Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online July 13, 2007; 10.1104/pp.107.101808

Plant Physiology 145:174-182 (2007)
© 2007 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/1/174    most recent
pp.107.101808v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McLellan, C. A.
Right arrow Articles by Gunatilaka, A.A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McLellan, C. A.
Right arrow Articles by Gunatilaka, A.A. L.
Agricola
Right arrow Articles by McLellan, C. A.
Right arrow Articles by Gunatilaka, A.A. L.
PLANTS INTERACTING WITH OTHER ORGANISMS

A Rhizosphere Fungus Enhances Arabidopsis Thermotolerance through Production of an HSP90 Inhibitor1

Catherine A. McLellan2,3, Thomas J. Turbyville2, E.M. Kithsiri Wijeratne, Arthur Kerschen, Elizabeth Vierling, Christine Queitsch4, Luke Whitesell and A.A. Leslie Gunatilaka*

FAS Center for Systems Biology, Harvard University, Cambridge, Massachusetts 02138 (C.A.M., C.Q.); Southwest Center for Natural Products Research, Office of Arid Lands Studies, College of Agriculture and Life Sciences, University of Arizona, Tucson, Arizona 85706 (T.J.T., E.M.K.W., A.A.L.G.); Department of Plant Sciences (A.K.) and Department of Biochemistry and Molecular Biophysics (E.V.), University of Arizona, Tucson, Arizona 85721; and Whitehead Institute for Biomedical Research, Cambridge, Massachusetts 02142 (L.W.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The molecular chaperone HEAT SHOCK PROTEIN90 (HSP90) is essential for the maturation of key regulatory proteins in eukaryotes and for the response to temperature stress. Earlier, we have reported that fungi living in association with plants of the Sonoran desert produce small molecule inhibitors of mammalian HSP90. Here, we address whether elaboration of the HSP90 inhibitor monocillin I (MON) by the rhizosphere fungus Paraphaeosphaeria quadriseptata affects plant HSP90 and plant environmental responsiveness. We demonstrate that MON binds Arabidopsis (Arabidopsis thaliana) HSP90 and can inhibit the function of HSP90 in lysates of wheat (Triticum aestivum) germ. MON treatment of Arabidopsis seedlings induced HSP101 and HSP70, conserved components of the stress response. Application of MON, or growth in the presence of MON, allowed Arabidopsis wild type but not AtHSP101 knockout mutant seedlings to survive otherwise lethal temperature stress. Finally, cocultivation of P. quadriseptata with Arabidopsis enhanced plant heat stress tolerance. These data demonstrate that HSP90-inhibitory compounds produced by fungi can influence plant growth and responses to the environment.


Environmental factors and interactions between organisms are major forces that impact the development of organisms and have helped shape the evolutionary histories of species. Recent studies have identified the highly conserved and environmentally responsive molecular chaperone HEAT SHOCK PROTEIN90 (HSP90) as a potential molecular link between the biotic and abiotic environments of an organism and its phenotype. HSP90 is essential for the maturation of many key regulatory proteins in eukaryotes and for the evolutionarily conserved response to temperature stress (Young et al., 2001Go; Picard, 2002Go; Pratt and Toft, 2003Go). In plants, reduced HSP90 function dramatically alters responses to environmental stimuli and can globally affect plant phenotype. For example, plants with reduced HSP90 function are more sensitive to microbial pathogens and also show altered responses to abiotic cues such as gravity and light (Sangster and Queitsch, 2005Go). Several studies have demonstrated that manipulation of HSP90 function results in expression of previously cryptic genetic and epigenetic variation, thereby dramatically altering organism phenotype in a heritable manner (Rutherford and Lindquist, 1998Go; Queitsch et al., 2002Go; Sollars et al., 2003Go; Yeyati et al., 2007Go). It has been proposed that the manifestation of such variation could occur through environmental stress that might reduce HSP90 buffering capacity (Sangster et al., 2004Go). Alternatively, HSP90 function could be modulated by HSP90-specific small molecule inhibitors elaborated by several fungi in natural environments (Turbyville et al., 2006Go). To date, however, no evidence for targeting of HSP90 in the interactions between organisms with consequences for organismic phenotypes has been reported.

In a screen of ethyl acetate extracts from more than 500 Sonoran desert plant-associated endophytic and rhizosphere fungal strains, we previously identified two highly specific inhibitors of mammalian HSP90, monocillin I (MON; Fig. 1A , R = H) and radicicol (RAD; Fig. 1A, R = Cl), among many other secondary metabolites (Turbyville et al., 2006Go). Extracts of the rhizosphere fungal strain Paraphaeosphaeria quadriseptata, which inhabits the Sonoran desert Christmas cactus (Opuntia leptocaulis DC.; Cactaceae), contained MON in surprisingly high amounts—about 30% by weight of dry extract (Wijeratne et al., 2004Go). Extracts of the endophytic fungal strain Chaetomium chiversii, which colonizes the stem tissues of Mormon tea (Ephedra fasciculata A. Nels.; Ephedraceae), contained up to 10% RAD (Turbyville et al., 2006Go). Production of MON and RAD are not limited to these fungi; in fact, MON was first identified as a secondary metabolite elaborated by a mycoparasite of pine trees in North America (Delmotte and Delmotte-Plaquee, 1953Go; Omura et al., 1979Go; Ayer et al., 1980Go). Additional reports document the production of HSP90 inhibitors by bacteria and fungi in diverse ecosystems. Furthermore, P. quadriseptata is not restricted to the desert but has also been isolated as the major fungal inhabitant of the rhizosphere of young maize (Zea mays) plants in Brazil, indicating that this plant-fungus association is not limited to members of the cactus family (Gomes et al., 2003Go). Therefore, the extent of plant associations with fungi or other microorganisms that produce HSP90 inhibitors is most likely vastly underappreciated.


Figure 1
View larger version (20K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. MON binds plant HSP90 and inhibits its activity. A, Structures of MON (R = H) and RAD (R = Cl). B, HSP90 binding. Aliquots of drug-supplemented lysate of 14-d-old aerial tissue from Arabidopsis seedlings were incubated with bead-immobilized GDA. The relative binding of HSP90 was assessed by immunoblot using an Arabidopsis HSP90-specific antibody. Control indicates a sample of resin beads without immobilized GDA. C, Luciferase renaturation. Heat-denatured luciferase was added to wheat germ lysate supplemented with the indicated compounds, and the time-dependent recovery of activity was measured. Each time point was assayed in triplicate. The mean and SD of data derived from two independent experiments are depicted. Recovery of total input luciferase activity for DMSO control samples over the course of the experiments was 61% ± 4%.

 
While extensive studies have been directed toward understanding the mechanisms and activities of small molecule HSP90 inhibitors in mammalian systems, especially for possible treatment of cancers (Whitesell and Lindquist, 2005Go), there has been virtually no investigation of the impact of production of HSP90 inhibitors on plant-microorganism associations. As an essential step in beginning to define the impact of such inhibitors on plants in the environment, we demonstrate that MON binds and inhibits plant HSP90 function and can induce components of the plant heat shock response. In addition, application of MON or cocultivation with P. quadriseptata enhances plant heat tolerance. To fully understand the importance of HSP90 in plant biology, these findings make it clear that consideration must be given to HSP90 as a prominent target in mediating plant-microorganism interactions.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

MON Binds and Inhibits Plant Hsp90

We first sought to establish that the fungus-derived inhibitors of mammalian HSP90, MON and RAD, can bind and inhibit plant HSP90. Although HSP90 is a conserved molecular chaperone, small molecule inhibitors can show species specificity. For example, the prototypic HSP90 inhibitor geldanamycin (GDA) fails to bind and inhibit Caenorhabditis elegans HSP90 (David et al., 2003Go), despite the fact that this protein is 83% similar (73% identical) to its human ortholog that is readily inhibited by the compound. Given that the protein sequences of plant Hsp90 are only 63% to 71% identical to human and yeast Hsp90 (although they are 88%–93% identical between species; Krishna and Gloor, 2001Go), we first tested whether fungus-derived MON and RAD could bind plant Hsp90. Using a previously reported solid-phase competition approach (Whitesell et al., 1994Go), an amine derivative of GDA was immobilized on agarose beads and then incubated with Arabidopsis (Arabidopsis thaliana) seedling lysates that had been supplemented with various concentrations of MON or RAD as soluble competitors. After washing under moderately stringent conditions, bound proteins were eluted and analyzed by SDS-PAGE and staining with Sypro Ruby. Several nonspecific bands of comparable size were identified in the eluates of both control beads without attached GDA and beads with GDA. Importantly, a prominent band in the 90-kD range was present only in eluate from beads with covalently bound GDA (data not shown). To establish the identity of this band, we immunoblotted eluates with an antibody to plant HSP90. Immunodetection of a specific approximately 90-kD band confirmed that both MON and RAD efficiently competed with immobilized GDA for binding to Arabidopsis HSP90 in a concentration-dependent manner (Fig. 1B). These data suggest that both inhibitors bind to the nucleotide-binding site in the amino terminus of HSP90, which is known to be the binding site of GDA and RAD in other organisms (Roe et al., 1999Go; Schulte et al., 1999Go).

Because ATP hydrolysis is required for its chaperoning activity, GDA binding to the nucleotide binding site of Hsp90 markedly alters its function (Roe et al., 1999Go). To confirm that MON and RAD could affect plant HSP90 function, we performed standard assays for chaperone activity based on the ATP-dependent refolding of heat-denatured firefly luciferase in wheat (Triticum aestivum) germ lysate (Kolb et al., 1994Go). Indeed, MON and RAD inhibited luciferase refolding consistent with MON- or RAD-mediated inhibition of plant HSP90 function (Fig. 1C). Control experiments confirmed that neither MON nor RAD had any direct effect on the enzyme activity of native luciferase (data not shown).


MON Induces Expression of Heat Stress-Responsive Genes

Having established that HSP90 from wheat and Arabidopsis were bound and inhibited by both MON and RAD, we next evaluated whether exposure to MON could alter the environmental responsiveness of plants. We first examined the impact of MON on the transcriptional activation of specific heat stress-responsive genes. Under physiological conditions, HSP90-containing chaperone complexes are thought to sequester heat stress transcription factor (HSF) monomers in the cytoplasm. In the most widely accepted current model, HSP90 inhibitors and stressors such as heat that lead to accumulation of misfolded proteins are proposed to titer HSP90 and other chaperones away from HSF, resulting in its release and thereby allowing the trimerization and phosphorylation that are required for its activation of HSP gene transcription (Zou et al., 1998Go; Guo et al., 2001Go; Voellmy and Boellmann, 2007Go). To assess potential HSF activation, mRNA levels of AtHSP101 were measured in Arabidopsis seedlings after MON exposure using semiquantitative reverse transcription-PCR. Exposure of seedlings to MON induced a rapid increase in AtHSP101 mRNA level at 90 min post MON application, as is also observed during heat stress. AtHSP101 mRNAs then declined substantially 210 min after MON exposure (Fig. 2A ). A similar response was observed for AtHSP70, another HSP that relies on HSF for induction (data not shown). Heat stress at 38°C for 90 min was used as a positive control for these experiments, and it markedly increased AtHSP101 mRNA levels as expected. To determine whether MON-induced changes in mRNA levels would result in increased protein amounts, lysates of MON-treated seedlings were examined for HSP101 protein levels. A concentration-dependent increase in HSP101 level was observed in response to overnight treatment with a solution of MON in dimethyl sulfoxide (DMSO) as compared to the level found in control plants that had been exposed to DMSO alone (Fig. 2B). As a positive control, heat-stressed seedlings were analyzed and increased HSP101 levels were detected (Fig. 2B). From these results, we conclude that MON-mediated modulation of the heat shock response in plants is rapid, tunable, and reversible.


Figure 2
View larger version (59K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. MON increases HSP101 expression in Arabidopsis seedlings. A, Semiquantitative measurement of AtHSP101 mRNA by reverse transcription-PCR. Seedlings were sprayed with aqueous solutions of MON or DMSO vehicle and harvested for RNA extraction at the times indicated. As a positive control, seedlings were heat shocked (HEAT). Fragments of the AtHSP101 gene (black arrow) and the control housekeeping gene GAPC (gray arrow) were co-amplified from the same reverse-transcribed RNA samples and analyzed by gel electrophoresis. Relative levels of AtHSP101 normalized to GAPC signal are indicated below the gel. B, Measurement of relative HSP101 protein levels by immunoblotting. Seedlings were sprayed with aqueous solutions of MON at the indicated concentrations or DMSO vehicle, and total protein was extracted the following day. Lysate from heat-shocked seedlings (38°C for 90 min) served as a positive control (Heat).

 

MON Enhances HSP101-Dependent Heat Tolerance

In several plant species and in Saccharomyces cerevisiae, the HSF-dependent induction of HSP101 is crucial for acquired thermotolerance. Therefore, we hypothesized that MON-mediated induction of HSP101 might enhance thermotolerance in treated seedlings. To test this hypothesis, a quantitative assay of acquired thermotolerance based on hypocotyl elongation of dark-grown seedlings was used (Hong and Vierling, 2000Go; Queitsch et al., 2000Go). Hypocotyl elongation in the dark is slowed or completely arrested after exposure to temperature stress depending upon its severity. Prior induction of HSP101 through a preconditioning heat exposure, however, allows continued hypocotyl elongation even after severe stress, which can be readily measured in large numbers of replicate seedlings, permitting statistical analysis. Conversely, AtHSP101 mutant seedlings do not acquire thermotolerance following heat pretreatment and hypocotyl elongation remains arrested in response to severe stress (Hong and Vierling, 2000Go; Queitsch et al., 2000Go).

In the absence of heat stress (control conditions), topical MON application to dark-grown seedlings on plates did not alter hypocotyl elongation (Fig. 3A ). MON application prior to heat stress at 45°C for 50 or 75 min, however, resulted in significant preservation of hypocotyl elongation consistent with enhanced thermotolerance. The 10 µM treatment appeared to cause some cytotoxicity to the heat-stressed plants as measured by decreased hypocotyl elongation (Fig. 3A). This could be due to nonspecific effects of the small molecule or the loss of other essential HSP90 functions related to growth. Most strikingly, when the same plates were subsequently transferred to a growth chamber under day/night light and temperature cycling, it was apparent that prior MON treatment resulted in a dramatic rescue of the seedlings from an otherwise lethal heat stress (Fig. 3B). After 2 weeks, the heat-stressed, MON-treated seedlings showed dramatic preservation of seedling growth and greening compared to the vehicle-treated seedlings.


Figure 3
View larger version (72K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. MON induces a thermotolerant phenotype in Arabidopsis seedlings. A, Measurement of hypocotyl elongation after heat treatment. MON was applied topically to dark-grown seedlings 18 h prior to heat shock under the conditions indicated. Hypocotyl elongation occurring in the dark over a 4-d period following heat treatment was measured as described previously (Hong and Vierling, 2000Go; Queitsch et al., 2000Go). The mean increase observed for 15 plants per condition is plotted. Error bars: SD. Star indicates that no column appears because the value was 0. B, MON-treated seedlings continue to develop normally. Plates were transferred to a growth chamber with a day/night cycle and photographed 14 d later. Results presented are representative of three independent experiments.

 
To address whether root exposure to MON could enhance thermotolerance, comparable to topical treatment, seedlings were germinated on media supplemented with varying concentrations of MON. An Arabidopsis HSP101 null mutant, hot1-3 (Hong and Vierling, 2000Go), was included in these experiments to determine if differences in response to MON are linked to the observed MON-induced expression of this critical chaperone. Growth of seedlings on MON-containing plates resulted in modest stunting of overall hypocotyl growth when compared to controls, similar to what has been reported for the HSP90 inhibitor GDA. However, growth on MON-supplemented plates protected dark-grown seedlings from the adverse effects of severe temperature stress, as demonstrated by their normal light-induced greening response in contrast to untreated seedlings (Fig. 4 ). Most importantly, the HSP101 null mutant hot1-3 failed to green and develop normally, confirming that induction of HSP101 is required for the enhanced thermotolerance observed after MON treatment (Fig. 4).


Figure 4
View larger version (69K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. HSP101 is required for MON-induced thermotolerance. A solution of MON (2 µm) or DMSO vehicle was applied to dark-grown wild-type (Col) or mutant (hot1-3) Arabidopsis seedlings (Col-0 accession). hot1-3 mutant seedlings express no functional HSP101 (Hong and Vierling, 2000Go). Eighteen hours after MON application, seedlings were heat shocked at 45°C for 50 min (45 x 50). Plates were then transferred to a growth chamber with a day/night cycle and photographed 14 d later.

 

Cocultivation of Arabidopsis and P. quadriseptata Enhances Heat Tolerance

To test whether the presence of a MON-producing fungus in the rhizosphere could alter plant responsiveness to thermal stress, we investigated the consequences of cocultivation of P. quadriseptata with Arabidopsis as a model for this type of interaction. When Arabidopsis seedlings were cocultured with P. quadriseptata on plates, hypocotyl elongation under non-heat shock conditions was reduced, most likely due to the presence of MON. Importantly, despite overall reduced growth, the hypocotyls of seedlings cocultivated with P. quadriseptata continued to elongate after heat stress, resulting in significantly longer hypocotyls than seen in seedlings heat stressed in the absence of fungus (Fig. 5, A and B ; P < 0.0001 for the effect of fungus, effect of heat treatment, and the interaction of the two variables). Although the heat treatment appears to have decreased fungal growth, extraction of fungus recovered from the plates and of the agar substrate showed that the fungus produced MON under these culture conditions and that MON had diffused into the growth medium (Fig. 6 ).


Figure 5
View larger version (78K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Coculture with the fungus P. quadriseptata induces a thermotolerant phenotype in Arabidopsis seedlings. A, Measurement of hypocotyl elongation after heat stress. Seeds were plated along with approximately 25 colony forming units of P. quadriseptata. Three days later, plates were heat treated at 45°C for the indicated time intervals, and hypocotyl elongation occurring in the dark over a 4-d period following heat treatment was measured. The mean increase observed for 20 to 30 plants per condition is indicated. Error bars: SEM. B, Plants that were not heat shocked and plants heat shocked at 45°C for 75 min were photographed at the conclusion of the experiment.

 

Figure 6
View larger version (13K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. Detection of MON in nutrient agar recovered from plates following plant-fungus coculture. A, Analysis of methanolic extract prepared from agar approximately 1 cm from the location of the Arabidopsis-P. quadriseptata growth zone. B, Analysis of authentic MON as a standard. The liquid chromatograms (LC) in A and B demonstrate a major UV absorbance peak eluting at approximately 17.5 min as indicated by the arrows. UV and mass spectrometry (MS) performed on material recovered from these peaks confirm that the peak in A contains MON with the expected molecular mass [M + 1]+ of 331 D. The chromatogram and spectra of extract prepared directly from plate-grown fungus appeared essentially identical to that shown in A, while extract of agar from plates containing seedlings but no fungus was found to contain no detectable MON (data not shown).

 
Cocultivation with P. quadriseptata also improved the survival of soil-grown plants after severe heat stress (Fig. 7 ). In the presence of the fungus, surviving soil-grown plants recovered readily from heat stress, appearing indistinguishable from nonstressed controls with no significant difference in leaf number or rosette diameter observed after 12 d of growth (data not shown).


Figure 7
View larger version (17K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. Cultivation with the fungus P. quadriseptata induces a thermotolerant phenotype in soil-grown Arabidopsis. Height of each bar depicts the percentage of plants surviving 5 d after a 2-h heat shock at 45°C. Results from two independent experiments are displayed in which each experimental group consisted of approximately 20 plants. In both experiments, 90% to 100% of plants that received no heat shock survived over the 5-d time period, irrespective of the presence or absence of fungus.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
We have demonstrated that the fungal secondary metabolites MON and RAD can bind and inhibit plant HSP90. Application of MON leads to expression of major components of the heat stress response, HSP101 and HSP70, and can promote heat tolerance of Arabidopsis seedlings in an HSP101-dependent manner. In addition, cocultivation of the MON-producing fungus P. quadriseptata with Arabidopsis leads to enhanced heat tolerance of Arabidopsis. Taken together, these data demonstrate that the presence of an HSP90 inhibitor-producing fungus can dramatically alter plant responsiveness to environmental stresses such as heat. Based on extensive evidence in other systems that HSF activation of HSP gene expression is stimulated by inhibition of HSP90, we conclude that the enhanced Arabidopsis heat tolerance observed in our studies is the result of MON inhibition of HSP90. The elaboration of HSP90 inhibitors by plant-associated microorganisms implicates HSP90 as a direct target in organismic interactions, possibly among microbial communities competing in the plant rhizosphere. In light of the multifaceted role that plant HSP90 plays in response to biotic and abiotic stresses (Sangster and Queitsch, 2005Go), in normal plant development (Krishna and Gloor, 2001Go), and in the buffering of genetic variation (Queitsch et al., 2002Go), HSP90-based plant-fungus interactions could impact plant phenotypes in numerous ways.

Induced responses to environmental stimuli such as heat and drought and defense responses against microbial pathogens are typically tightly regulated. Constitutive activation of these normally inducible environmental response pathways can result in slower growth and abnormal pleiotropic phenotypes (Kasuga et al., 1999Go; Noutoshi et al., 2005Go). At this point, it is not known whether fungal production of MON or RAD might be regulated by abiotic conditions or by plant signals, either in the Sonoran desert, where our isolates were obtained, or in other environments where these fungi occur. In laboratory monoculture, however, elaboration of these secondary metabolites can be markedly altered by growth conditions (Gunatilaka, 2006Go). Even if such compounds are continually produced by fungi in association with plants, it remains possible that stress preconditioning as a result of plant exposure to fungal HSP90 inhibitors could be advantageous in certain environments such as the desert, where plants must survive rapid, drastic temperature changes. Indeed, extreme environments may favor constitutive up-regulation of HSPs as demonstrated for larvae, but not adults, of the polar insect Belgica antarctica. The larvae of this flightless midge are exposed to dramatic temperature differences, being encased in ice during the lengthy Antarctic winter and then emerging to complete their life cycle during the austral summer (Rinehart et al., 2006Go). In contrast, adults show the typical stress-inducible expression of HSPs.

Previous studies of grass-endophyte associations have also shown that continual presence of an endophyte can improve the tolerance of infected plants to high temperatures (Marquez et al., 2007Go). In these studies, however, molecular mechanisms responsible for induced thermotolerance, including the potential elaboration of heat shock-active secondary metabolites, were not investigated. Much more research on the occurrence, concentration, and environmental stability of HSP90 inhibitors, as well as the control of their production by plant-associated microorganisms, is clearly warranted. Ecological and physiological studies will also be advanced by development of genetically tractable microorganisms, in which production of MON can be controlled, an approach that is not currently feasible in P. quadriseptata.

While the responses we have measured are most likely the result of the interactions of HSP90 with plant HSFs, HSP90 inhibitors can also be expected to disrupt processes mediated by other substrates that HSP90 chaperones, its so-called client proteins. The only endogenous HSP90 clients characterized so far in plants are R proteins, whose rapid degradation in HSP90-deficient mutant plants translates into greater sensitivity to microbial pathogens (Belkhadir et al., 2004Go; Schulze-Lefert, 2004Go). Because the entry of symbiotic organisms into the root system of host plants is accompanied by a local defense response similar to that observed in response to pathogens, manipulation of host HSP90 by secondary metabolites might facilitate the establishment and maintenance of fungal symbionts. MON and other HSP90 inhibitors could also be toxic to certain plant pathogens (Ayer et al., 1980Go), suggesting another potentially beneficial aspect of MON production by fungi for their associated plant communities. As the clients of HSP90 in plants are further elucidated, the range of possible phenotypes impacted by HSP90-producing microorganisms will no doubt continue to expand.

HSP90 clearly plays an important role in eukaryotic development and environmental responsiveness. The elaboration of HSP90 inhibitors by microorganisms in both natural and agricultural ecosystems and the myriad ways in which such small molecules could affect organismic interactions and phenotypes open up many exciting new avenues for investigation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Solid-Phase Competition Assay

MON binding to Arabidopsis (Arabidopsis thaliana) HSP90 was assessed using a solid-phase competition assay (Whitesell et al., 1994Go). Plant tissue was prepared by grinding aerial tissue from 14-d-old Arabidopsis in a liquid nitrogen-cooled mortar and pestle. The tissue was extracted with assay buffer containing 20 mM HEPES, pH 7.3, 50 mM KCl, 5 mM MgCl2, 20 mM Na2MoO4, and 0.01% Nonidet P-40 by rocking for 2 h at 4°C. The lysate was clarified by centrifugation for 30 min at 4°C, followed by supplementation with 1 mM fresh dithiothreitol, and frozen at –80°C. Binding assays were performed using 0.5-mL aliquots (1.2 mg of total protein) of plant lysate supplemented with the indicated concentrations of soluble drug as competitor or an equal volume of DMSO vehicle. After addition of agarose beads on which GDA had been previously immobilized as described, the reaction tubes were incubated for 1 h with gentle agitation at 4°C. Beads were then washed extensively and bound proteins eluted into Laemmli sample buffer, followed by SDS-PAGE and western blotting with an Arabidopsis-specific anti-HSP90 antibody (Santa Cruz Biotechnology).


Luciferase Renaturation Assay

Inhibition of chaperone-mediated refolding of heat-denatured firefly luciferase was analyzed using an adaptation of previously published methods (Kolb et al., 1994Go). Recombinant firefly luciferase (Promega; 3 µg/mL in sample buffer; Thulasiraman and Matts, 1996Go) was denatured at 40°C for 5 min. Native or denatured luciferase was then diluted 1:10 into a 50% solution of wheat (Triticum aestivum) germ lysate in water (Promega) that had been previously supplemented with the indicated compounds or an equal volume of DMSO vehicle. After incubation at 25°C for the indicated time intervals, 5-µL aliquots of lysate mixture were removed, added to 50 µL of luciferase assay reagent (Promega), and the light intensity measured using a microplate luminometer. Each time point was assayed in triplicate, and the results presented depict the mean ± SD of pooled data from two independent experiments.


Measurement of AtHSP101 mRNA and Protein

Surface-sterilized Arabidopsis seeds (Columbia [Col]-0 accession) were germinated on nutrient agar plates and allowed to grow for 10 d at 24°C. Seedlings were then sprayed with aqueous solutions of MON at various concentrations. RNA was extracted from pools of 12 seedlings at 90 and 210 min post MON application, while for protein lysates seedlings were harvested approximately 18 h after being sprayed. For semiquantitative measurement of AtHSP101 mRNA, 5 µg of total RNA from each sample was reverse transcribed and a 648-bp AtHSP101 fragment amplified using forward (CTGCTCAGCTGTCTGCTCG) and reverse (GCCCTTGACCTTAGAATTGCC) primers derived from Arabidopsis locus At1g74310. The AtHSP101 fragment was co-amplified in the same PCR reactions with primers for a control 542-bp fragment of glyceraldehyde-3-P dehydrogenase C subunit (GAPC) cDNA (Arabidopsis locus At3g04120) and 20% GAPC amplification inhibitors as described previously (Kerschen et al., 2004Go). After agarose gel electrophoresis, relative PCR product amounts were measured by UV image optical density (Labworks Analysis Software; UVP). The reduced intensity of GAPC control bands in heat-shocked samples is due to competition for amplification by elevated AtHSP101 transcript levels. The ratio of target to control band intensity in the untreated sample was assigned a value of 1.0, and the ratios determined for all other samples were normalized based on this measurement to yield values for relative AtHSP101 transcript levels. The relative level of HSP101 protein in seedlings was measured by immunoblotting protein extracts (10 µg/lane) using a rabbit polyclonal primary antibody (AZ 561, 1:5,000), peroxidase-conjugated secondary antibody, and chemiluminescent detection. As a positive control, seedlings were heat shocked at 38°C for 90 min. RNA and protein extracts were analyzed in the same manner as extracts prepared from MON-exposed seedlings.


Thermotolerance Assays

As a quantitative indicator of thermotolerance, hypocotyl elongation following heat shock of 2.5-d-old, synchronized dark-grown seedlings (between 10 and 15 per condition) was measured as described previously (Hong and Vierling, 2000Go). The evening prior to heat shock, plates were sprayed with aqueous solutions of MON at various concentrations or an equivalent volume of DMSO vehicle. Plants were maintained in the dark continuously and the extent of hypocotyl growth over a 4.5-d period following heat shock was measured. After measuring hypocotyl growth, plates were transferred to a growth chamber with a day/night cycle and photographed 14 d later. This same experimental design was repeated three times with similar results. Mutant hot1-3 seedlings (expressing no functional HSP101) and wild type (Col-0) planted on the same plates were sprayed, as above, with varying concentrations of MON or DMSO. Eighteen hours later the plates were heat shocked at 45°C for 50 min, transferred to a growth chamber with a day/night cycle, and then photographed 14 d later. To directly assess the effect of the fungus Paraphaeosphaeria quadriseptata on Arabidopsis heat tolerance, seeds were cocultured with fungus on plates and in soil. For these experiments seeds were sterilized and imbibed in water at 4°C for a minimum of 2 d prior to transfer to Suc-enriched plates or autoclaved soil. Approximately 25 colony forming units of P. quadriseptata were then applied on top of each seed in 10 µL of water. Colony forming units were determined experimentally by plating dilutions of fungal suspension on potato dextrose agarose plates, followed by incubation at 28°C for 4 d. Seeds grown on plates were heat treated at 45°C 3 d after plating. Hypocotyl elongation occurring in the dark after a 4-d period was measured. Soil-grown plants were cultivated in 24-well tissue culture plates with drainage holes drilled into the bottom of each well to facilitate watering. Plates were incubated under 50% humidity and a physiological light/dark cycle. After 7 d of growth, the plants were photographed, counted, and transferred during the light phase of their cycle to an identical incubator maintained at 45°C. After 2 h of treatment at the higher temperature, the plants were returned to their original growth conditions for 5 d, at which time they were photographed and recounted.


Preparation of Extracts

Samples of nutrient agar or actual fungal mass were transferred to three 50-mL centrifuge tubes, sonicated twice in methanol (30 mL each time for 30 min), and filtered. Combined filtrates from each of the three tubes were evaporated separately under reduced pressure to afford crude methanolic extracts. Each of these extracts was then partitioned between water and ethyl acetate (3 x 10 mL). Combined ethyl acetate layers were washed separately with water (3 x 10 mL), dried over anhydrous Na2SO4, and evaporated under reduced pressure to yield ethyl acetate extracts for liquid chromatography (LC)-mass spectrometry (MS) analysis.


Analysis of Extracts for the Presence of MON by LC-MS

To detect the presence of MON, ethyl acetate extracts were dissolved in methanol to a final concentration of 1.0 mg/mL and analyzed by LC-MS using a Shimadzu LCMS-QP800{alpha} equipped with LC-10AD liquid chromatograph, SCL-10A system controller, DGU-14A degasser, and SPD-M10A diode array detector. The following conditions were used: Cromasil C18 5-µm column (250 mm x 4.6 mm), 35-min linear gradient from 60% methanol in water (containing 0.25% HCOOH) to 100% methanol, and 0.4 mL/min flow rate. APCI (atmospheric pressure chemical ionization) positive mode was used for data acquisition. Spectra were monitored and processed using Shimadzu LabSolutions LC-MS software.

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers At1g74310 and At1g04120.


    ACKNOWLEDGMENTS
 
We thank Vicki Chandler (University of Arizona) for generously providing some equipment and reagents, and Susan Lindquist and Leah Cowen (Whitehead Institute) for useful suggestions. H.D. VanEtten, L.S. Pierson, S. Faeth, and E.E. Pierson assisted in the collection and identification of microorganisms, while M.T. Marron, L.A. Luevano, and C.J. Seliga provided expert technical assistance.

Received May 4, 2007; accepted June 6, 2007; published July 13, 2007.


    FOOTNOTES
 
1 This work was supported in part by the U.S. National Institutes of Health (grant no. R01–CA090265 to A.A.L.G. and grant no. R21–CA091056 to L.W.) and by the U.S. Department of Energy (Energy Biosciences Program grant no. DE–RG03–99ER20338 to E.V.). Fellowship support of T.J.T. was provided by the University of Arizona Bio5 Institute. Back

2 These authors contributed equally to the article. Back

3 Present address: Whitehead Institute for Biomedical Research, Cambridge, MA 02142. Back

4 Present address: Department of Genome Sciences, University of Washington, Seattle, WA 98195. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: A.A. Leslie Gunatilaka (leslieg{at}ag.arizona.edu).

www.plantphysiol.org/cgi/doi/10.1104/pp.107.101808

* Corresponding author; e-mail leslieg{at}ag.arizona.edu.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Ayer WA, Lee SP, Tsuneda A, Hiratsuka Y (1980) The isolation, identification, and bioassay of the antifungal metabolites produced by Monocillium nordinii. Can J Microbiol 26: 766–773[Web of Science]

Belkhadir Y, Subramaniam R, Dangl JL (2004) Plant disease resistance protein signaling: NBS-LRR proteins and their partners. Curr Opin Plant Biol 7: 391–399[CrossRef][Web of Science][Medline]

David CL, Smith HE, Raynes DA, Pulcini EJ, Whitesell L (2003) Expression of a unique drug-resistant Hsp90 ortholog by the nematode Caenorhabditis elegans. Cell Stress Chaperones 8: 93–104[CrossRef][Web of Science][Medline]

Delmotte P, Delmotte-Plaquee J (1953) A new antifungal substance of fungal origin. Nature 171: 344–345[Medline]

Gomes NCM, Fagbola O, Costa R, Rumjanek NG, Buchner A, Mendona-Hagler L, Smalla K (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. Appl Environ Microbiol 69: 3758–3766[Abstract/Free Full Text]

Guo Y, Guettouche T, Fenna M, Boellmann F, Pratt WB, Toft DO, Smith DF, Voellmy R (2001) Evidence for a mechanism of repression of heat shock factor 1 transcriptional activity by a multichaperone complex. J Biol Chem 276: 45791–45799[Abstract/Free Full Text]

Gunatilaka AAL (2006) Natural products from plant-associated microorganisms: distribution, structural diversity, bioactivity, and implications of their occurrence. J Nat Prod 69: 509–526[CrossRef][Medline]

Hong SW, Vierling E (2000) Mutants of Arabidopsis thaliana defective in the acquisition of tolerance to high temperature stress. Proc Natl Acad Sci USA 97: 4392–4397[Abstract/Free Full Text]

Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1999) Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat Biotechnol 17: 287–291[CrossRef][Web of Science][Medline]

Kerschen A, Napoli CA, Jorgensen RA, Muller AE (2004) Effectiveness of RNA interference in transgenic plants. FEBS Lett 566: 223–228[CrossRef][Web of Science][Medline]

Kolb VA, Makeyev EV, Spirin AS (1994) Folding of firefly luciferase during translation in a cell-free system. EMBO J 13: 3631–3637[Web of Science][Medline]

Krishna P, Gloor G (2001) The Hsp90 family of proteins in Arabidopsis thaliana. Cell Stress Chaperones 6: 238–246[Web of Science][Medline]

Marquez LM, Redman RS, Rodriguez RJ, Roossinck MJ (2007) A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science 315: 513–515[Abstract/Free Full Text]

Noutoshi Y, Ito T, Seki M, Nakashita H, Yoshida S, Marco Y, Shirasu K, Shinozaki K (2005) A single amino acid insertion in the WRKY domain of the Arabidopsis TIR-NBS-LRR-WRKY-type disease resistance protein SLH1 (sensitive to low humidity 1) causes activation of defense responses and hypersensitive cell death. Plant J 43: 873–888[CrossRef][Web of Science][Medline]

Omura S, Iwai Y, Takahashi Y, Sadakane N, Nakagawa A (1979) Herbimycin, a new antibiotic produced by a strain of Streptomyces. J Antibiot (Tokyo) 32: 255–261[Medline]

Picard D (2002) Heat-shock protein 90, a chaperone for folding and regulation. Cell Mol Life Sci 59: 1640–1648[CrossRef][Web of Science][Medline]

Pratt WB, Toft DO (2003) Regulation of signaling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. Exp Biol Med (Maywood) 228: 111–133[Abstract/Free Full Text]

Queitsch C, Hong SW, Vierling E, Lindquist S (2000) Heat shock protein 101 plays a crucial role in thermotolerance in Arabidopsis. Plant Cell 12: 479–492[Abstract/Free Full Text]

Queitsch C, Sangster TA, Lindquist S (2002) Hsp90 as a capacitor of phenotypic variation. Nature 417: 618–624[CrossRef][Medline]

Rinehart JP, Hayward SA, Elnitsky MA, Sandro LH, Lee RE Jr, Denlinger DL (2006) Continuous up-regulation of heat shock proteins in larvae, but not adults, of a polar insect. Proc Natl Acad Sci USA 103: 14223–14227[Abstract/Free Full Text]

Roe SM, Prodromou C, O'Brien R, Ladbury JE, Piper PW, Pearl LH (1999) Structural basis for inhibition of the Hsp90 molecular chaperone by the antitumor antibiotics radicicol and geldanamycin. J Med Chem 42: 260–266[CrossRef][Web of Science][Medline]

Rutherford SL, Lindquist S (1998) Hsp90 as a capacitor for morphological evolution. Nature 396: 336–342[CrossRef][Medline]

Sangster TA, Lindquist S, Queitsch C (2004) Under cover: causes, effects and implications of Hsp90-mediated genetic capacitance. Bioessays 26: 348–362[CrossRef][Web of Science][Medline]

Sangster TA, Queitsch C (2005) The HSP90 chaperone complex, an emerging force in plant development and phenotypic plasticity. Curr Opin Plant Biol 8: 86–92[CrossRef][Web of Science][Medline]

Schulte TW, Akinaga S, Murakata T, Agatsuma T, Sugimoto S, Nakano H, Lee Y, Simen B, Argon Y, Felts S, et al (1999) Interaction of radicicol with members of the heat shock protein 90 family of molecular chaperones. Mol Endocrinol 13: 1435–1448[Abstract/Free Full Text]

Schulze-Lefert P (2004) Plant immunity: the origami of receptor activation. Curr Biol 14: R22–R24[Web of Science][Medline]

Sollars V, Lu X, Xiao L, Wang X, Garfinkel MD, Ruden DM (2003) Evidence for an epigenetic mechanism by which Hsp90 acts as a capacitor for morphological evolution. Nat Genet 33: 70–74[CrossRef][Web of Science][Medline]

Thulasiraman V, Matts RL (1996) Effect of geldanamycin on the kinetics of chaperone-mediated renaturation of firefly luciferase in rabbit reticulocyte lysate. Biochemistry 35: 13443–13450[CrossRef][Medline]

Turbyville TJ, Wijeratne EMK, Liu MX, Burns AM, Seliga CJ, Luevano LA, David CL, Faeth SH, Whitesell L, Gunatilaka AAL (2006) Search for Hsp90 inhibitors with potential anticancer activity: isolation and SAR studies of radicicol and monocillin I from two plant-associated fungi of the Sonoran desert. J Nat Prod 69: 178–184[CrossRef][Medline]

Voellmy R, Boellmann F (2007) Chaperone regulation of the heat shock protein response. Adv Exp Med Biol 594: 89–99[Web of Science][Medline]

Whitesell L, Lindquist SL (2005) HSP90 and the chaperoning of cancer. Nat Rev Cancer 5: 761–772[CrossRef][Web of Science][Medline]

Whitesell L, Mimnaugh EG, De Costa B, Myers CE, Neckers LM (1994) Inhibition of heat shock protein HSP90-pp60v-src heteroprotein complex formation by benzoquinone ansamycins: essential role for stress proteins in oncogenic transformation. Proc Natl Acad Sci USA 91: 8324–8328[Abstract/Free Full Text]

Wijeratne EMK, Carbonezi CA, Takahashi JA, Seliga CJ, Turbyville TJ, Pierson EE, Pierson LS III, VanEtten HD, Whitesell L, Bolzani V da S, et al (2004) Isolation, optimization of production and structure-activity relationship studies of monocillin I, the cytotoxic constituent of Parapheosphaeria quadriseptata. J Antibiot (Tokyo) 57: 541–546[Medline]

Yeyati PL, Bancewicz RM, Maule J, van Heyningen V (2007) Hsp90 selectively modulates phenotype in vertebrate development. PLoS Genet 3: e43[CrossRef][Medline]

Young JC, Moarefi I, Hartl FU (2001) Hsp90: a specialized but essential protein-folding tool. J Cell Biol 154: 267–273[Abstract/Free Full Text]

Zou J, Guo Y, Guettouche T, Smith DF, Voellmy R (1998) Repression of heat shock transcription factor HSF1 activation by HSP90 (HSP90 complex) that forms a stress-sensitive complex with HSF1. Cell 94: 471–480[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Phil Trans R Soc BHome page
S. F. Gilbert, E. McDonald, N. Boyle, N. Buttino, L. Gyi, M. Mai, N. Prakash, and J. Robinson
Symbiosis as a source of selectable epigenetic variation: taking the heat for the big guy
Phil Trans R Soc B, February 27, 2010; 365(1540): 671 - 678.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Forafonov, O. A. Toogun, I. Grad, E. Suslova, B. C. Freeman, and D. Picard
p23/Sba1p Protects against Hsp90 Inhibitors Independently of Its Intrinsic Chaperone Activity
Mol. Cell. Biol., May 15, 2008; 28(10): 3446 - 3456.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
A. Porras-Alfaro, J. Herrera, R. L. Sinsabaugh, K. J. Odenbach, T. Lowrey, and D. O. Natvig
Novel Root Fungal Consortium Associated with a Dominant Desert Grass
Appl. Envir. Microbiol., May 1, 2008; 74(9): 2805 - 2813.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. A. Sangster, N. Salathia, S. Undurraga, R. Milo, K. Schellenberg, S. Lindquist, and C. Queitsch
HSP90 affects the expression of genetic variation and developmental stability in quantitative traits
PNAS, February 26, 2008; 105(8): 2963 - 2968.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Yamada, Y. Fukao, M. Hayashi, M. Fukazawa, I. Suzuki, and M. Nishimura
Cytosolic HSP90 Regulates the Heat Shock Response That Is Responsible for Heat Acclimation in Arabidopsis thaliana
J. Biol. Chem., December 28, 2007; 282(52): 37794 - 37804.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/1/174    most recent
pp.107.101808v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McLellan, C. A.
Right arrow Articles by Gunatilaka, A.A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McLellan, C. A.
Right arrow Articles by Gunatilaka, A.A. L.
Agricola
Right arrow Articles by McLellan, C. A.
Right arrow Articles by Gunatilaka, A.A. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2007 by the American Society of Plant Biologists