., 2003
Several studies have proposed that SUMOylation directly participates in plant pathogenesis. A tomato (Solanum lycopersicon) SUMO ortholog was found to interact with the effector ethylene-induced xylanase EIX from the fungus Trichoderma viridae, and when SUMO is overexpressed infection is reduced (Hanania et al., 1999
To further define the range of plant processes regulated by SUMOylation, we initiated a reverse-genetics analysis of the dominant SUMOs, SUMO1 and SUMO2, components of the SUMO E1 heterodimer (SAE1/2), and the SUMO E2 SCE1 in Arabidopsis. We show here that these proteins are essential and that their absence causes early embryonic arrest. In combination with an available null allele of the SUMO E3 SIZ1 (siz1-2; Miura et al., 2005
Expression of SUMO Pathway Components
Prior genomic analyses identified numerous components of the Arabidopsis SUMO conjugation system using animal and yeast counterparts as queries (Kurepa et al., 2003
To help analyze the expression patterns for the SUMOs, the cognate E1 and E2, and the SIZ1 E3, we mined the Arabidopsis ESTs (http://www.arabidopsis.org) and the Genevestigator DNA microarray databases (https://www.genevestigator.ethz.ch; Zimmermann et al., 2004
When the mRNA profiles of SAE1a, SAE1b, SAE2, SCE1, and SIZ1 in the Genevestigator database were analyzed similarly, we found that each is expressed in all tissues examined with little variation in their relative levels, indicating that the SUMO conjugation pathway is ubiquitously present (Fig. 1B). SAE1a and SAE1b, which encode very similar polypeptides (81% amino acid sequence identity), have comparable expression patterns, suggesting that they are functionally redundant. The E2 SCE1 locus appears to be the most highly expressed gene, with mRNA levels 2 to 10 times higher than the other components based on DNA microarray analysis and EST numbers (96 ESTs versus 43, 42, 14, and eight for SIZ1, SAE1a, SAE1b, and SAE2, respectively; http://www.arabidopsis.org). The low levels of the SAE2 transcript relative to those for SAE1a and SAE1b as judged by both EST numbers and DNA microarray analyses could indicate that the corresponding polypeptide is better translated and/or more stable relative to the two SAE1 subunit isoforms, which we presume would accumulate in stoichiometric amounts to form the E1 heterodimer.
When crude extracts derived from various tissues were subjected to SDS-PAGE and probed by immunoblotting, we also confirmed accumulation of several of the corresponding proteins. An antibody raised against recombinant SUMO1, which primarily cross-reacts with SUMO1 and SUMO2 (Kurepa et al., 2003
To help define the importance of SUMOylation in plants, we searched for Arabidopsis T-DNA insertion mutants that should strongly impair expression of the cognate E1 and E2 proteins. Whereas useful lines were not available for SAE1b, we acquired one or more alleles disrupting the SAE1a, SAE2, or SCE1 loci within or near the predicted transcribed regions from the SIGNAL collection generated with the Columbia (Col)-0 background (Alonso et al., 2003
For the SAE1a locus, two T-DNA insertion lines were found. The sae1a-1 allele (Salk_060834) contains a T-DNA within the penultimate exon, 233 bp upstream from the stop codon, which when inserted caused a 7-bp deletion of exonic sequence surrounding the insertion site that might shift the reading frame (bp 2,089–2,095 downstream of the translation start site; Fig. 2A). RT-PCR of RNA isolated from homozygous sae1a-1 seedlings failed to amplify the full-length SAE1a mRNA, but detected partial transcripts both upstream and downstream of the insertion site (Fig. 2B). The potential absence of full-length mRNA was supported by gel-blot analysis of total RNA using a SAE1a coding region probe (Fig. 2C). Only a faint signal was evident at the migration position of the SAE1a mRNA, which likely represents weak cross-hybridization with the SAE1b mRNA. Similarly, the amount of SAE1 protein was dramatically reduced in the sae1a-1 background based on immunoblot analysis with affinity-purified anti-SAE1a antibodies. These antibodies recognize recombinant SAE1a approximately 5 times better than its paralog SAE1b (Fig. 2E). Whereas an approximately 40-kD SAE1 protein was easily detected in wild-type seedlings, only a small amount of a slightly lower molecular mass species was detected in homozygous sae1a-1 seedlings, which is either a truncated form of SAE1a potentially missing the C-terminal end, the remaining SAE1b isoform, or a cross-reacting protein (Fig. 2D). Taken together, it appears that the sae1a-1 mutant represents a strong, if not null, allele. Homozygous sae1a-1 plants displayed no abnormal phenotypes when grown under standard growth conditions, suggesting that the SAE1a gene is not essential by itself and likely functionally redundant with SAE1b (data not shown). A sae1a-2 allele (Salk_001140) was also found that contains a T-DNA inserted 40 bp upstream of the predicted transcription start site and 190 bp upstream of the translation start site. Given the lack of phenotypic effects for the sae1a-1 allele and the predicted weaker consequences for the sae1a-2 allele, based on the greater distance of the T-DNA from the coding region, we did not characterize this mutant further. Several T-DNA insertion mutants were identified within or near SAE2. The most useful allele, sae2-1 (Salk_053023), contains a T-DNA within the fourth intron and is missing 31 bp of genomic sequence flanking the left-border and right-border junctions (bp 1,186–1,217 downstream of the translation start site; Fig. 3A). The insertion is upstream of the codon for the active-site Cys (Cys-168). Whereas truncated mRNAs produced by the native promoter upstream of the T-DNA should encode inactive polypeptides, transcripts produced downstream of the insertion site could generate truncated, but active, enzymes. Two other T-DNA mutants were found within the 3'-untranslated region (UTR). For the sae2-2 (Salk_020830) and sae2-3 (Salk_020005) alleles, the left border of the T-DNA sequence is positioned 33 and 44 bp downstream of the translation stop codon, respectively. We obtained viable homozygous sae2-2 and sae2-3 plants, suggesting that these alleles do not dramatically reduce SAE2 expression (data not shown). Despite being the smallest gene target of the group, a number of T-DNA insertion mutants were available for the SCE1 locus. Three mutants contained a T-DNA upstream of the 5'-UTR, which starts 68 bp from the translation start site (Fig. 3A). The sce1-3 (Salk_058401), sce1-4 (Salk_006164), and sce1-7 (Salk_022200) alleles have T-DNA left-border sequences located 230, 87, and 92 bp upstream of the SCE1 initiation codon, respectively. Two additional lines, sce1-5 and sce1-6, have T-DNA insertions within the coding sequence very close to the translation start site (58 and 43 bp downstream of the initiation codon) and upstream of the codon for the active-site Cys (Cys-94) and thus should represent strong mutant alleles.
Phenotypic analysis of strong alleles affecting SAE2 (sae2-1) and SCE1 (sce1-5 and sce1-6) revealed that the SUMO conjugation pathway is essential in Arabidopsis. Both classes of mutants could be easily transferred through the pollen or egg when the alleles were out-crossed to wild-type Col-0, indicating that male and female gametogenesis proceeds normally. However, when heterozygous lines of each were self-fertilized, we could not recover homozygous progeny as determined by genomic PCR (data not shown). Examination of the developing siliques identified a large percentage of seeds that failed to develop normally and became brown and shriveled, in addition to the plump green seeds characteristic of those from self-fertilized wild-type siliques (Fig. 3B). Approximately 23% of the seeds from the heterozygous sae2-1, sce1-5, and sce1-6 plants showed this aborted phenotype, strongly suggesting that seeds homozygous for the mutant loci underwent embryo arrest following fertilization (Table I
). To determine the stage of embryo arrest, we collected immature white and green seeds from the defective siliques and examined the embryos by differential contrast microscopy following clearing of the seeds with Hoyer's solution (Gingerich et al., 2005
Phenotypically normal homozygous plants were obtained from selfed heterozygous sce1-3, sce1-4, and sce1-7 seedlings, indicating that these upstream T-DNA insertion mutants did not inactivate the SCE1 gene (see Fig. 6; data not shown). However, the sce1-4 and sec1-7 mutants depressed accumulation of the SCE1 transcript and corresponding protein. As shown in Figure 3D, gel-blot analysis of total RNA collected from liquid-grown seedlings revealed a substantial decrease in SCE1 mRNA as compared to that in wild-type Col-0 seedlings. A reduced amount of SCE1 protein was also evident by immunoblot analysis with anti-SCE1 antibodies; the homozygous sce1-4 and sce1-7 backgrounds had approximately one-fourth the amount of SCE1 protein as wild type (Fig. 3E).
This reduced amount of the SUMO E2 in homozygous sce1-4 and sce1-7 plants also dampened the conjugation of SUMO1/2 to other proteins. Our prior work showed that heat shock (37°C) of young liquid-grown Arabidopsis seedlings rapidly and substantially elevates the amount of SUMO conjugates with a concomitant reduction in the amount of free SUMO (Kurepa et al., 2003
The embryonic lethality of E1 and E2 mutants implied that conjugation of one or more SUMO isoforms is essential for Arabidopsis development. To help identify which of the four expressed SUMO variants is responsible (SUMO1, SUMO2, SUMO3, and SUMO5), we attempted to collect T-DNA mutants affecting each paralog. At the time of this study, neither the SIGNAL (Alonso et al., 2003 Fortunately, useful T-DNA lines were identified that disrupt the closely related and best-expressed SUM1 and SUM2 pair (Fig. 4A ). The sum1-1 allele (296_C12) was found in the SAIL collection; it contains a T-DNA sequence and a 34-bp deletion of genomic sequence within the second intron of SUM1, with its right border placed 822 bp downstream of the ATG start codon. The sum2-1 allele (SALK_129775) was found in the SIGNAL collection; it harbors a T-DNA within the third exon 958 bp downstream of the translation start site. RT-PCR failed to detect the corresponding full-length mRNAs in the appropriate single-homozygous sum1-1 and sum2-1 plants, strongly suggesting that the mutants represent null alleles of each locus (Fig. 4B).
Unlike strong mutants of SAE2 and SCE1 (Fig. 3, B and C), we could easily generate single-homozygous progeny from selfed heterozygous sum1-1 or sum2-1 plants. The homozygous plants were phenotypically normal and highly fertile, with siliques full of healthy green seeds, indicating that neither SUMO1 nor SUMO2 is essential by itself (Fig. 4, C and D; Table I; data not shown). Given the likelihood that SUM1 and SUM2 are functionally redundant genes, we attempted to create the double-homozygous mutant by initially crossing a sum1-1/sum1-1 plant to a sum2-1/sum2-1 mutant to generate double-heterozygous individuals and then identifying double-homozygous progeny following self-fertilization. We failed to find any double-homozygous plants by PCR genotyping 58 progeny, suggesting that the double homozygote is nonviable. This dihybrid cross did generate both SUM1/sum1-1 sum2-1/sum2-1 and sum1-1/sum1-1 SUM2/sum2-1 homozygous/heterozygous plants that were fertile. Again, when 24 progeny from each of these selfed parents were screened, no double-homozygous plants were found. Inspection of the siliques from the selfed SUM1/sum1-1 sum2-1/sum2-1 and sum1-1/sum1-1 SUM2/sum2-1 plants detected a large percentage of white and shriveled brown seeds indicative of embryos that aborted development following fertilization (Fig. 4C; Table I). We then determined the stage of embryo arrest by differential contrast microscopy of both green and white embryos. Like the sae2-1, sce1-5, and sce1-6 mutants analyzed in Figure 3, embryos arrested at various early stages of development were detected in the white/brown and presumed double-homozygous sum1-1/sum1-1 sum2-1/sum2-1 seeds. In some defective seeds, possible embryo reabsorption was evident, suggesting problems very early in embryogenesis (Fig. 4D; data not shown). In contrast, approximately 75% of the remaining embryos from the selfed SUM1/sum1 sum2/sum2 parent and 80% of the remaining embryos from the selfed sum1/sum1 SUM2/sum2 parent were green and appeared to develop normally (Table I), demonstrating that Arabidopsis embryogenesis can often proceed normally if at least one wild-type copy of SUM1 or SUM2 is present. Likewise, the homozygous/heterozygous and heterozygous/homozygous plants grew normally from these seeds under standard growth conditions (see Fig. 6).
Prior studies implicated SUMO1 and SUMO2 in the stress-induced rapid accumulation of SUMO conjugates in Arabidopsis. Key observations included the facts that these conjugates can be detected with anti-SUMO1 antibodies that preferentially recognize SUMO1 and SUMO2, but not their next closest paralog, SUMO3, and could be artificially increased by overexpression of SUMO2 (Kurepa et al., 2003
When wild-type Col-0 seedlings were exposed to a 30-min heat shock at 37°C followed by recovery at 24°C, they rapidly accumulated SUMOylated proteins and consumed the pool of free SUMO (Fig. 5
; Kurepa et al., 2003
SIZ1 Participates in Heat-Induced SUMOylation of SUMO1 and SUMO2
Whereas it is expected that multiple SUMO E3s exist in plants, to date only the SIZ1 E3 has been described (Kurepa et al., 2003 To confirm that SIZ1 ligates SUMO1/2, we compared the heat-induced accumulation of SUMO conjugates in young siz1-2 seedlings to those in wild-type Col-0, single-homozygous sum1-1 and sum2-1, and the heterozygous/homozygous SUM1/sum1-1 sum2-1/sum2-1 seedlings. The kinetics for heat-induced SUMOylation in the siz1-2 seedlings was indistinguishable to wild-type Col-0, but the siz1-2 plants accumulated much less conjugates and failed to appreciably consume the free SUMO pool at the peak of the response (Fig. 7A ). Compared to the homozygous sum1-1 and sum2-1 and heterozygous/homozygous sum1-1 sum2-1 backgrounds, siz1-2 seedlings also showed a severely dampened heat stress response (Fig. 7B). However, small amounts of SUMO conjugates did accumulate in siz1-2 seedlings between 30 and 60 min after the start of the heat stress, suggesting that other SUMO E3s participate and/or that this stress-induced accumulation can occur to a limited degree in an E3-independent manner.
In addition to dampened SUMO conjugation, we also detected increases in the levels of free SUMO and the E2 SCE1 in siz1-2 seedlings both before and after heat shock (Fig. 7B). We presume that part of the increase in free SUMO in the mutant background reflected a failure to incorporate the tag into conjugates in the absence of SIZ1. In contrast, the marked increase in SCE1 levels suggests that the siz1-2 plants attempted to overcome this block in conjugation by elevating E2 abundance. However, this block did not universally up-regulate the entire SUMOylation cascade because no increase in the SAE1 E1 level was evident in siz1-2 plants. Similar increases in SCE1 abundance were not apparent in the single-homozygous sum1-1 or sum1-2 plants or in the SUM1/sum1-1 sum2-1/sum2-1 plants, suggesting that this up-regulation is not activated by milder constraints on SUMOylation.
To confirm that SUMO1 and SUMO2 are together essential in Arabidopsis, we attempted to rescue the embryo lethality of the double-homozygous sum1-1 sum2-1 plants by complementation with an Arabidopsis SUM1 transgene (SUM1-T). SUM1-T was introduced into the SUM1/sum1-1 sum2-1/sum2-1 background; heterozygous/homozygous individuals containing the transgene were first selected by kanamycin resistance linked to SUM1-T and then for the sum1-1 allele by genomic PCR (Fig. 8B
). Double-homozygous progeny harboring the transgene were then identified by PCR with an array of gene-specific primers (Fig. 8, A and B). First attempts to complement the mutant using a SUM1 coding region expressed under the direction of the cauliflower mosaic virus 35S promoter failed (data not shown). Because the 35S promoter is purported to work poorly in embryos (Sunilkumar et al., 2002
Heat Shock-Induced SUMO Conjugates Accumulate in the Nucleus
Previous studies showed that both SUMOs and the SCE1 E2 are nuclear enriched in Arabidopsis, suggesting that many SUMOylation targets in plants reside in this compartment (Kurepa et al., 2003 As can be seen in Figure 9 , the protocol successfully enriched for nuclei (as judged by histone H3 levels) with little cytoplasmic and organellar contamination. When analyzed similarly with anti-SUMO1 antibodies, we found that most of the SUMO conjugates were in the nucleus in nonstressed plants, with little detected in the cytoplasmic fraction (Fig. 9). Similar strong nuclear enrichment was evident in heat-shocked plants despite the dramatic increase in SUMO conjugates (Fig. 9), suggesting that most, if not all, of the stress-induced targets are also in this compartment or reside in the nucleus after SUMOylation. In contrast, the free SUMO pool was present in the cytoplasmic fraction. This could indicate that much of the free SUMO is cytoplasmic or, more likely, that SUMO diffused out of the nuclei during fractionation because of its small size or rupture of the nuclear envelope. The total and cytosolic fraction from heat-shocked tissue also contained immunoreactive species at approximately 36 and 50 kD (Fig. 9). Intriguingly, these species could reflect dimeric and trimeric variants of free SUMO, suggesting that SUMO can be assembled into polymeric chains.
Previous genomic analysis revealed that Arabidopsis contains a complex SUMO conjugation system with multiple SUMO isoforms, at least two types of E1s distinguished by the incorporation of the SAE1a and SAE1b isoforms into the SAE1/SAE2 heterodimer, and numerous deSUMOylating enzymes (Kurepa et al., 2003 Whereas eight potentially functional SUM genes exist in Arabidopsis, it appears that only four are actively transcribed—SUM1 to SUM3 and SUM5. Our genetic analysis of SUMO1 and SUMO2 indicates that these two isoforms together are essential. Whereas sum1-1 and sum2-1 single mutants are phenotypically normal, double-homozygous mutants are embryo lethal. Surprisingly, the sum1-1 sum2-1 homozygous/heterozygous and heterozygous/homozygous mutants are also normal, indicating that a single functional allele of SUM1 or SUM2 is sufficient to supply the free SUMO needed for viability and proper development.
During various stresses, like heat shock, a rapid and readily reversible accumulation of SUMO conjugates is evident that likely plays a role in stress protection (Kurepa et al., 2003
In addition to SUMO1 and SUMO2, expression studies indicate that SUMO3 and SUMO5 also accumulate. At present, the functions of these two isoforms and their contributions to stress-induced SUMOylation are unknown. Prior analysis with SUMO3-specific antibodies did not find similar increases in SUMO3 conjugates upon stress (Kurepa et al., 2003
In Arabidopsis, the E1 heterodimer is assembled from two paralogous SAE1 polypeptides and a single SAE2 polypeptide. Whereas the SAE2 subunit harbors the active-site Cys, the SAE1 subunit also contributes a conserved Arg finger to the active site and is thus necessary for catalysis (Dye and Schulman, 2007
Prior studies in yeasts and metazoans have demonstrated that SCE1 E2 is essential for viability and proper development (Epps and Tanda, 1998
Previous reports have implicated SIZ1 as the predominant SUMO E3 in Arabidopsis and showed that siz1 mutants are hypersensitive to thermal and cold stress and display increased SA-mediated pathogen resistance (Miura et al., 2005
Whatever the underpinning mechanisms for the pleiotropic siz1 defects, it is clear that SIZ1 is involved in the conjugation of SUMO1 and SUMO2 and appears responsible for most of their heat shock-induced SUMOylation. Whereas SUMO1 and SUMO2 are essential in Arabidopsis, SIZ1 is not. Possible explanations include the involvement of other SUMO E3s or SUMOylation directly by SCE1 via an E3-independent mechanism. In support of the latter, in vitro SUMOylation assays showed that yeast SIZ1 enhances, but is not required, for protein conjugation, and that SCE1 can directly transfer SUMO to targets by itself (Desterro et al., 1999
Cell fractionation studies revealed that the vast majority of SUMO conjugates in Arabidopsis are concentrated in the nucleus, both before and after heat shock. Such enrichment is not surprising given the nuclear localization of SUMOylation enzymes in Arabidopsis and other eukaryotes (Johnson and Blobel, 1999
Clearly, identification of the array of proteins modified by SUMOylation both before and after stress is now critical to define how SUMO regulates plant development and the stress response. To date, only one SUMO target has been proposed in plants, that being ICE1, a key transcriptional regulator of freezing tolerance (Miura et al., 2007
Plant Material and Genotypic Analysis
Arabidopsis (Arabidopsis thaliana) ecotype Col-0 T-DNA insertion mutants sum2-1 (Salk_129775), sum3-1 (Salk_123673), sae1a-1 (Salk_060834), sae1a-2 (Salk_001140), sae2-1 (Salk_053023), sae2-2 (Salk_020830), sae2-3 (Salk_020005), sce1-3 (Salk_058401), sce1-4 (Salk_006164), sce1-5 (Salk_138741), sce1-6 (Salk_071596), and sce1-7 (Salk_022200) were identified in the SIGNAL collection (Alonso et al., 2003
RNA isolation from 7-d-old liquid-grown seedlings using TRIzol reagent (Invitrogen) and RNA gel-blot analyses were performed essentially as described (Smalle et al., 2002
RT-PCR was performed with total RNA (1 µg) pretreated with RQ1 DNAse (Promega). First-strand cDNA synthesis followed the manufacturer's protocol (SuperScript II; Invitrogen) employing the gene-specific reverse primers for SAE1a (Fig. 2A) primer 5 (TACCGAAGGAAAATCACAACTGATCC) and primer 4 (TTTAGTTCGCATTCCACCATCTCT), for SUM1 (Fig. 4A; GATCCGATACCAAACGAACAAGAC), and for SUM2 (TGATTCACATAGACTTTCACCAGT) or those described by Downes et al. (2003)
To rescue the sum1-1 sum2-1 mutant, a plasmid encompassing a genomic fragment of SUM1 (from 979 bp upstream of the translation start site to 279 bp downstream of the stop codon) was PCR amplified from wild-type (Col-0) Arabidopsis chromosomal DNA using the primers 5'-CACCGGTTATTCTCGAGTGTATCTTCAGAAACAG and 3'-CAATAATTAATAGCTTTTTACCGTTACCATACCAACAAAC. The SUM1 product was recombined into the pENTR/TEV/D-TOPO vector (Invitrogen), verified as correct via dideoxy DNA sequencing, and then transferred into the plant transformation vector pMDC100 (Curtis and Grossniklaus, 2003
For seed production, plants were grown in a LD photoperiod (16 h light/8 h dark) at 23°C. Analysis of embryonic arrest was performed on developing seeds dissected from immature siliques. The seeds were fixed and cleared with Hoyer's solution (Gingerich et al., 2005
Arabidopsis nuclei were isolated from 7-d-old control or heat-shocked (30 min at 37°C) wild-type Col-0 plants by the Percoll gradient method as described (Folta and Kaufman, 2000
Anti-SAE1a and anti-SCE1 antisera were generated in rabbits using recombinant proteins expressed from the full-length coding regions. cDNAs were amplified using primers designed to contain 5' and 3' flanking NdeI and XhoI sites and cloned into pET28b(+) (EMD Biosciences) plasmids that were similarly digested. Following a 3-h induction with 1 mM isopropyl 1-thio-
The embryo lethality of the sae2-1, sce1-5, and sce1-6 mutants agrees with prior analysis of independent alleles for SAE2 and SCE1 presented in the SeedGenes database (http://www.seedgenes.org/; Tzafrir I, Dickerman A, Brazhnik O, Nguyen Q, McElver J, Frye C, Patton D, Meinke D [2003] The Arabidopsis SeedGenes Project. Nucleic Acids Res 31: 90–93).
We thank Benjamin Harrison and Dr. Patrick Masson for help with microscopy; Dr. Ray Bressan for the siz1-2 mutant; Drs. David Rancour and Sebastian Bednarek and Dr. Archie Portis for anti-PUX1 and Rubisco antibodies, respectively; and Reza Ahmadi, Neal Englert, and Robert Schmitz for technical assistance. Received May 11, 2007; accepted July 5, 2007; published July 20, 2007.
1 This work was supported by the National Science Foundation Arabidopsis 2010 Program (grant no. MCB–0115870 to R.D.V.) and a National Institutes of Health predoctoral training fellowship to the University of Wisconsin Genetics Training Program (to M.J.M.).
2 Present address: Department of Plant and Soil Sciences, University of Kentucky, KTRDC Room 104A, Cooper and University Drives, Lexington, KY 40546–0312. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Richard D. Vierstra (vierstra{at}wisc.edu).
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.102285 * Corresponding author; e-mail vierstra{at}wisc.edu.
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657 Andrews EA, Palecek J, Sergeant J, Taylor E, Lehmann AR, Watts FZ (2005) Nse2, a component of the Smc5-6 complex, is a SUMO ligase required for the response to DNA damage. Mol Cell Biol 25: 185–196 Bencsath KP, Podgorski MS, Pagala VR, Slaughter CA, Schulman BA (2002) Identification of a multifunctional binding site on Ubc9p required for Smt3p conjugation. J Biol Chem 277: 47938–47945 Bossis G, Melchior F (2006) SUMO: regulating the regulator. Cell Div 1: 13[CrossRef][Medline] Chosed R, Mukherjee S, Lois LM, Orth K (2006) Evolution of a signalling system that incorporates both redundancy and diversity: Arabidopsis SUMOylation. Biochem J 398: 521–529[CrossRef][Web of Science][Medline] Chosed R, Tomchick DR, Brautigam CA, Mukherjee S, Negi VS, Machius M, Orth K (2007) Structural analysis of Xanthomonas XopD provides insights into substrate specificity of ubiquitin-like protein proteases. J Biol Chem 282: 6773–6782 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline] Colby T, Matthai A, Boeckelmann A, Stuible HP (2006) SUMO-conjugating and SUMO-deconjugating enzymes from Arabidopsis. Plant Physiol 142: 318–332 Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133: 462–469 Desterro JM, Rodriguez MS, Hay RT (1998) SUMO-1 modification of IkappaBalpha inhibits NF-kappaB activation. Mol Cell 2: 233–239[CrossRef][Web of Science][Medline] Desterro JM, Rodriguez MS, Kemp GD, Hay RT (1999) Identification of the enzyme required for activation of the small ubiquitin-like protein SUMO-1. J Biol Chem 274: 10618–10624 Downes B, Vierstra RD (2005) Post-translational regulation in plants employing a diverse set of polypeptide tags. Biochem Soc Trans 33: 393–399[CrossRef][Web of Science][Medline] Downes BP, Saracco SA, Lee SS, Crowell DN, Vierstra RD (2006) MUBs, a family of ubiquitin-fold proteins that are plasma membrane-anchored by prenylation. J Biol Chem 281: 27145–27157 Downes BP, Stupar RM, Gingerich DJ, Vierstra RD (2003) The HECT ubiquitin-protein ligase (UPL) family in Arabidopsis: UPL3 has a specific role in trichome development. Plant J 35: 729–742[CrossRef][Web of Science][Medline] Dye BT, Schulman BA (2007) Structural mechanisms underlying posttranslational modification by ubiquitin-like proteins. Annu Rev Biophys Biomol Struct 36: 131–150[CrossRef][Medline] Epps JL, Tanda S (1998) The Drosophila semushi mutation blocks nuclear import of bicoid during embryogenesis. Curr Biol 8: 1277–1280[CrossRef][Web of Science][Medline] Folta KM, Kaufman LS (2000) Preparation of transcriptionally active nuclei from etiolated Arabidopsis thaliana. Plant Cell Rep 19: 504–510[CrossRef][Web of Science] Fu H, Doelling JH, Arendt CS, Hochstrasser M, Vierstra RD (1998) Molecular organization of the 20S proteasome gene family from Arabidopsis thaliana. Genetics 149: 677–692 Giaever G, Chu AM, Ni L, Connelly C, Riles L, Véronneau S, Dow S, Lucau-Danila A, Anderson K, André B, et al (2002) Functional profiling of the Saccharomyces cerevisiae genome. Nature 418: 387–391[CrossRef][Medline] Gingerich DJ, Gagne JM, Salter DW, Hellmann H, Estelle M, Ma L, Vierstra RD (2005) Cullins 3a and 3b assemble with members of the broad complex/tramtrack/bric-a-brac (BTB) protein family to form essential ubiquitin-protein ligases (E3s) in Arabidopsis. J Biol Chem 280: 18810–18821 Hanania U, Furman-Matarasso N, Ron M, Avni A (1999) Isolation of a novel SUMO protein from tomato that suppresses EIX-induced cell death. Plant J 19: 533–541[CrossRef][Web of Science][Medline] Hannich JT, Lewis A, Kroetz MB, Li SJ, Heide H, Emili A, Hochstrasser M (2005) Defining the SUMO-modified proteome by multiple approaches in Saccharomyces cerevisiae. J Biol Chem 280: 4102–4110 Hay RT (2005) SUMO: a history of modification. Mol Cell 18: 1–12[CrossRef][Web of Science][Medline] Hayashi T, Seki M, Maeda D, Wang W, Kawabe Y, Seki T, Saitoh H, Fukagawa T, Yagi H, Enomoto T (2002) Ubc9 is essential for viability of higher eukaryotic cells. Exp Cell Res 280: 212–221[CrossRef][Web of Science][Medline] Ho JC, Warr NJ, Shimizu H, Watts FZ (2001) SUMO modification of Rad22, the Schizosaccharomyces pombe homologue of the recombination protein Rad52. Nucleic Acids Res 29: 4179–4186 Hoege C, Pfander B, Moldovan GL, Pyrowolakis G, Jentsch S (2002) RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419: 135–141[CrossRef][Medline] Hong Y, Rogers R, Matunis MJ, Mayhew CN, Goodson ML, Park-Sarge OK, Sarge KD (2001) Regulation of heat shock transcription factor 1 by stress-induced SUMO-1 modification. J Biol Chem 276: 40263–40267 Hotson A, Chosed R, Shu H, Orth K, Mudgett MB (2003) Xanthomonas type III effector XopD targets SUMO-conjugated proteins in planta. Mol Microbiol 50: 377–389[CrossRef][Web of Science][Medline] Huang TT, Wuerzberger-Davis SM, Wu ZH, Miyamoto S (2003) Sequential modification of NEMO/IKKgamma by SUMO-1 and ubiquitin mediates NF-kappaB activation by genotoxic stress. Cell 115: 565–576[CrossRef][Web of Science][Medline] Huh WK, Falvo JV, Gerke LC, Carroll AS, Howson RW, Weissman JS, O'Shea EK (2003) Global analysis of protein localization in budding yeast. Nature 425: 686–691[CrossRef][Medline] Johnson ES (2004) Protein modification by SUMO. Annu Rev Biochem 73: 355–382[CrossRef][Web of Science][Medline] Johnson ES, Blobel G (1997) Ubc9p is the conjugating enzyme for the ubiquitin-like protein Smt3p. J Biol Chem 272: 26799–26802 Johnson ES, Blobel G (1999) Cell cycle-regulated attachment of the ubiquitin-related protein SUMO to the yeast septins. J Cell Biol 147: 981–994 Johnson ES, Gupta AA (2001) An E3-like factor that promotes SUMO conjugation to the yeast septins. Cell 106: 735–744[CrossRef][Web of Science][Medline] Johnson ES, Schwienhorst I, Dohmen RJ, Blobel G (1997) The ubiquitin-like protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J 16: 5509–5519[CrossRef][Web of Science][Medline] Jones D, Crowe E, Stevens TA, Candido EP (2002) Functional and phylogenetic analysis of the ubiquitylation system in Caenorhabditis elegans: ubiquitin-conjugating enzymes, ubiquitin-activating enzymes, and ubiquitin-like proteins. Genome Biol 3: RESEARCH0002[Medline] Kagey MH, Melhuish TA, Wotton D (2003) The polycomb protein Pc2 is a SUMO E3. Cell 113: 127–137[CrossRef][Web of Science][Medline] Kim KI, Baek SH, Jeon YJ, Nishimori S, Suzuki T, Uchida S, Shimbara N, Saitoh H, Tanaka K, Chung CH (2000) A new SUMO-1-specific protease, SUSP1, that is highly expressed in reproductive organs. J Biol Chem 275: 14102–14106 Kirsh O, Seeler JS, Pichler A, Gast A, Muller S, Miska E, Mathieu M, Harel-Bellan A, Kouzarides T, Melchior F, et al (2002) The SUMO E3 ligase RanBP2 promotes modification of the HDAC4 deacetylase. EMBO J 21: 2682–2691[CrossRef][Web of Science][Medline] Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant Cell 11: 2283–2290 Kurepa J, Walker JM, Smalle J, Gosink MM, Davis SJ, Durham TL, Sung DY, Vierstra RD (2003) The small ubiquitin-like modifier (SUMO) protein modification system in Arabidopsis. Accumulation of SUMO1 and -2 conjugates is increased by stress. J Biol Chem 278: 6862–6872 Lee J, Nam J, Park HC, Na G, Miura K, Jin JB, Yoo CY, Baek D, Kim DH, Jeong JC, et al (2007) Salicylic acid-mediated innate immunity in Arabidopsis is regulated by SIZ1 SUMO E3 ligase. Plant J 49: 79–90[CrossRef][Web of Science][Medline] Lehembre F, Badenhorst P, Muller S, Travers A, Schweisguth F, Dejean A (2000) Covalent modification of the transcriptional repressor tramtrack by the ubiquitin-related protein Smt3 in Drosophila flies. Mol Cell Biol 20: 1072–1082 Lois LM, Lima CD, Chua NH (2003) Small ubiquitin-like modifier modulates abscisic acid signaling in Arabidopsis. Plant Cell 15: 1347–1359 Mahajan R, Gerace L, Melchior F (1998) Molecular characterization of the SUMO-1 modification of RanGAP1 and its role in nuclear envelope association. J Cell Biol 140: 259–270 Matunis MJ, Wu J, Blobel G (1998) SUMO-1 modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex. J Cell Biol 140: 499–509 Melchior F (2000) SUMO—nonclassical ubiquitin. Annu Rev Cell Dev Biol 16: 591–626[CrossRef][Web of Science][Medline] Meluh PB, Koshland D (1995) Evidence that the MIF2 gene of Saccharomyces cerevisiae encodes a centromere protein with homology to the mammalian centromere protein CENP-C. Mol Biol Cell 6: 793–807[Abstract] Miura K, Rus A, Sharkhuu A, Yokoi S, Karthikeyan AS, Raghothama KG, Baek D, Koo YD, Jin JB, Bressan RA, et al (2005) The Arabidopsis SUMO E3 ligase SIZ1 controls phosphate deficiency responses. Proc Natl Acad Sci USA 102: 7760–7765 Miura K, Jin JB, Lee J, Yoo CY, Stirm V, Miura T, Ashworth EN, Bressan RA, Yun DJ, Hasegawa PM (2007) SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis. Plant Cell 19: 1403–1414 Mukherjee S, Keitany G, Li Y, Wang Y, Ball HL, Goldsmith EJ, Orth K (2006) Yersinia YopJ acetylates and inhibits kinase activation by blocking phosphorylation. Science 312: 1211–1214 Murtas G, Reeves PH, Fu YF, Bancroft I, Dean C, Coupland G (2003) A nuclear protease required for flowering-time regulation in Arabidopsis reduces the abundance of SMALL UBIQUITIN-RELATED MODIFIER conjugates. Plant Cell 15: 2308–2319 Nacerddine K, Lehembre F, Bhaumik M, Artus J, Cohen-Tannoudji M, Babinet C, Pandolfi PP, Dejean A (2005) The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice. Dev Cell 9: 769–779[CrossRef][Web of Science][Medline] Nowak M, Hammerschmidt M (2006) Ubc9 regulates mitosis and cell survival during zebrafish development. Mol Biol Cell 17: 5324–5336 Okuma T, Honda R, Ichikawa G, Tsumagari N, Yasuda H (1999) In vitro SUMO-1 modification requires two enzymatic steps, E1 and E2. Biochem Biophys Res Commun 254: 693–698[CrossRef][Web of Science][Medline] Orth K, Xu Z, Mudgett MB, Bao ZQ, Palmer LE, Bliska JB, Mangel WF, Staskawicz B, Dixon JE (2000) Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease. Science 290: 1594–1597 Panse VG, Hardeland U, Werner T, Kuster B, Hurt E (2004) A proteome-wide approach identifies sumoylated substrate proteins in yeast. J Biol Chem 279: 41346–41351 Pichler A, Knipscheer P, Saitoh H, Sixma TK, Melchior F (2004) The RanBP2 SUMO E3 ligase is neither HECT- nor RING-type. Nat Struct Mol Biol 11: 984–991[CrossRef][Web of Science][Medline] Przemeck GK, Mattsson J, Hardtke CS, Sung ZR, Berleth T (1996) Studies on the role of the Arabidopsis gene MONOPTEROS in vascular development and plant cell axialization. Planta 200: 229–237[Web of Science][Medline] Rancour DM, Park S, Knight SD, Bednarek SY (2004) Plant UBX domain-containing protein 1, PUX1, regulates the oligomeric structure and activity of Arabidopsis CDC48. J Biol Chem 279: 54264–54274 Roden J, Eardley L, Hotson A, Cao Y, Mudgett MB (2004) Characterization of the Xanthomonas AvrXv4 effector, a SUMO protease translocated into plant cells. Mol Plant Microbe Interact 17: 633–643[Web of Science][Medline] Rodriguez MS, Dargemont C, Hay RT (2001) SUMO-1 conjugation in vivo requires both a consensus modification motif and nuclear targeting. J Biol Chem 276: 12654–12659 Rose A, Meier I (2001) A domain unique to plant RanGAP is responsible for its targeting to the plant nuclear rim. Proc Natl Acad Sci USA 98: 15377–15382 Saitoh H, Hinchey J (2000) Functional heterogeneity of small ubiquitin-related protein modifiers SUMO-1 versus SUMO-2/3. J Biol Chem 275: 6252–6258 Sampson DA, Wang M, Matunis MJ (2001) The small ubiquitin-like modifier-1 (SUMO-1) consensus sequence mediates Ubc9 binding and is essential for SUMO-1 modification. J Biol Chem 276: 21664–21669 Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P, Bacwaden J, Ko C, et al (2002) A high-throughput Arabidopsis reverse genetics system. Plant Cell 14: 2985–2994 Seufert W, Futcher B, Jentsch S (1995) Role of a ubiquitin-conjugating enzyme in degradation of S- and M-phase cyclins. Nature 373: 78–81[CrossRef][Medline] Shayeghi M, Doe CL, Tavassoli M, Watts FZ (1997) Characterisation of Schizosaccharomyces pombe rad31, a UBA-related gene required for DNA damage tolerance. Nucleic Acids Res 25: 1162–1169 Smalle J, Kurepa J, Yang P, Babiychuk E, Kushnir S, Durski A, Vierstra RD (2002) Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14: 17–32 Smalle J, Vierstra RD (2004) The ubiquitin 26S proteasome proteolytic pathway. Annu Rev Plant Biol 55: 555–590[CrossRef][Medline] Sramko M, Markus J, Kabat J, Wolff L, Bies J (2006) Stress-induced inactivation of the c-Myb transcription factor through conjugation of SUMO-2/3 proteins. J Biol Chem 281: 40065–40075 Sunilkumar G, Mohr L, Lopata-Finch E, Emani C, Rathore KS (2002) Developmental and tissue-specific expression of CaMV 35S promoter in cotton as revealed by GFP. Plant Mol Biol 50: 463–474[CrossRef][Web of Science][Medline] Tanaka K, Nishide J, Okazaki K, Kato H, Niwa O, Nakagawa T, Matsuda H, Kawamukai M, Murakami Y (1999) Characterization of a fission yeast SUMO-1 homologue, pmt3p, required for multiple nuclear events, including the control of telomere length and chromosome segregation. Mol Cell Biol 19: 8660–8672 Tatham MH, Jaffray E, Vaughan OA, Desterro JM, Botting CH, Naismith JH, Hay RT (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem 276: 35368–35374 Vertegaal AC, Ogg SC, Jaffray E, Rodriguez MS, Hay RT, Andersen JS, Mann M, Lamond AI (2004) A proteomic study of SUMO-2 target proteins. J Biol Chem 279: 33791–33798 Wohlschlegel JA, Johnson ES, Reed SI, Yates JR III (2004) Global analysis of protein sumoylation in Saccharomyces cerevisiae. J Biol Chem 279: 45662–45668 Woody ST, Austin-Phillips S, Amasino RM, Krysan PJ (2007) The WiscDsLox T-DNA collection: an Arabidopsis community resource generated by using an improved high-throughput T-DNA sequencing pipeline. J Plant Res 120: 157–165[CrossRef][Web of Science][Medline] Yoo CY, Miura K, Jin JB, Lee J, Park HC, Salt DE, Yun DJ, Bressan RA, Hasegawa PM (2006) SIZ1 small ubiquitin-like modifier E3 ligase facilitates basal thermotolerance in Arabidopsis independent of salicylic acid. Plant Physiol 142: 1548–1558 Zhang H, Saitoh H, Matunis MJ (2002) Enzymes of the SUMO modification pathway localize to filaments of the nuclear pore complex. Mol Cell Biol 22: 6498–6508 Zhao Y, Kwon SW, Anselmo A, Kaur K, White MA (2004) Broad spectrum identification of cellular small ubiquitin-related modifier (SUMO) substrate proteins. J Biol Chem 279: 20999–21002 Zhou W, Ryan JJ, Zhou H (2004) Global analyses of sumoylated proteins in Saccharomyces cerevisiae. Induction of protein sumoylation by cellular stresses. J Biol Chem 279: 32262–32268 Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004) GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol 136: 2621–2632 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|