Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online July 13, 2007; 10.1104/pp.107.101691

Plant Physiology 145:147-159 (2007)
© 2007 American Society of Plant Biologists

OPEN ACCESS ARTICLE
This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrowOA All Versions of this Article:
145/1/147    most recent
pp.107.101691v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Devaiah, B. N.
Right arrow Articles by Raghothama, K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Devaiah, B. N.
Right arrow Articles by Raghothama, K. G.
Agricola
Right arrow Articles by Devaiah, B. N.
Right arrow Articles by Raghothama, K. G.
ENVIRONMENTAL STRESS AND ADAPTATION TO STRESS

Phosphate Homeostasis and Root Development in Arabidopsis Are Synchronized by the Zinc Finger Transcription Factor ZAT61,[W],[OA]

Ballachanda N. Devaiah, Vinay K. Nagarajan and Kashchandra G. Raghothama*

Department of Horticulture and Landscape Architecture, Purdue University, West Lafayette, Indiana 47907–1165


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Phosphorus availability is limited in many natural ecosystems. Plants adapt to phosphate (Pi) deficiency by complex molecular processes. There is growing evidence suggesting that transcription factors are key components in the regulation of these processes. In this study, we characterized the function of ZAT6 (zinc finger of Arabidopsis 6), a cysteine-2/histidine-2 zinc finger transcription factor that is responsive to Pi stress. ZAT6 is induced during Pi starvation and localizes to the nucleus. While the RNAi suppression of ZAT6 appeared to be lethal, its overexpression affects root development and retards seedling growth as a result of decreased Pi acquisition. The ZAT6 overexpression also resulted in altered root architecture of older plants, with consequent changes in Pi acquisition. These results indicate that ZAT6 regulates root development independent of the Pi status of the plant, thereby influencing Pi acquisition and homeostasis. In addition, the expression of several Pi starvation-responsive genes was decreased in ZAT6 overexpressing plants, thereby confirming the role of ZAT6 in regulating Pi homeostasis. This study thus indicates that ZAT6 is a repressor of primary root growth and regulates Pi homeostasis through the control of root architecture. To our knowledge, ZAT6 is the first cysteine-2/histidine-2 zinc finger transcription factor reported to regulate root development and nutrient stress responses.


Phosphate (Pi) is a vital nutrient required for numerous metabolic and developmental processes in plants. However, its availability in most soils is limited as it is fixed in mineral or organic forms that are unavailable to the plant (Marschner, 1995Go). Pi starvation results in adaptive morphological modifications such as altered root architecture that helps the plant to explore greater soil volumes for Pi acquisition (López-Bucio et al., 2003Go). Physiological modifications such as elevated phosphatase activity (Lipton et al., 1987Go) and secretion of organic acids (Marschner, 1995Go) also help the plant to mobilize more Pi. Plants have evolved many adaptive mechanisms to alleviate Pi starvation-induced stress and to improve their ability to mobilize, acquire, and utilize Pi (Raghothama and Karthikeyan, 2005Go). Information regarding the regulatory mechanisms controlling these adaptations could thus aid in better understanding of plant responses to Pi starvation. Consequently, potential regulatory mechanisms, such as microRNAs (miR399; Bari et al., 2006Go; Chiou et al., 2006Go), posttranslational regulators (PHOSPHATE TRANSPORTER TRAFFIC FACILITATOR1 [PHF1]; González et al., 2005Go; SUMO E3 ligase [SIZ1]; Miura et al., 2005Go), and transcription factors (Franco-Zorilla et al., 2004Go; Devaiah et al., 2007Go) involved in controlling Pi stress responses are being investigated. A transcriptional regulatory model for the Pi starvation responses in plants has therefore been proposed on the basis of microarray analysis (Hammond et al., 2004Go). The spatiotemporal regulation of transcription factors responsive to Pi starvation has also been described by microarray analysis in rice (Oryza sativa) and Arabidopsis (Arabidopsis thaliana; Wasaki et al., 2003Go; Wu et al., 2003Go; Misson et al., 2005Go). In addition, several transcription factors involved in the regulation of Pi stress responses have been discovered and characterized during the past few years. PHR1, a Myb transcription factor in Arabidopsis (Rubio et al., 2001Go), and OsPTF1, a bHLH transcription factor in rice (Yi et al., 2005Go), have been implicated in the regulation of Pi starvation responses. Using microarray analysis, we have previously identified a range of Pi stress-responsive genes, including transcription factors, in Arabidopsis (Misson et al., 2005Go). Based on this information, we recently characterized WRKY75, a Pi starvation-responsive transcription factor involved in modulating Pi acquisition and root development in Arabidopsis (Devaiah et al., 2007Go). Microarray analysis also revealed that ZAT6, a Cys-2/His-2 (C2H2) zinc finger transcription factor (At5g04340), was strongly induced during Pi deprivation.

The C2H2-type zinc finger proteins (ZFPs), also called the TFIIIA-type zinc finger, represent a large family of eukaryotic transcription factors. In Arabidopsis, a total of 176 proteins that contain one or more zinc finger domains have been reported, thus making ZFPs one of the largest family of putative transcriptional regulators (Englbrecht et al., 2004Go). Members of the ZFP family have been implicated in a variety of processes such as the regulation of floral organogenesis, leaf initiation, lateral shoot initiation, gametogenesis, and stress responses (for review, see Englbrecht et al., 2004Go). ZAT6 (zinc finger of Arabidopsis 6) was identified during the isolation and characterization of a diverse family of Arabidopsis two- and three-fingered C2H2 ZFPs (Meissner and Michael, 1997Go). ZAT6 has been recently classified as part of the 20 member C1-2i subclass of C2H2 ZFPs in Arabidopsis (Englbrecht et al., 2004Go). C1 refers to ZFPs that do not have tandem arrays of zinc fingers, where the two invariant zinc coordinating His residues are separated by three amino acids. The presence of two zinc fingers is indicated by the notation 2i. Several members of this subclass have been shown to be involved in water stress (Sakamoto et al., 2000Go). Other well-characterized members include RHL41/ZAT12, which mediates light acclimatization responses (Iida et al., 2000Go) and STZ/ZAT10, which is involved in regulating salt, osmotic, drought, and cold stress responses (Mittler et al., 2006Go). It is believed that ZAT6 and ZAT10 are closely related, as both have the dehydration-responsive element cis-acting element on their promoters and are therefore considered downstream targets of the stress-responsive transcription factor DREB1A/CBF3 (Nakashima and Yamaguchi-Shinozaki, 2006Go). A previous study termed ZAT6 as CZF2 (cold-induced ZFP 2) based on its induction during cold and osmotic stress (Vogel et al., 2005Go). However, in the same study, a microarray analysis of cold stress-induced genes in CZF2 overexpressing plants revealed that CZF2 might not be involved in regulating cold stress responses. A microarray analysis of jasmonic acid and ethylene-induced genes also suggested that phytohormones might regulate ZAT6 (Glazebrook et al., 2003Go). The ZAT6 protein has also been empirically demonstrated to bind to POS9, a positive regulatory element on the promoter of the Arabidopsis ovule development gene INNER NO OUTER (Meister et al., 2004Go). A microarray analysis of genes with unstable transcripts in Arabidopsis also indicated that ZAT6 might be an Arabidopsis gene with unstable transcript (AtGUT) that could be induced by touch (Gutiérrez et al., 2002Go). The multitude of preliminary reports suggests a potential role for ZAT6 in various biological processes in plants, thus necessitating a systematic characterization of its function.

In this study, the function of ZAT6 was investigated and its characterization as a regulator of root development and Pi homeostasis is reported. We demonstrate that ZAT6 is responsive to Pi stress and is nuclear localized. Suppression of ZAT6 through RNAi-mediated silencing resulted in lethality. On the other hand, overexpression of ZAT6 resulted in retarded root growth, which impaired Pi acquisition and seedling growth during early stages of seedling development. The inhibition of primary root growth persisted as the ZAT6 overexpressing (ZOe) seedlings grew older. However, the emergence and growth of significantly longer lateral roots caused alterations in root architecture leading to a larger root-to-shoot ratio in older ZOe seedlings. In addition, the overexpression of ZAT6 also suppressed the expression of several Pi stress-responsive genes, suggesting its influence on multiple facets of Pi homeostasis. These results indicate that ZAT6 is a repressor of primary root growth that regulates Pi homeostasis by controlling the root architecture independent of the Pi status of the plant.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

ZAT6 Is a Pi Stress-Responsive Transcription Factor

To find if ZAT6 was responsive to Pi starvation, the relative abundance of its transcripts in mature plants as well as young seedlings grown under Pi-sufficient (P+) or Pi-deficient (P–) conditions was evaluated (Fig. 1A ). During Pi deprivation there was an increase in the abundance of ZAT6 transcripts to varying levels in different parts of mature plants, highlighting the spatial regulation of ZAT6 by Pi. A similar but larger increase in expression during P– conditions was observed in young seedlings. The differential pattern of expression in young and mature seedlings suggests a broader role for ZAT6 in plant growth. When Pi-deprived plants were transferred into medium with sufficient Pi, a rapid suppression in the elevated ZAT6 transcripts was observed within 3 h (Fig. 1B). Further, the effect of Phosphite (Phi) on the ZAT6 transcript abundance was also evaluated (Fig. 1C). Phi is an analog of Pi that is known to specifically suppress genes involved in Pi starvation responses (Varadarajan et al., 2002Go). The expression of ZAT6 during P– conditions was also suppressed by Phi. These results suggest that ZAT6 is a rapidly regulated Pi stress-responsive gene.


Figure 1
View larger version (73K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. ZAT6 is responsive to Pi deprivation. A, RNA-blot analysis of ZAT6 gene expression. Arabidopsis plants were grown either hydroponically or in liquid culture conditions for 7 d and then transferred to medium containing Pi (P+) or lacking Pi (P–), where they were grown for an additional 7 d. Roots, rosette leaves, and flowers were collected from mature plants grown hydroponically while roots and shoots were collected from young seedlings grown in liquid culture. The expression of ZAT6 in these samples was detected through RNA-blot analysis as described below. An elongation factor (EF1{alpha}) gene probe was used as a loading control. B, Decrease in ZAT6 transcripts as Pi-deprived plants are replenished with Pi. Plants that were Pi deprived for 7 d were moved into P+ media. The expression of ZAT6 was monitored at 0 h, 30 m, 1, 2, 3, 6, 12 h, 1, and 2 d by collecting the plant tissue at these time points and using them for RNA-blot analysis. EtBr-stained ribosomal RNA prior to transfer is shown to indicate loading and integrity of the RNA. C, ZAT6 expression is suppressed by Phi, an analog of Pi, during Pi deprivation. Plants were grown in liquid culture conditions under P+ and P– regimes with or without 3 mM Phi for 7 d before they were harvested for RNA-blot analysis. EtBr-stained ribosomal RNA prior to transfer is shown to indicate loading and integrity of the RNA. For RNA-blot analysis 10 µg of total RNA from the samples was separated electrophoretically and blotted onto a nylon membrane that was then probed with a 32P-labeled ZAT6 cDNA.

 
To identify the subcellular localization of ZAT6, its coding region was fused with the 3' end of an ENHANCED GFP (EGFP) reporter gene. This was expressed constitutively under the control of a cauliflower mosaic virus (CaMV) 35S promoter. The EGFP gene alone under the control of the CaMV 35S promoter served as a control. Transgenic Arabidopsis plants expressing the control EGFP gene and the chimeric ZAT6::GFP gene were analyzed under both P+ and P– conditions. In the control transgenic plant, GFP fluorescence was uniformly distributed all over the cell, while in the plants with the ZAT6-GFP protein, fluorescence was localized in the nucleus (Fig. 2A ). The nuclear localization of the ZAT6-GFP protein was confirmed through the colocalization of the nuclear-specific dye 4',6-diamidino-2-phenylindole (DAPI) in these cells (Supplemental Fig. S1). The ZAT6-GFP fusion protein was localized to the nucleus irrespective of the Pi regimen under which the plants were grown. The deduced amino acid sequence of ZAT6 revealed the presence of two C2H2 zinc finger motifs with plant-specific QALGGH sequences (Fig. 2B, underlined in red). In addition, three other conserved domains were also identified. These included a B box (highlighted green) representing a nuclear localization signal, an L box (highlighted gray), and a repressor domain DLN box (highlighted yellow). Together, these data show that ZAT6 is a nuclear-localized Pi starvation-responsive transcription factor that may function as a transcriptional repressor.


Figure 2
View larger version (97K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Subcellular localization of ZAT6 and the effects of its altered expression. A, Nuclear localization of a GFP::ZAT6 fusion protein. The sections show microscopic images of root cells from Arabidopsis plants transformed with a control gene 35S::GFP (left section) or a 35S::GFP::ZAT6 fusion gene (right section). These results were observed under both P+ and P– conditions. B, Deduced amino acid sequence of ZAT6. The nuclear localization signal represented by the B box is highlighted in green. The two highly conserved C2H2 zinc finger domains are denoted by red underlined letters. The L box and DLN box are highlighted in gray and yellow, respectively. C, Nongerminating seeds of two representative ZAT6 RNAi transgenic lines in comparison to wild-type (WT) seeds 7 d after sowing. D, Phenotype of ZOe and ZAT6::GFP overexpressing (ZFP) plants relative to wild type (WT). Plants were germinated and grown on soil for 3 weeks. E, Comparative image of wild type (WT), ZOe, and ZAT6::GFP overexpressing (ZFP) plants 5 dpg on 0.5x Murashige and Skoog medium. F, Increased anthocyanin content in young ZOe seedlings. Anthocyanin content was determined in wild type (WT), ZOe, and ZAT6::GFP overexpressing (ZFP) plants 3 dpg. Values are mean ± SE (n = 6) and different letters above the bars indicate that the means are statistically different (P < 0.05). G, In vivo APase staining of wild-type (WT) and ZOe roots 5 dpg. The dark blue-stained ZOe roots indicate increased APA.

 

RNAi-Mediated Silencing of ZAT6 Could Be Lethal

Our attempts to identify a T-DNA insertion mutant for ZAT6 were unsuccessful. Therefore, to characterize the role of ZAT6 during Pi starvation, RNAi mutant plants harboring inverted repeats of a ZAT6 cDNA fragment under the control of the CaMV 35S promoter were generated. Although we were able to generate a T0 transgenic population and confirm the presence of inverted repeats of the ZAT6 cDNA fragment through PCR, the seeds from this population failed to germinate. Seeds from 10 independent T0 putative RNAi lines and a wild-type line grown on the same soil flat in the greenhouse were germinated on 0.5x Murashige and Skoog medium (Fig. 2C). The seeds from almost all the RNAi lines failed to germinate, in contrast to the normal germination of the wild-type seeds. The few putative ZAT6 RNAi seed lines that germinated were found to have no suppression of ZAT6 expression upon reverse transcription-PCR analysis (data not shown). These results suggest that the RNAi-mediated suppression of ZAT6 could be lethal to the plant.


Overexpression of ZAT6 Retards Seedling Development and Causes Anthocyanin Accumulation

We were unable to pursue any further experiments with the putative ZAT6 RNAi lines because of a nongerminating phenotype. Therefore, gain-of-function plants, which overexpressed ZAT6, were generated as an alternate tool to find the role of ZAT6 during Pi starvation stress. Transgenic plants with the full-length ZAT6 cDNA under the control of a CaMV 35S promoter were developed and six independent transgenic lines were screened through RNA-blot analysis (data not shown). A representative transgenic line with strong ZAT6 expression was selected from among these lines for all further experiments. The correct localization of overexpressed proteins are sometimes viewed with suspicion. Therefore, the transgenic line generated earlier with a ZAT6-GFP fusion protein under the control of the same CaMV 35S promoter was used as an internal control for several crucial experiments involving ZOe lines. The ZOe and wild-type plants were germinated and grown on a peat-vermiculite mixture for 3 weeks under greenhouse conditions (Fig. 2D). The overexpression of ZAT6 resulted in a distinct phenotype of smaller plants with fewer leaves as compared to the robust wild-type plants. A strong basal expression of ZAT6 was observed earlier in seedlings (Fig. 1A). Therefore, seeds of wild type and plants overexpressing ZAT6 alone, or the ZAT6-GFP fusion protein were germinated on 0.5x Murashige and Skoog medium (Fig. 2E). The seedlings overexpressing ZAT6 were found to have retarded growth with smaller primary roots compared to wild-type seedlings at 5 d post germination. One of the most striking symptoms of Pi starvation in plants is the accumulation of anthocyanin (Marschner, 1995Go). Since the hypocotyls of the transgenic seedlings were purple in color, the anthocyanin content in the ZOe seedlings and wild-type seedlings was quantified at 5 d postgermination (dpg; Fig. 2F). The results indicated that while wild-type seedlings had little or no anthocyanin, the anthocyanin content in the ZOe seedlings was drastically increased. Another characteristic symptom of Pi starvation in plants is the increased secretion of extracellular acid phosphatases (APases) from roots to mobilize more Pi (for review, see Abel et al., 2002Go). To detect changes in the extracellular APases, the roots of the wild-type and ZOe seedlings were coated with a layer of the APase stain 5-bromo-4-chloro-3-indolyl Pi (BCIP; Trull and Deikman, 1998Go) mixed with agarose at 3 dpg. APases cleave the substrate BCIP to produce a blue precipitate and the intensity of blue color indicates the amount of APases on the root surface. The intensity of blue color on the wild-type and ZOe roots was recorded after 48 h at 5 dpg (Fig. 2G). The results show the roots of the ZOe seedlings are stained dark blue while the staining of wild-type roots is much lighter. This indicates that the young ZOe seedlings secrete substantial amounts of APases compared to wild-type seedlings. Together, these results indicate that overexpressing ZAT6 retards growth and results in typical Pi starvation responses such as increased anthocyanin accumulation and APase secretion. This suggests that ZAT6 has an important role in regulating seedling development and Pi starvation responses.


Retarded Growth of ZOe Seedlings Is Correlated to a Decrease in Total Pi Content and Pi Uptake

Since seedlings overexpressing ZAT6 exhibited typical Pi starvation responses, the total Pi content in the shoots and roots of these seedlings was measured. Wild-type and ZOe seeds were germinated on 0.5x Murashige and Skoog medium and total Pi content in shoots and roots of the seedlings was quantified separately at 3, 5, 7, 9, 11, 14, and 18 dpg (Fig. 3 ). Total Pi was also quantified in seed lots of wild-type and ZOe plants that were grown under identical conditions in the same growing season. The results indicated that ZOe seedlings had significantly decreased total Pi content in both shoots (Fig. 3A) and roots (Fig. 3B), compared to wild-type seedlings until 7 dpg. However, after 7 dpg, there were no significant differences in total Pi content of either shoots or roots of the ZOe seedlings compared to the wild-type seedlings. No significant differences were observed in the total Pi content of the seeds of ZOe and wild-type plants either, indicating that the decrease in total Pi content of the young ZOe seedlings occurred postgermination. These results suggest that the retarded growth of young ZOe seedlings is correlated with a decrease in the total Pi content of these seedlings.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Total Pi content is decreased in ZOe seedlings during early stages of development. Total Pi content was estimated in wild-type (WT) and ZOe seeds as well as shoots and roots of seedlings grown on 0.5x Murashige and Skoog medium at 3, 5, 7, 9, 11, 14, and 18 dpg. Black ovals represent wild type and gray squares represent ZOe. Error bars represent SE (n = 3). A, Total Pi content in shoots. B, Total Pi content in roots.

 
The total Pi content in a plant is dependent on the uptake of Pi. Therefore, the uptake of Pi was measured in ZOe seedlings in comparison to wild-type seedlings. Two sets of wild-type and ZOe seedlings were grown on 0.5x Murashige and Skoog medium until 3 and 5 dpg, respectively. These seedlings were transferred into a Pi uptake solution containing 50 µM Pi supplemented with 33P, a radiotracer, and Pi uptake over a 2-h period was measured (Fig. 4 ). The results indicated that the Pi uptake was reduced in the ZOe seedlings in both 3-d-old (Fig. 4A) as well as 5-d-old (Fig. 4B) seedlings compared to wild-type seedlings. Together these results indicate that the retarded growth of seedlings overexpressing ZAT6 is correlated with a decrease in total Pi content caused by decreased uptake of Pi. These data implicates a role for ZAT6 in regulating the Pi uptake and Pi content in young plants.


Figure 4
View larger version (12K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Young ZOe seedlings have decreased Pi uptake. Pi uptake was monitored over a 2 h period in wild-type (WT; black ovals) and ZOe (gray squares) seedlings grown on 0.5x Murashige and Skoog medium 3 and 5 dpg. A, Pi uptake in seedlings 3 dpg. B, Pi uptake in seedlings 5 dpg. Error bars represent SE (n = 3).

 

Recovery of the ZOe Seedlings Is Concomitant with Increasing APase Activity and Soluble Pi Content

An increase in the production of extracellular and intracellular phosphatases to mobilize Pi is a distinct and universal response of higher plants to Pi starvation. Consequently, phosphatase activity has been used as a potential marker of the Pi status of plants (Ascencio, 1994Go). We observed an increased secretion of extracellular APases in young ZOe seedlings (Fig. 2G). Therefore, wild-type and ZOe seedlings were grown on 0.5x Murashige and Skoog medium and total APase activity (APA) was measured separately in the shoots and roots of these seedlings at 3, 5, 7, 9, 11, 14, and 18 dpg (Fig. 5, A and B ). The results indicated no change in APA in the shoots (Fig. 5A) but a significant increase in roots (Fig. 5B) of ZOe seedlings as compared to wild-type seedlings. However, the significant increase in APA in the ZOe roots was observed only until 7 dpg, after which the APA was similar in both ZOe and wild-type roots. These results suggest that the increase in root APA of the ZOe seedlings might be correlated to the gradual increase in total Pi content observed earlier (Fig. 3).


Figure 5
View larger version (21K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. The APA and soluble Pi content in ZOe seedlings is tightly correlated. APA and soluble Pi content was estimated in shoots and roots of wild-type (WT) and ZOe seedlings grown on 0.5x Murashige and Skoog medium at 3, 5, 7, 9, 11, 14, and 18 dpg. Black ovals represent wild type and gray squares represent ZOe. Error bars represent SE (n = 3). A, APA in shoots. B, APA in roots. C, Soluble Pi content in shoots. D, Soluble Pi content in roots.

 
The APA is considered to have an effect on the soluble Pi content of the plant. Considering the increase in root APA in ZOe seedlings, we estimated the soluble Pi content in the same samples used for APA estimation. No changes were observed in the soluble Pi content of the ZOe shoots as compared to the wild-type shoots (Fig. 5C). However, there was a significant increase in the soluble Pi content of the ZOe roots as compared to that of the wild type (Fig. 5D), which was concomitant with the increase in ZOe root APA (Fig. 5B). Together, these results suggest that the recovery of the ZOe seedlings from Pi starvation is likely to be aided by adaptive mechanisms involving increased APA and the consequent increase in soluble Pi content.


Increased Expression of ZAT6 Alters Root Architecture

The overexpression of ZAT6 resulted in retarded primary root growth of young seedlings causing changes in total Pi content and Pi uptake (Figs. 2–4GoGo). One of the adaptive responses to Pi starvation in Arabidopsis is the alteration of the root system architecture (RSA; López-Bucio et al., 2003Go; Jain et al., 2007Go). Therefore, the effect of ZAT6 overexpression on the RSA of older plants was investigated. We examined the RSA of 14-d-old wild-type and ZOe plants grown in vertically oriented agar plates under P+ and P– conditions for 7 d (Fig. 6 ). The results indicated drastic alterations in the RSA of ZOe plants as compared to the wild-type plants under both P+ and P– conditions (Fig. 6A). Pi deprivation resulted in a significant reduction of primary root growth in both the wild-type and ZOe plants, which is caused by Pi deficiency-induced progressive loss of meristematic cells and determinate growth in the primary root (Sánchez-Calderón et al., 2005Go). This result indicated that localized Pi deficiency-induced inhibition of primary root growth (Ticconi et al., 2004Go) is not influenced by the overexpression of ZAT6. However, there was a significant decrease in the primary root length of the ZOe plants under both P+ as well as P– conditions as compared to the wild-type plants (Fig. 6B). In addition, there was a significant increase in the length of the lateral roots (Fig. 6C), while the lateral root number decreased (Fig. 6D) in the ZOe plants under both P+ and P– conditions as compared to the wild-type plants. An estimation of the root-to-shoot ratio on a fresh weight basis showed that ZOe plants had a significantly larger root-to-shoot ratio than wild-type plants under both P+ and P– conditions (Fig. 6E). Together, the results suggest that ZAT6 plays an important role in root development by negatively regulating primary root growth while increasing the lateral root length and overall root-to-shoot ratio. The results also suggest that the regulation of root development by ZAT6 occur independent of the Pi status of the plant.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. ZAT6 overexpression alters root architecture. Wild-type (WT) and ZOe plants were grown under P+ and P– conditions for 7 d on vertically oriented petri plates. A, Lateral roots were spread to reveal the architectural details and scanned at 600 dpi. The seedlings shown are representative of 12 seedlings of the wild-type and ZOe plants grown under P+ and P– conditions. B to E show comparative histograms of wild type (white bars) and ZOe (black bars) with regard to various components of their root architecture under P+ or P– conditions. Different letters on the bars represent means that are statistically different (P < 0.05). Values are means ± SE (n = 12) of each genotype per treatment. B, Primary root length. C, Length of first order lateral roots. D, Total number of lateral roots per plant. E, Root/shoot ratio.

 

The Modified Root Architecture of ZOe Plants Results in Higher Pi Uptake and Accumulation

The changes in the RSA of older ZOe seedlings (Fig. 6) suggested that the Pi uptake in these plants might be different from the decreased Pi uptake observed in young seedlings (Fig. 4). Therefore, Pi uptake experiments were carried out in older plants with well-developed root architecture to find the effect of an altered RSA caused by the overexpression of ZAT6. Wild-type and ZOe plants were grown under P+ or P–. Ten-day-old seedlings were transferred into a Pi uptake solution containing 50 µM Pi supplemented with 33P, a radiotracer, and Pi uptake over a 2 h period was measured (Fig. 7 ). There was a significant increase in the Pi uptake of ZOe plants grown under both P+ (Fig. 7A) and P– (Fig. 7B) conditions compared to the wild-type plants. This was consistent with the increased root-to-shoot ratio observed in the ZOe plants under both P+ and P– conditions (Fig. 6E). These results illustrate that the changes in the RSA caused by the increased expression of ZAT6 have a direct bearing on the Pi uptake of the plant.


Figure 7
View larger version (12K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. Pi uptake is increased in older ZOe seedlings. Wild-type (WT; black ovals) and ZOe (gray squares) seedlings were grown on 0.5x Murashige and Skoog medium for 7 d and then transferred as groups of 10 seedlings into P+ or P– medium for 3 d. The Pi uptake of these 10-d-old seedlings was monitored over a 2 h period. A, Pi uptake in plants from P+ conditions. B, Pi uptake in plants from Pi-deficient conditions. Error bars represent SE (n = 3).

 
To further analyze the effect of increased root surface area in the ZOe plants, total P concentration was estimated in the shoots and roots of 14-d-old plants. Seven-day-old wild-type and ZOe plants were transferred to Murashige and Skoog medium containing sufficient Pi (1 mM; P+) or no Pi (P–). Plants overexpressing the ZFP were also grown under similar conditions as an internal control. The total Pi was estimated in the shoots and roots of these plants after 7 d of treatment (Fig. 8 ). A significant increase (P < 0.05) in the total Pi concentration was observed in the shoots and the roots of the ZOe and ZFP plants as compared to the wild-type plants under both P+ and P– conditions. However, relative to the ZOe plants, the increase in total P concentration in the ZFP plants was significantly lower. Together, these results suggest that the increased root surface area of older ZOe plants may help them increase their Pi uptake and accumulation.


Figure 8
View larger version (17K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 8. Total Pi content is increased in 14-d-old ZOe seedlings. Wild-type (WT) and ZOe plants were grown on 0.5x Murashige and Skoog medium for 7 d and then transferred to P+ and P– medium for 7 d. Total Pi concentration in shoots (black bars) and roots (white bars) was estimated. Error bars indicate SE (n = 3) and different letters above the bars represent means that are statistically different (P < 0.05).

 

Expression of Pi Starvation-Induced Genes Is Reduced in ZOe Plants

Microarray analysis has shown an array of spatiotemporally regulated Pi starvation-responsive genes involved in maintaining Pi homeostasis (Misson et al., 2005Go). Therefore, an attempt was made to find the role of ZAT6, if any, in regulating these genes. The expression of some well-characterized Pi starvation induced (PSI) was evaluated in 14-d-old wild-type and ZOe plants grown under P+ and P– conditions for 7 d (Fig. 9 ). The comparative expression of these genes in the ZFP and wild-type plant was also evaluated in a similar experiment as additional confirmation (Fig. 9). The large increase in the ZAT6 transcripts in the overexpression lines confirmed the authenticity of the ZAT6 overexpression plants used in this study. Recent studies on at4, a loss-of-function mutant, revealed the role of At4, a member of the Mt4/TPSI1 gene family, in Pi distribution between the roots and shoots (Shin et al., 2006Go). We therefore evaluated the expression profile of At4 and AtIPS1, another member of the Mt4/TPSI1 gene family that is involved in cytokinin signaling during Pi starvation (Martín et al., 2000Go). We also evaluated the expression of AtPS2-1 and AtPS2-2, encoding two members of a phosphatase family specifically induced by Pi stress (K.G. Raghothama, unpublished data), which are orthologs of the LePS2 gene family from tomato (Solanum lycopersicum; Baldwin et al., 2001Go) as well as AtACP5, encoding an APase involved in Pi stress responses (del Pozo et al., 1999Go). Finally, we also evaluated the expression of Pht1;1 and Pht1;4, which encode high-affinity Pi transporters (Muchhal et al., 1996Go; Shin et al., 2004Go). The results indicated that the expression of all these PSI genes was reduced to varying degrees in the ZOe plants compared to the wild-type plants during Pi deprivation (Fig. 9). However, the transcripts of At4 and Pht1;1 were not reduced in the ZFP plants compared to the wild-type plants during Pi deprivation. This is in line with the smaller increase in the total Pi content observed in the ZFP plants (Fig. 8). These results reveal the effect of ZAT6 overexpression on an array of Pi deficiency-induced genes involved in Pi mobilization, translocation, and acquisition. Together, these findings suggest that ZAT6 regulates the expression of PSI genes through the modulation of internal Pi content by regulating the RSA.


Figure 9
View larger version (100K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 9. Expression of Pi starvation-induced genes in plants overexpressing ZAT6. Seven-day-old wild-type (WT), ZOe, and 35S::ZAT6::GFP expressing (ZFP) plants grown in liquid culture under P+ and P– conditions for 7 d were used for RNA extraction. Total RNA (10 µg) was electrophoretically separated, blotted onto a nylon membrane, and hybridized with a 32P-labeled ZAT6 probe. The membrane was stripped and subsequently rehybridized with probes corresponding to the following genes consecutively: At4, AtIPS1, AtPS2-1, AtPS2-2, AtACP5, Pht1;1, and Pht1;4. EF1{alpha} was used as the loading control. Ethidium bromide-stained rRNA prior to blotting demonstrates the RNA integrity.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Zinc finger transcription factors, which constitute the largest transcription factor family in Arabidopsis, regulate a broad range of biological processes during plant development and stress responses. They have been reported to be involved in floral organogenesis, leaf initiation, lateral shoot initiation, and gametogenesis (for review, see Englbrecht et al., 2004Go). In this study, we report the characterization of ZAT6 as a Pi stress-responsive gene that is involved in regulating root development and Pi homeostasis. We have empirically demonstrated that the regulation of root architecture by ZAT6 plays a major role in maintaining Pi homeostasis and the two biological processes are synchronized during the development of the plant. We also discuss how the two processes could be controlled in tandem by ZAT6.


ZAT6 Is a Vital Pi-Responsive Regulator of Pi Uptake and Early Seedling Development

The Pi starvation responsiveness of molecular determinants controlling Pi stress responses is a key to their regulatory function during Pi stress. In this study, we demonstrate that ZAT6, encoding a C2H2 zinc finger transcription factor, is induced in all the parts of the plant during Pi stress, suggesting its involvement in regulating Pi starvation responses (Fig. 1A). Based on preliminary results, earlier studies have suggested that ZAT6 could be induced during osmotic stress (Mittler et al., 2006Go). Therefore, it may be argued that the increased induction in young seedlings is the result of osmotic stress caused inadvertently by growing the seedlings under liquid culture conditions. However, this is unlikely considering that the expression of ZAT6 is completely quenched within 3 h of replenishing Pi in Pi-deprived seedlings grown under the same conditions (Fig. 1B). Phi, an analog of phosphorus, suppresses the expression of most known Pi stress-responsive genes (Varadarajan et al., 2002Go). The expression of ZAT6 is also suppressed by Phi (Fig. 1C). Thus, it is clear that that ZAT6 is a gene induced during Pi starvation that responds rapidly and specifically to the altered Pi status of plants. Interestingly, PHR1, a Myb transcription factor that has been reported to regulate a subset of Pi stress responses is not induced during Pi starvation (Rubio et al., 2001Go) while WRKY75, which regulates root development and Pi acquisition (Devaiah et al., 2007Go), has a pattern of induction similar to that of ZAT6. This suggests that ZAT6 and WRKY75 could be regulated by similar mechanisms during Pi stress. Like WRKY75, ZAT6 is also induced by other nutrient stresses besides Pi stress such as potassium, iron, and nitrogen stress (Supplemental Fig. S2). It is therefore possible that Pi stress responses may be regulated by multifunctional transcription factors such as ZAT6 and WRKY75, which might regulate a broad range of responses during different nutrient stresses, particularly in young seedlings. Nutrient stress-responsive transcription factors in yeast (Saccharomyces cerevisiae) have been reported to localize to the nucleus only during nutrient stress and thus regulate the expression of genes involved in adaptive mechanisms (O'Neill et al., 1996Go; Beck and Hall, 1999Go). However, ZAT6 was localized in the nucleus irrespective of the Pi regime under which the plant was grown (Fig. 2A). This pattern of localization is similar to all the three known plant transcription factors that regulate Pi stress responses, PHR1 (Rubio et al., 2001Go), OsPTF1 (Yi et al., 2005Go), and WRKY75 (Devaiah et al., 2007Go). It could be speculated that plants may have a different mode of transcriptional regulation during nutrient stresses. However, this notion needs to be confirmed by the use of native promoters to detect nuclear localization. It has been reported that all plant ZFPs with the DLN box, also called the EAR motif, function as transcriptional repressors (Ohta et al., 2001Go). It is particularly interesting to note the presence of a DLN box, defined by the consensus sequence L/FDLNL/F(X) P, on the deduced amino acid sequence of ZAT6 (Fig. 2B). Therefore, it is possible that ZAT6 could be functioning as a transcriptional repressor.

Numerous studies have demonstrated that the function of a gene could be defined by perturbing its expression. Therefore, we attempted to abolish the expression of ZAT6 through RNAi-mediated gene silencing that unfortunately resulted in nongerminating seeds (Fig. 2C). As our attempts to generate plants with suppressed ZAT6 expression were not successful, we generated plants that overexpressed ZAT6 under the control of a constitutive CaMV 35S promoter. The overexpression of ZAT6 had an inhibitory effect on young seedlings as they had smaller roots and grew slower (Fig. 2E). As a result of this inhibitory effect on root growth, increased anthocyanin accumulation, and APase secretion, as well as decreased Pi uptake and Pi content, was observed in very young seedlings (Figs. 2–4GoGo). This suggests that ZAT6 plays a vital role maintaining Pi homeostasis in young seedlings through its inhibitory influence on root growth. We speculate that ZAT6 could be tempering the rapid elongation of the primary root during early stages of seedling development and thereby influences nutrient uptake. The coordinated increase in APA and soluble Pi in recovering ZOe plants (Fig. 5) also suggests that ZAT6 may also influence other components of the Pi homeostasis machinery directly. We were unable to investigate the expression of ZAT6 or any other Pi starvation-induced genes in seedlings less than 7 d old. This was because wild-type control plants germinated on media lacking Pi demonstrated generic multiple stress responses, making the experiment technically challenging. Although the actual mode of regulation needs to be dissected by future studies, it is clear that ZAT6 plays an important role in early seedling development by controlling key components of the Pi homeostasis mechanism.


ZAT6 Controls Root Development and Pi Homeostasis

Low P availability can drastically alter the architecture of the Arabidopsis root system by promoting lateral root growth while causing the primary root growth to become determinate. Such root alterations are believed to increase the exploration of increased soil volumes in search of nutrient-rich patches (López-Bucio et al., 2003Go). Interestingly, the overexpression of ZAT6 caused significant changes in the root architecture of older seedlings. The primary root length of the ZOe plants was significantly decreased under both P+ and P– conditions (Fig. 6B). Decrease in primary root length is a phenomenon commonly observed during Pi stress due to the Pi deficiency-induced progressive loss of meristematic cells and consequent determinate growth in the primary root (Sánchez-Calderón et al., 2005Go). The increase in ZAT6 transcripts during Pi deprivation (Fig. 1A), coupled with the decrease in primary root length in ZOe seedlings grown under P+ conditions, leads us to the conclusion that ZAT6 has a role in regulating the mechanism by which the primary root growth becomes determinate during Pi stress. These results buttress the notion that ZAT6 is a transcriptional repressor of primary root growth. On the other hand, ZOe seedlings also demonstrate an increase in the lateral root length (Fig. 6C) compared to wild-type plants under both P+ and P– conditions. These characteristics are normally observed under P– conditions in wild-type plants. Phytohormones control most root system characteristics in angiosperms and auxins are believed to play an important role in Pi stress-induced alterations of lateral root development (López-Bucio et al., 2003Go). A decreased expression of ZAT6 in the auxin-resistant mutants aux1-7, axr1-3, axr2-1, and axr4-1 can be observed during Pi deprivation (Supplemental Fig. S3). Therefore, we speculate that ZAT6 is an intermediary Pi-responsive regulator of the changes in root architecture brought about by auxin. It is interesting to note that a similar increase in lateral root length was observed when the expression of WRKY75 was suppressed (Devaiah et al., 2007Go). Thus, in addition to the similar expression patterns of WRKY75 and ZAT6, they both appear to function as repressors of root development, suggesting that they may have mutually synergistic effects. However, a high basal level of induction suggests that WRKY75 could be controlling root development independent of Pi status, while in contrast, ZAT6 is tightly regulated by Pi in mature plants. The altered root architecture of ZOe plants results in an increased root-to-shoot ratio in older seedlings (Fig. 6E). An increase in the Pi uptake of mature ZOe seedlings was also observed under both P+ and P– conditions (Fig. 7), consequently leading to increased accumulation of total Pi in the plant (Fig. 8). These results are in contrast to the decreased Pi uptake and total Pi content observed in 3- and 5-d-old ZOe seedlings where lateral root initiation and growth is yet to occur. Therefore, we propose that the alterations in Pi homeostasis caused by ZAT6 overexpression in older plants are the result of its effect on lateral root growth.

The conserved cis-regulatory region to which ZAT6 binds to regulate the expression of target genes was identified by an earlier study and named POS9 (Meister et al., 2004Go). However, we could not detect the presence of the POS9 motif on the promoter sequences of any Pi stress-responsive genes. It is therefore surprising that a decrease in the expression of several PSI genes can be observed in the ZOe seedlings during Pi starvation (Fig. 9). This paradox could be explained by the presence of a hypothetical intracellular Pi-sensing mechanism that mediates the induction of PSI genes at the cellular level proposed earlier (Abel et al., 2002Go). The hypothetical intracellular Pi-sensing mechanism is believed to allow the induction of PSI genes only when the intracellular Pi content decreases below a threshold level. Since the ZOe seedlings accumulated significantly larger amounts of Pi even under P– conditions due to their increased root-to-shoot ratio and increased Pi uptake, it is possible that the PSI genes were suppressed by the hypothetical Pi-sensing mechanism. Further, the expression of At4 and Pht1;1, genes that are known to be very tightly regulated by Pi stress, was suppressed in the ZOe plants during Pi stress, but remained unaltered in the ZFP plants, which had a lower Pi content (Fig. 9). This adds credence to the notion that an intracellular Pi-sensing mechanism suppressing the expression of PSI genes is active in the ZOe plants.

In summary, our data provide evidence that ZAT6 is a Pi stress-responsive transcription factor that functions as a constitutive repressor of primary root growth. The presence of some ZAT6 transcripts during P+ condition in young seedlings suggests that it tempers root elongation in young seedlings. Its reduced expression as the plants grow older allows the primary root to elongate. However, during Pi stress in older plants, the expression of ZAT6 is induced. This leads to a decrease in the primary root growth, but increases the root-to-shoot ratio by promoting lateral root growth, thereby improving the ability of plants to acquire Pi in response to Pi deprivation. Therefore, the characterization of ZAT6 sheds new light on the current understanding regarding the regulation of root development during Pi starvation and the subsequent changes in Pi homeostasis. Besides this, the regulation of root architecture by ZAT6, coupled with its responsiveness to other major nutrient stresses, suggests an important role for ZAT6 in the regulation of multiple nutrient stresses. On the other hand, it also plays a vital role in young seedlings by regulating growth and Pi homeostasis depending on external Pi availability. The nongerminating phenotype of putative ZAT6 RNAi mutants suggests that this transcription factor is vital for the survival of plants. Therefore, it is likely that ZAT6 plays a very broad and important role in plant development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material and Growth Conditions

Arabidopsis (Arabidopsis thaliana) ecotype Columbia was used in this study. To meet the specific requirements of individual experiments, one of the following growth conditions was used.

Hydroponic Culture
Seeds were germinated in Premier ProMix PGX peat mix (Premier Horticulture). Plants were grown under greenhouse conditions under a 16-h-light/8-h-dark cycle at 1,000 µmol m–2 s–1 photosynthetically active radiation (PAR). Seedlings at the five to seven leaf stage were transferred to hydroponics after their roots were gently washed. After a recovery period of 7 d in 0.5x modified Hoagland solution, plants were transferred to hydroponic solutions containing 250 µM Pi (P+) or no Pi (P–) for 7 d before they were harvested (Devaiah et al., 2007Go).

Petri Dish Culture
Seeds were surface sterilized, stratified at 4°C, and germinated initially on 0.5x Murashige and Skoog medium. Seven-day-old seedlings were transferred to Murashige and Skoog medium modified according to Devaiah et al. (2007)Go and supplemented with 1% (w/v) agar and 1.5% (w/v) Suc. Treatments with P+ and P– medium were supplemented with 1 mM KH2PO4 or 0.5 mM K2SO4, respectively. The seedlings were grown under a 16-h-light/8-h-dark cycle at 22°C with 75 µmol m–2 s–1 PAR. The plates were inclined at a 65° angle to allow the roots to grow along the agar surface.

Liquid Culture
This method was used to generate material for all gene expression analysis. Surface-sterilized seeds were dispensed into conical flasks containing 0.5x strength Murashige and Skoog medium without agar. The seedlings were grown under a 16-h-light (125 µmol m–2 s–1 PAR)/8-h-dark cycle at 22°C with constant shaking (85 rpm). Seven-day-old seedlings were rinsed three times with distilled water and transferred into Murashige and Skoog liquid media with Pi (1 mM) or without Pi. Plants were grown for 7 d, harvested, blot dried, frozen immediately in liquid nitrogen, and stored at –70°C until being used for RNA extraction (Karthikeyan et al., 2002Go).


Plant Transformation

Arabidopsis plants were transformed with three different gene constructs using the floral dip method (Clough and Bent, 1998Go).

To generate the ZAT6 RNAi construct, a 258 bp fragment of the ZAT6 coding sequence that was unique to ZAT6 was amplified using the primers 5'GGACTAGTCCATGGGATTATCTTCTCCGATGCC3' and 5'CGGGATCCGGCGCGCCTGTCACAGACGCTACACTT3'. The amplified fragment was initially digested with NcoI and AscI and cloned in sense orientation into the binary double-stranded RNA vector pGSA1131 immediately after the CaMV 35S promoter to generate an intermediary vector. The same ZAT6 fragment was then digested with SpeI and BamHI and cloned in antisense orientation next to the GUS intron spacer region of the intermediary vector described above. The vector was sequenced to confirm the authenticity and correct orientation of the two cloned inserts. The pGSA1131 binary vector confers Basta resistance in planta.

The second construct was used to generate a GFP::ZAT6 translational fusion protein.

The full-length ZAT6 cDNA was amplified with the primers 5'TCCCCCGGGATGGCACTTGAAACTCTTACTTC3' and 5'CCCAAGCTTTTAGGGTTTCTCCGGGAAG3'. The amplified fragment was digested with SmaI and HindIII and cloned into the binary pEGAD expression vector with the EGFP as a N-terminal translational fusion. This construct and an empty vector control were stably transformed into Arabidopsis and transgenic seedlings were selected by spraying 50 µL L–1 Basta.

The vector construct for overexpressing ZAT6 was developed by modifying the pEGAD vector and cloning the ZAT6 cDNA into the modified vector. The sequence encoding EGFP was excised from pEGAD using AgeI and EcoRI enzymes. The 5' overhangs on the vector were end filled using DNA Polymerase1 (New England Biolabs) and ligated to form a new overexpression vector. The full-length ZAT6 cDNA was amplified using the same primers mentioned above. The amplified fragment was cloned just after the CaMV 35S promoter into the modified vector using the SmaI and HindIII restriction enzymes. This construct was transformed stably into Arabidopsis and transgenic seedlings selected as described above.


Visualization of GFP

Wide-field fluorescence imaging was done using a NIKON E800 compound microscope equipped with a SPOT RT-slider digital camera (Diagnostic Instruments) interfaced to a computer. GFP excitation was done with standard fluorescein isothiocyanate filters. Images of the roots were taken through fluorescein isothiocyanate filters under the 20x objective. To confirm the nuclear localization of ZAT6, roots from 35S::GFP::ZAT6 transgenic and wild-type control plants were stained with DAPI. They were fixed in Pi-buffered saline, pH 7.2, containing 4% (w/v) paraformaldehyde, 50 mM EDTA, and 100 mM NaCl for 1 h and then washed three times over 40 min with DAPI stain solution (100 mM Pi-buffered saline, 50 mM EDTA, and 1 µg mL–1 DAPI). The nuclear-specific dye DAPI colocalized with GFP fluorescence in the cells (Supplemental Fig. S2).


In Vivo APase Staining

In vivo APase staining was done using a modification of the method described earlier (Tomscha et al., 2004Go) as follows. Seedlings were germinated and grown on 0.5x Murashige and Skoog medium supplemented with 1% agar and 1.5% Suc for 3 d. The roots of these seedlings were layered with a thin layer of 0.05% agarose containing 0.008% BCIP. Blue color staining was recorded after 48 h, at 5 dpg.


RNA Gel-Blot Analysis

Total RNA was extracted from plant samples using the TRIzol reagent (Invitrogen). Ten micrograms of total RNA was electrophoretically separated in a denaturing formaldehyde agarose gel and blotted onto nylon membranes. The nylon membranes were hybridized overnight with 32P-labeled DNA probes at 42°C, washed stringently, and exposed to x-ray films.


Measurements of Roots and Root-to-Shoot Ratio

Seedlings were grown on petri dishes under P+ or P– conditions as described earlier. After 7 d of treatment, the primary root length, lateral root number, and lateral root lengths were measured. The roots from 12 individual plants of each line per treatment were spread out carefully with a fine brush, scanned at 600 dpi, and the different root traits were evaluated using the ImageJ program (Abramoff et al., 2004Go). For measuring root-to-shoot ratio, shoots from plants grown as described above were excised just below the hypocotyls. Shoots and roots from three plants of each genotype were pooled and treated as one biological sample. Samples were weighed and the root-to-shoot ratio was calculated by dividing the root fresh weight by shoot fresh weight. Values are the mean of seven replicates and the experiment was repeated twice.


Physiological Measurements

All physiological measurements were done with plant material raised through petri dish culture as described earlier.

Anthocyanin Estimation
About 100 mg of frozen ground tissue from each treatment and line was used for the quantification of anthocyanins as described by Lange et al. (1971)Go. The optical density was measured at A532 and A653. Subtraction of 0.24 A653 compensated for the small overlap in A532 by the chlorophylls. The concentration was determined by using the corrected absorbance and the molar extinction coefficient ({varepsilon}) of 38,000 L mol–1 cm–1 for anthocyanin.

Quantification of Total Pi
Total Pi concentration was quantified using a modification of the U.S. Environmental Protection Agency method 365.2. About 50 mg of fresh sample was taken in a preweighed vial and oven dried. After recording their dry weight, the samples were flamed to ash and dissolved in 100 µL of concentrated HCl. Ten microliters of this sample was diluted in 790 µL of water. To a reaction containing 800 µL of diluted sample, 200 µL of mixed reagent (4.8 mM NH4MoO4, 2.5 N H2SO4, and 35 mM of ascorbic acid) was added and incubated at 45°C for 20 min. Total Pi content was measured at A650 using appropriate standards and expressed as total Pi/mg tissue dry weight.

Quantification of Total APA
Total APase was measured as described earlier using the p-nitrophenyl phosphate hydrolysis assay (Richardson et al., 2001Go). Samples were extracted from about 30 mg of finely ground frozen tissue. The enzyme activity was measured at A405. Total protein was estimated separately using Bradford's reagent and the total APA expressed as milliunits/milligram protein.

Quantification of Soluble Pi
The samples extracted for the quantification of total APA were used for quantification of soluble Pi. Two-hundred microliters of the extracted sample was mixed with 600 µL of water. To this, 200 µL of mixed reagent (4.8 mM NH4MoO4, 2.5 N H2SO4, and 35 mM of ascorbic acid) was added and incubated at 45°C for 20 min. Soluble Pi content was measured at A650 using a standard curve and calculated as follows: value x dilution factor/1,000 = micromoles of soluble Pi. Total protein was estimated separately using Bradford's reagent and the total soluble Pi expressed as micromoles per milligram protein.

Pi Uptake Assay
Pi uptake assay was done using the method described earlier by Devaiah et al. (2007)Go. Briefly, wild-type and ZOe seedlings were grown in P+ or P– medium for 3 d. Groups of 10 seedlings were used as one biological sample. The roots of the seedlings were incubated in a pretreatment solution (5 mM MES and 0.1 mM CaCl2, pH 5.7) for 20 min before moving them into 2 mL of uptake solution (5 mM MES, 0.1 mM CaCl2, 50 µM KH2PO4, pH 5.7) containing [33P]orthophosphate (0.15 µCi/mL–1). Whole seedlings were moved into ice-cold desorption solution (5 mM MES, 0.1 mM CaCl2, and 1 mM KH2PO4, pH 5.7) at the end of 1 and 2 h, respectively. After two washes with fresh desorption solution for 45 min, the samples were blot dried, placed in preweighed scintillation vials, oven dried overnight at 65°C, and their dry weight recorded. Four milliliters of scintillation cocktail was added into each vial and radioactivity was measured with a scintillation counter (Beckman Coulter).

Statistical Analysis
Statistical significance between mean values was determined using Student's t-test or one-way ANOVA with posthoc analysis using Tukey's test. Different letters on the error bars of histograms were used to indicate means that were statistically different at P < 0.05.

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number NC_003076.


Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Colocalization of GFP::ZAT6 and the nuclear-specific dye, DAPI.
Supplemental Figure S2. ZAT6 expression during different nutrient stresses.
Supplemental Figure S3. ZAT6 expression in auxin-resistant mutants.


    ACKNOWLEDGMENTS
 
We would like to thank Mike Poling and Madhuvanthi Ramaiah for their valuable help in preparing and editing this manuscript. We also thank the Arabidopsis Resource Center at Ohio State University for providing the vectors used in this study.

Received April 30, 2007; accepted July 6, 2007; published July 13, 2007.


    FOOTNOTES
 
1 This work was supported by grants from the U.S. Department of Agriculture. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Kashchandra G. Raghothama (kraghoth{at}purdue.edu).

[W] The online version of this article contains Web-only data. Back

[OA] Open Access articles can be viewed online without a subscription. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.107.101691

* Corresponding author; e-mail kraghoth{at}purdue.edu.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Abel S, Ticconi AC, Delatorre CA (2002) Phosphate sensing in higher plants. Physiol Plant 115: 1–8[CrossRef][Medline]

Abramoff MD, Magelhaes PJ, Ram SJ (2004) Image processing with ImageJ. Biophotonics International 11: 36–42

Ascencio J (1994) Acid phosphatase as a diagnostic tool. Commun Soil Sci Plant Anal 25: 1553–1564[Web of Science]

Baldwin JC, Karthikeyan AS, Raghothama KG (2001) LEPS2, a phosphorus starvation-induced novel acid phosphatase from tomato. Plant Physiol 125: 728–737[Abstract/Free Full Text]

Bari R, Pant BD, Stitt M, Scheible W-R (2006) PHO2, microRNA399, and PHR1 define a phosphate-signaling pathway in plants. Plant Physiol 141: 988–999[Abstract/Free Full Text]

Beck T, Hall MN (1999) The TOR signaling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402: 689–692[CrossRef][Medline]

Chiou T-J, Aung K, Lin S-I, Wu C-C, Chiang S-F, Su C-L (2006) Regulation of phosphate homeostasis by microRNA in Arabidopsis. Plant Cell 18: 412–421[Abstract/Free Full Text]

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline]

del Pozo JC, Allona I, Rubio V, Leyva A, de la Peña A, Aragoncillo C, Paz-Ares J (1999) A type 5 acid phosphatase gene from Arabidopsis thaliana is induced by phosphate starvation and by some other types of phosphate mobilising/oxidative stress conditions. Plant J 19: 579–589[CrossRef][Web of Science][Medline]

Devaiah BN, Karthikeyan AS, Raghothama KG (2007) WRKY75 transcription factor is a modulator of phosphate acquisition and root development in Arabidopsis. Plant Physiol 143: 1789–1801[Abstract/Free Full Text]

Englbrecht CC, Schoof H, Böhm S (2004) Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. BMC Genomics 5: 39[CrossRef][Medline]

Franco-Zorilla JM, González E, Bustos R, Linhares F, Leyva A, Paz-Ares J (2004) The transcriptional control of plant responses to phosphate limitation. J Exp Bot 55: 285–293[Abstract/Free Full Text]

Glazebrook J, Chen W, Estes B, Chang H-S, Nawarth C, Métraux J-P, Zhu T, Katagiri F (2003) Topology of the network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. Plant J 34: 217–228[CrossRef][Web of Science][Medline]

González E, Solano R, Rubio V, Leyva A, Paz-Ares J (2005) PHOSPHATE TRANSPORTER TRAFFIC FACILITATOR1 is a plant-specific SEC12-related protein that enables the endoplasmic reticulum exit of a high-affinity phosphate transporter in Arabidopsis. Plant Cell 17: 3500–3512[Abstract/Free Full Text]

Gutiérrez RA, Ewing RM, Cherry JM, Green PJ (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay is associated with a group of touch- and specific clock-controlled genes. Proc Natl Acad Sci USA 99: 11513–11518[Abstract/Free Full Text]

Hammond JP, Broadley MR, White PJ (2004) Genetic responses to phosphorus deficiency. Ann Bot (Lond) 94: 323–332[Abstract/Free Full Text]

Iida A, Kazuoka T, Torikai S, Kikuchi H, Oeda K (2000) A zinc finger protein RHL41 mediates the light acclimation response in Arabidopsis. Plant J 24: 191–203[CrossRef][Web of Science][Medline]

Jain A, Poling MD, Karthikeyan AS, Blakeslee JJ, Peer WA, Titapiwatanakun B, Murphy AS, Raghothama KG (2007) Differential effects of sucrose and auxin on localized Pi-deficiency induced modulation of different traits of root system architecture in Arabidopsis. Plant Physiol 144: 232–247[Abstract/Free Full Text]

Karthikeyan AS, Varadarajan DK, Mukatira UT, D'Urzo MP, Damz B, Raghothama KG (2002) Regulated expression of Arabidopsis phosphate transporters. Plant Physiol 130: 221–233[Abstract/Free Full Text]

Lange H, Shropshire W Jr, Mohr H (1971) An analysis of phytochrome-mediated anthocyanin synthesis. Plant Physiol 47: 649–655[Abstract/Free Full Text]

Lipton DS, Lanchar RW, Blevins DG (1987) Citrate, malate and succinate concentration in exudates from P-sufficient and P-stressed Medicago sativa L. seedlings. Plant Physiol 85: 315–317[Abstract/Free Full Text]

López-Bucio J, Cruz-Ramírez A, Herrera-Estrella L (2003) The role of nutrient availability in regulating root architecture. Curr Opin Plant Biol 6: 280–287[CrossRef][Web of Science][Medline]

Marschner H (1995) Mineral Nutrition of Higher Plants. Academic Press, London

Martín AC, del Pozo JC, Iglesias J, Rubio V, Solano R, de La Peña A, Leyva A, Paz-Ares J (2000) Influence of cytokinins on the expression of phosphate starvation responsive genes in Arabidopsis. Plant J 24: 559–567[CrossRef][Web of Science][Medline]

Meissner R, Michael AJ (1997) Isolation and characterization of a diverse family of Arabidopsis two and three fingered protein genes and cDNAs. Plant Mol Biol 33: 615–624[CrossRef][Web of Science][Medline]

Meister RJ, Williams LA, Monfared MM, Gallagher TL, Kraft EA, Nelson CG, Gasser CS (2004) Definition and interactions of a positive regulatory element of the Arabidopsis INNER NO OUTER promoter. Plant J 37: 426–438[CrossRef][Web of Science][Medline]

Misson J, Raghothama KG, Jain A, Jouhet J, Block MA, Bligny R, Ortet P, Creff A, Somerville S, Rolland N, et al (2005) A genome-wide transcriptional analysis using Arabidopsis thaliana Affymetrix gene chips determined plant responses to phosphate deprivation. Proc Natl Acad Sci USA 102: 11934–11939[Abstract/Free Full Text]

Mittler R, Kim Y, Song L, Coutu J, Coutu A, Ciftci-Yilmaz S, Lee H, Stevenson B, Zhu J-J (2006) Gain- and loss-of-function mutations in Zat10 enhance the tolerance of plants to abiotic stress. FEBS Lett 580: 6537–6542[CrossRef][Web of Science][Medline]

Miura K, Rus A, Sharkhuu A, Yokoi S, Karthikeyan AS, Raghothama KG, Baek D, Koo YD, Jin JB, Bressan RA, et al (2005) The Arabidopsis SUMO E3 ligase SIZ1 controls phosphate deficiency responses. Proc Natl Acad Sci USA 102: 7760–7765[Abstract/Free Full Text]

Muchhal US, Pardo JM, Raghothama KG (1996) Phosphate transporters from the higher plant Arabidopsis thaliana. Proc Natl Acad Sci USA 93: 10519–10523[Abstract/Free Full Text]

Nakashima K, Yamaguchi-Shinozaki Y (2006) Regulons involved in osmotic stress-responsive and stress-responsive gene expression in plants. Physiol Plant 126: 62–71[CrossRef]

Ohta M, Matsui K, Hiratsu K, Shinshi H, Ohme-Takagi M (2001) Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. Plant Cell 13: 1959–1968[Abstract/Free Full Text]

O'Neill EM, Kaffman A, Jolly ER, Shea EK (1996) Regulation of PHO4 nuclear localization by the PHO80-PHO85 cyclin-CDK complex. Science 271: 209–212[Abstract]

Raghothama KG, Karthikeyan AS (2005) Phosphate acquisition. Plant Soil 274: 37–49[CrossRef][Web of Science]

Richardson AE, Hadobas PA, Hayes JE (2001) Extracellular secretion of Aspergillus phytase from Arabidopsis roots enables plants to obtain phosphorus from phytate. Plant J 25: 641–649[CrossRef][Web of Science][Medline]

Rubio V, Linhares F, Solano R, Martín AC, Iglesias J, Leyva A, Paz-Ares J (2001) A conserved MYB transcription factor involved in phosphate starvation signalling both in vascular plants and in unicellular algae. Genes Dev 15: 2122–2133[Abstract/Free Full Text]

Sakamoto H, Araki T, Meshi T, Iwabuchi M (2000) Expression of a subset of the Arabidopsis Cys(2)/His(2)-type zinc-finger protein gene family under water stress. Gene 248: 23–32[CrossRef][Web of Science][Medline]

Sánchez-Calderón L, López-Bucio J, Chacón-López A, Cruz-Ramírez A, Nieto-Jacobo F, Dubrovsky JG, Herrera-Estrella L (2005) Phosphate starvation induces a determinate developmental program in the roots of Arabidopsis thaliana. Plant Cell Physiol 46: 174–184[Abstract/Free Full Text]

Shin H, Shin HS, Chen R, Harrison MJ (2006) Loss of At4 function impacts phosphate distribution between the roots and the shoots during phosphate starvation. Plant J 45: 712–726[CrossRef][Web of Science][Medline]

Shin H, Shin HS, Dewbre GR, Harrison MJ (2004) Phosphate transport in Arabidopsis: Pht1;1 and Pht1;4 play a major role in phosphate acquisition from both low- and high-phosphate environments. Plant J 39: 629–642[CrossRef][Web of Science][Medline]

Ticconi CA, Delatorre CA, Lahner B, Salt DE, Abel S (2004) Arabidopsis pdr2 reveals a phosphate-sensitive checkpoint in root development. Plant J 37: 801–814[CrossRef][Web of Science][Medline]

Tomscha JL, Trull MC, Deikman J, Lynch JP, Guiltnan MJ (2004) Phosphatase under-producer mutants have altered phosphorus relations. Plant Physiol 135: 334–345[Abstract/Free Full Text]

Trull MC, Deikman J (1998) An Arabidopsis mutant missing one acid phosphatase isoform. Planta 206: 544–550[CrossRef][Web of Science][Medline]

Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG (2002) Phosphite, an analog of phosphate, suppresses the coordinated expression of genes under phosphate starvation. Plant Physiol 129: 1232–1240[Abstract/Free Full Text]

Vogel JT, Zarka DG, Van Buskirk HA, Fowler SG, Thomashow MF (2005) Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis. Plant J 41: 195–211[CrossRef][Web of Science][Medline]

Wasaki J, Yonetani R, Kuroda S, Shinano T, Yazaki J, Fujii F, Shimbo K, Yamamoto K, Sakata K, Sasaki T (2003) Transcriptomic analysis of metabolic changes by phosphorus stress in rice plant roots. Plant Cell Environ 26: 1515–1523[CrossRef]

Wu P, Ma L, Hou X, Wang M, Wu Y, Liu F, Deng XW (2003) Phosphate starvation triggers distinct alterations of genome expression in Arabidopsis roots and leaves. Plant Physiol 132: 1260–1271[Abstract/Free Full Text]

Yi K, Wu Z, Zhou J, Du L, Guo L, Wu Y, Wu P (2005) OsPTF1, a novel transcription factor involved in tolerance to phosphate starvation in rice. Plant Physiol 138: 2087–2096[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
A. Jain, M. D. Poling, A. P. Smith, V. K. Nagarajan, B. Lahner, R. B. Meagher, and K. G. Raghothama
Variations in the Composition of Gelling Agents Affect Morphophysiological and Molecular Responses to Deficiencies of Phosphate and Other Nutrients
Plant Physiology, June 1, 2009; 150(2): 1033 - 1049.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
W.-Y. Lin, S.-I Lin, and T.-J. Chiou
Molecular regulators of phosphate homeostasis in plants
J. Exp. Bot., April 1, 2009; 60(5): 1427 - 1438.
[Abstract] [Full Text] [PDF]


Home page
Mol PlantHome page
B. N. Devaiah, R. Madhuvanthi, A. S. Karthikeyan, and K. G. Raghothama
Phosphate Starvation Responses and Gibberellic Acid Biosynthesis Are Regulated by the MYB62 Transcription Factor in Arabidopsis
Mol Plant, January 1, 2009; 2(1): 43 - 58.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
C. Calderon-Vazquez, E. Ibarra-Laclette, J. Caballero-Perez, and L. Herrera-Estrella
Transcript profiling of Zea mays roots reveals gene responses to phosphate deficiency at the plant- and species-specific levels
J. Exp. Bot., June 6, 2008; (2008) ern115v2.
[Abstract] [Full Text] [PDF]


This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrowOA All Versions of this Article:
145/1/147    most recent
pp.107.101691v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Devaiah, B. N.
Right arrow Articles by Raghothama, K. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Devaiah, B. N.
Right arrow Articles by Raghothama, K. G.
Agricola
Right arrow Articles by Devaiah, B. N.
Right arrow Articles by Raghothama, K. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2007 by the American Society of Plant Biologists