|
|
||||||||
|
First published online July 27, 2007; 10.1104/pp.107.103374 Plant Physiology 145:204-215 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
AtNUDT7, a Negative Regulator of Basal Immunity in Arabidopsis, Modulates Two Distinct Defense Response Pathways and Is Involved in Maintaining Redox Homeostasis1,[C],[OA]Donald Danforth Plant Science Center, St. Louis, Missouri 63132 (X.G., G.-J.L., S.-B.W., H.Z., Y.X.); State Key Laboratory of Genetic Engineering, Department of Biochemistry and Molecular Biology, Fudan University, Shanghai 200433, China (X.G.); and Syngenta Biotechnology Incorporated, Research Triangle Park, North Carolina 27709 (T.Z., X.W.)
Plants have evolved complicated regulatory systems to control immune responses. Both positive and negative signaling pathways interplay to coordinate development of a resistance response with the appropriate amplitude and duration. AtNUDT7, a Nudix domain-containing protein in Arabidopsis (Arabidopsis thaliana) that hydrolyzes nucleotide derivatives, was found to be a negative regulator of the basal defense response, and its loss-of-function mutation results in enhanced resistance to infection by Pseudomonas syringae. The nudt7 mutation does not cause a strong constitutive disease resistance phenotype, but it leads to a heightened defense response, including accelerated activation of defense-related genes that can be triggered by pathogenic and nonpathogenic microorganisms. The nudt7 mutation enhances two distinct defense response pathways: one independent of and the other dependent on NPR1 and salicylic acid accumulation. In vitro enzymatic assays revealed that ADP-ribose and NADH are preferred substrates of NUDT7, and the hydrolysis activity of NUDT7 is essential for its biological function and is sensitive to inhibition by Ca2+. Further analyses indicate that ADP-ribose is not likely the physiological substrate of NUDT7. However, the nudt7 mutation leads to perturbation of cellular redox homeostasis and a higher level of NADH in pathogen-challenged leaves. The study suggests that the alteration in cellular antioxidant status caused by the nudt7 mutation primes the cells for the amplified defense response and NUDT7 functions to modulate the defense response to prevent excessive stimulation.
Recognition of a potentially pathogenic microorganism by plant cells triggers coordinated disease resistance responses, leading to the deployment of appropriate defense mechanisms. A strong form of disease resistance is mediated by race-specific gene-for-gene interaction in which the host Resistance (R) protein directly or indirectly recognizes the cognate Avirulence (Avr) protein delivered into the host by a specific pathogen strain (Dangl and Jones, 2001
In the absence of the R-Avr interactions, host cells are still capable of activating the basal defense response (Glazebrook et al., 1997
Nudix box-containing proteins generally hydrolyze a nucleoside diphosphate linked to some other moiety X, and the proteins containing the domain were termed Nudix proteins (Bessman et al., 1996 In this report, we describe the identification and characterization of NUDT7 as a negative regulator of the basal defense response. Its loss-of-function mutation leads to acceleration and amplification of the basal defense response. Two distinct pathways, one dependent on and the other independent of NPR1 and SA, are modulated by NUDT7 to prevent an excessive defense response. Our study indicates that alteration in redox homeostasis caused by the nudt7 mutation may lead to the excessive defense response that can be triggered not only by pathogens but also by other inciting agents.
Identification of nudt7 as an Enhanced Disease Resistance Mutant
The basal defense response can be quickly triggered upon pathogen invasion through recognition of MAMPs by host cells. It is plausible that many of the genes rapidly induced following pathogen infection may play important roles in the basal defense response. Based on gene expression profiles from our Arabidopsis Genechip microarray experiment (data not shown), we selected some early pathogen-responsive genes (induced within 1.5 h of infection by the bacterial pathogen P. syringae) and obtained their T-DNA insertion mutagenized lines for further analyses to determine their roles in the basal defense response. Among the T-DNA insertion lines, the nudt7 mutant was found to have an enhanced disease resistance phenotype against the virulent P. syringae pv. tomato (Pst) strain DC3000. The nudt7 mutant line (Salk_046441) carries a T-DNA insertion at the locus At4g12720, which encodes a protein containing a Nudix box (see below). The gene was previously named AtNUDT7 (abbreviated here as NUDT7), one of 24 putative Arabidopsis genes encoding Nudix proteins, and was reported to possess a hydrolase activity in an in vitro enzymatic assay (Ogawa et al., 2005
The morphological phenotype of the nudt7 plants differs under different growth environments. When the plants were grown in our communal growth rooms where pathogens (mainly Erysiphe cichoracearum) and insects (mainly aphids) were frequently present and pesticides were routinely used, the nudt7 plants grew much smaller than the wild-type plants (data not shown). However, in isolated growth chambers where no obvious damage by pathogens or insects was observed and no pesticide or other chemical (except fertilizer) was applied, the nudt7 plants were often morphologically indistinguishable from the wild-type plants (Fig. 1C) and were slightly smaller than the wild-type plants in some batches. All experimental data presented here were obtained using plants growing in the isolated growth chamber on soil unless otherwise specifically indicated in the text. In two recent reports, the same nudt7 mutant was described as having a stunting growth phenotype (Bartsch et al., 2006 NUDT7 consists of eight exons and the mutant has a T-DNA insertion in its first exon at 117 bp 3' to the initial codon. A NUDT7 genomic clone (NUDT7t) including the 2-kb promoter region was obtained by PCR from genomic DNA of wild-type plants. When transformed into the nudt7 mutant, it was able to complement the enhanced disease resistance phenotype of the mutant (Fig. 1A), confirming that the mutation is indeed caused by the insertion at the NUDT7 gene. NUDT7 was expressed at a low level in the uninfected wild-type leaves (Fig. 1D). Its expression was significantly induced in response to infection by both avirulent Pst avrRpm1 and virulent Pst strains. Strong induction of NUDT7 could be detected within 0.5 h of the inoculation. In the Pst-inoculated leaves, its transcript level dropped at 3 h postinoculation following the initial increase and then increased again at the later time points (Fig. 1D). This expression profile was repeatedly observed in multiple experiments. NUDT7 was also induced systemically by both the virulent Pst and avirulent Pst avrRpm1 strains (Fig. 1D). NUDT7 transcripts were not detectable in the mutant (Fig. 1E), indicating that the insertion likely results in a null allele.
To understand the mechanism by which the nudt7 mutation results in enhanced disease resistance, we used RNA-blotting analysis to reveal differences in activation of the defense response between the mutant and wild-type plants by examining pathogen-induced expression patterns of several pathogen-induced genes, including PATHOGENESIS-RELATED (PR) genes (PR1, PR2) and AVRRPT2-INDUCED GENE1 (AIG1; Reuber and Ausubel, 1996
The above results indicate that the hyperresponsiveness of the nudt7 mutant is likely triggered upon the initial recognition of the microorganisms, presumably through detection of MAMPs. Indeed, infiltration of the mutant leaves with boiled Pst and individual MAMPs such as chitosan (100 µg/mL; a main cell wall component of fungi) and flg22 (5 µM; the 22-amino acid peptide from bacterial flagellin that triggers the innate immune response) resulted in quick and strong induction of AIG1 and PR2 in the mutant (Fig. 2F; data not shown).
The nudt7 mutant does not develop spontaneous lesions visible by the naked eye. When examined under microscopes after trypan blue staining, the leaves of uninfected mutant plants were found to display very small lesions, most of which appear to consist of a single cell (Fig. 3A ). The estimated number of the microlesions in expanded leaves from the mutant was approximately 150 per leaf, whereas leaves from a wild-type plant generally displayed fewer than 20 stained spots per leaf (Fig. 3B). Diaminobenzidine (DAB) staining (to detect hydrogen peroxide [H2O2] in situ) revealed no DAB-positive spots in the uninfected leaves of the mutant or wild-type plants (data not shown), indicating that the microcell death of the mutant is not associated with a high level of H2O2 production. Similarly, we did not detect significant difference between wild-type and mutant leaves in levels of H2O2 (Fig. 3G), as determined by a quantitative H2O2 measurement method.
The microlesions associated with the mutant plants may be a consequence of disruption of the host cells' normal function due to their hyperresponsiveness to microorganisms and/or other stimuli in the environment. Examination of green healthy leaves from plants grown in sterile environments in culture tubes revealed no significant difference in microlesions between the mutant and wild-type plants (Fig. 3, C and D): Both the mutant and wild-type leaves had fewer than 10 trypan blue-positive spots per leaf. To determine whether the nudt7 mutation enhances hypersensitive cell death triggered by avirulent pathogens, we inoculated leaves with Pst avrRpm1 at a concentration of approximately 107 cfu/mL and monitored appearance of dead cells by trypan blue staining. No obvious difference was found between the mutant and wild-type plants in the timing of hypersensitive cell death. In both wild-type and mutant leaves, dead cells were observed after approximately 6 h postinoculation (Fig. 3, E and F). Tissue collapse, the visible symptom of infected leaves, appeared approximately 10 h postinoculation for both mutant and wild-type plants (data not shown). The virulent Pst strain was not able to induce cell death in either wild-type or mutant leaves when the leaves were observed by trypan blue staining in 5- to 36-h intervals after the inoculation (data not shown). We further monitored electrolyte leakage to provide a quantitative measurement of cell death in leaf discs infiltrated with Pst avrRpm1 and Pst (107 cfu/mL). Compared with the Pst-inoculated leaf discs, Pst avrRpm1 caused significant iron leakage, which began after approximately 2 h postinoculation (Fig. 3H). However, there is no significant difference in electrolyte leakage between the infected leaf discs of the wild-type and nudt7 mutant plants. Besides, no difference in hypersensitive cell death was seen between the mutant and wild-type plants when infection was carried out with a low concentration of the bacteria (2 x 105 cfu/mL; data not shown).
Many enhanced disease resistance mutants constitutively accumulate high levels of SA. To investigate whether the hyperresponsiveness phenotype of nudt7 is caused by higher levels of SA before and after inoculation, we measured SA and its glucoside conjugate (SAG, the storage form of SA). As shown in Figure 4 , the mutant accumulated significantly higher levels of SA and SAG 8 h postinoculation with Pst. However, within 3 h postinoculation, although the mutant had slightly higher levels of SAG, there was little difference in the levels of SA between the mutant and wild-type plants. The results indicate that the rapid activation of the defense-related genes in the mutant is unlikely due to an elevated level of SA, although the high level of SA at the later stages likely contributes to the enhanced disease resistance phenotype of the mutant.
The nudt7 Mutation Enhances Two Distinct Defense Response Pathways
The nudt7 mutant was crossed with previously identified disease resistance mutants, npr1 and eds5, and with the NahG plant to generate double mutants. NPR1 is a key component required for disease resistance (Cao et al., 1994
ADPR and NADH are Preferred in Vitro Substrates of NUDT7
NUDT7 encodes a 32-kD polypeptide that contains the conserved sequence motif called the Nudix box that is involved in hydrolyzing a nucleoside diphosphate linked to some other moiety X (Bessman et al., 1996
We generated a mutant form of NUDT7 (NUDT7 E154Q) in which the conserved Glu residue E154 in the Nudix box is mutagenized to Gln. E154 likely binds to Mg2+ to carry out the nucleophilic attack and therefore is considered essential for its hydrolase activity (Mildvan et al., 2005
The in vitro hydrolase activity assays described above raise the possibility that ADPR could be the physiological substrate of NUDT7. We reasoned that if NUDT7 functions to modulate the ADPR level, the nudt7 mutation is expected to lead to an increase in the level of ADPR. To test the working hypothesis, we determined levels of free ADPR. Free ADPR levels in Arabidopsis leaves were found to be too low to be detected in our initial nucleotide profiling analyses using regular HPLC (data not shown). We then applied a HPLC technique for detection of ethano-ADPR, a fluorescence analog of ADPR for measuring ADPR (see "Materials and Methods"). Our results showed that the concentration of ADPR in Arabidopsis leaves is around 200 pmol/g fresh weight (Fig. 7A
), which will give a rough estimate of about 20 to 40 µM in cellular compartments (such as the cytosol) according to an estimation method assuming that amount of ADPR is inappreciable in the vacuole (Noctor, 2006
The result from the in vitro enzymatic assays also suggested that NUDT7 could be a redox modulator since it hydrolyzes NADH and NADPH. We determined levels of NAD(P) and NAD(P)H in wild-type and nudt7 leaves before and after infection with P. syringae (Fig. 7A). Concentration of each of these nucleotide analogs in leaves ranged from 30 to 80 nmol/g tissue (roughly several mM to 20 mM in cellular compartments excluding the vacuole based on the estimation method mentioned earlier). Km for the hydrolysis reaction of NADH by NUDT7 was found to be 0.1281 ± 0.0155 mM. As shown in Figure 7A, the levels of NADPH and NADP did not change much before and after pathogen incubation. However, slightly more NADPH was detected in the nudt7 mutant at 6 h postinfection (the difference is not statistically significant). The levels of both NADH and NAD significantly increased in the mutant and wild-type leaves at 6 h postinfection. At that time point, the concentration of NADH in the mutant leaves was significantly higher than that in the wild-type leaves. To get more information on overall cellular redox states, we further determined levels of GSH and GSSG, an important antioxidant buffer system involved in scavenging attacking radicals as well as in regenerating oxidized biomolecules. In both wild-type and mutant leaves, GSH to GSSG ratios decreased gradually following the pathogen infection, reflecting an increasing oxidative stress (Fig. 7B). However, the ratios in the mutant were consistently lower than those in the wild type in both uninfected and infected leaves. However, the mutant leaves contained a consistently higher level of total glutathione. These results indicate that the nudt7 mutation leads to an increase in oxidation of cellular components that in turn promotes cells to increase production of total glutathione and NAD(P)H to counteract the perturbation of cellular redox balance. To determine whether the escalated oxidative state associated with the mutant makes it more sensitive to extra oxidative stresses, we examined tolerance of plants to application of paraquat (PQ), a reactive oxygen species-generating chemical. As shown in Figure 8 , the mutant plants were more sensitive to the externally applied oxidative stress. Leaves of the mutant plants, especially older leaves, became wilted within 24 h after spraying with 10 µM PQ (Fig. 8A) and showed clear necrotic lesions several days later (Fig. 8B), while the effect on the wild-type plants was very mild. The nudt7 eds5 (Fig. 8A), nudt7 npr1 (Fig. 8B), and nudt7 NahG (data not shown) plants were as sensitive as the nudt7 single mutant to the PQ treatments. Multiple applications of a lower concentration of PQ starting at a younger seedling stage caused striking growth stunting to the mutant plants (Fig. 8C).
Basal immunity is apparently controlled by complex pathways. Many important genes that control the basal defense response have likely eluded identification through classical forward genetic approaches because of the complexity of the pathways and functional redundancy. We have taken the reverse/functional genomic approach to identify components involved in basal immunity. Loss of function of NUDT7 was found to enhance resistance against P. syringae, indicating that it acts as a negative regulator of disease resistance. The mutant does not display constitutive accumulation of high levels of PR gene transcripts in absence of pathogen infection; however, the mutation potentiates a remarkably stronger defense response that can be triggered by both pathogenic and nonpathogenic bacterial strains.
In the two previous reports by other groups characterizing the same mutant line, the mutant plants were found to have a stunting growth phenotype and showed constitutive accumulation of very high levels of PR gene transcripts and SA (Bartsch et al., 2006
Innate immunity is considered a double-edged sword. Delicate regulation of the innate immune response is not only important for host defense against invading pathogens but also essential for cohabitation with nonpathogenic microorganisms in the environment (Kobayashi and Flavell, 2004
NUDT7 may play its role by sensing and modulating the levels of its substrate(s) to fine-tune the defense response. Identification of ADPR and NADH as its preferred in vitro substrates raises the possibility that these nucleotide analogs may be physiological substrates of NUDT7 and act as regulatory molecules in plant disease resistance signaling. ADPR and NADH have previously been reported to be preferred in vitro substrates of NUDT7 (Ogawa et al., 2005
A more direct effect caused by the nudt7 mutation was found to be the perturbation of cellular redox homeostasis. Unlike the levels of NADH or SA, which were not different between the untreated wild-type and mutant plants, the ratios of GSH to GSSG were consistently lower in the mutant, suggesting that more GSH molecules were used to regenerate oxidized biomolecules. Although the precise mechanism by which the nudt7 mutation causes the change in the glutathione status remains to be determined, the perturbation in redox balance may "prime" cells to hyperrespond to inciting agents such as pathogen infection, resulting in an excessive defense response and enhanced disease resistance. It is believed that antioxidant status sets the threshold for general defense responses provoked by biotic or other stresses (Foyer and Noctor, 2005
It is worth mentioning that the primary biochemical function of a Nudix protein may not always be hydrolysis of its substrate. Instead, a Nudix box may be involved in conformational change of a Nudix-containing protein through its binding to a nucleotide analog. In animal immunocytes, the Ca2+-permeable cation channel LTRP2 mediates Ca2+ influx to trigger the immune responses (Perraud et al., 2001
The Arabidopsis genome encodes over 20 members of the Nudix family. Their biological functions and their modes of action remain largely unknown. It is plausible that biological substrates of some AtNUDT proteins are nucleotide analogs. A variety of nucleotide derivatives, including ADPR, cyclic GMP, cADPR, Ap4A, and cytokinins, play regulatory roles in many biological processes. Nudix hydrolases may be involved in biological processes by sensing and modulating levels of nucleotide analogs. The identification of the Nudix proteins as putative virulence effectors of phytopathogens (Mukaihara et al., 2004
Plant Growth Plants were grown at 22°C with 50% humidity and under short-day conditions (9/15 h photoperiod at a light intensity of 125 mol m–2 s–1).
The T-DNA-flanking genomic fragment was amplified by PCR from Salk_046441 using the gene-specific primer 4g12720p5 (5'-CAACGAGATGAGTCCAATAAACAAA-3') and the T-DNA left-border primer LBb1 (AGTTGCAGCAAGCGGTCCACGC). The wild-type fragment of this region was amplified using the primer pair 4g12720p5 and 4g12720p3 (CTAAACAATACGCTGACACCCTTCA).
Arabidopsis (Arabidopsis thaliana) genomic DNA was isolated from leaves using a modified CTAB procedure (Saghai-Maroof et al., 1984
Pseudomonas syringae was grown as described (Cameron et al., 1994
To prepare boiled Pst and Escherichia coli, the bacterial suspensions (107 cfu/mL in double-distilled water [ddH2O]) were boiled for 10 min and cooled before being infiltrated into leaves. flg22 (QRLSTGSRINSAKDDAAGLQIA) was synthesized by GenScript. Chitosan (52368; Sigma) and lipopolysaccharide (62326; Sigma) were purchased from Sigma. Induction of the defense response was conducted by pressure infiltration of the MAMP solutions into Arabidopsis leaves using 1-mL syringes (approximately 20 µL/leaf).
A 4.2-kb fragment of NUDT7 genomic DNA (NUDT7t), which includes a 2-kb promoter region and a 0.4-kb 3' untranslated region, was amplified from Col-0 by using the primer pair 4g12720p5Kpn (GGATCCGGAGCTAAGCATCTGAATCAG) and 4g12720p3Sal (GTCGACCAGTGTAGTAAATGGTCAAGAGAC). The PCR product was cloned into pCR-Blunt II-TOPO (Invitrogen), subcloned into the binary vector pPZP221 using the restriction sites KpnI and SalI, and then transformed into the mutant plants.
SA and SAG were extracted and analyzed as described previously (Uknes et al., 1993
DAB staining and trypan blue staining were carried out as described previously (Alvarez et al., 1998
NUDT7 cDNA was cloned through reverse transcription-PCR from an RNA sample extracted from leaves inoculated with P. syringae. After reverse transcription with oligo(dT) as a primer, NUDT7 cDNA was amplified using the primer set TAGGATCCGGTACTAGAGCTCAGCAG and CAGTCGACTCAGAGAGAAGCAGAGGC. The 0.8-kb PCR product was cloned into pCR-Blunt II-TOPO, and the cDNA insert was then dropped by digesting with BamHI/HindIII and ligated into pET41a (Novagen) to generate a fusion protein with GST at its N terminus. The fusion construct was transformed into DL21(DE3). After the bacterial culture grew to OD600 = 0.6 to approximately 0.8, 1 mM IPTG was added to the culture, which was then grown at 30 for additional 4 h. Purification of GST-NUDT7 was preformed using a glutathione-agarose affinity resin (G4510; Sigma) according to the manufacturer's instructions.
A general method for the activity assay of Nudix hydrolases was used to determine enzymatic activity of NUDT7 (Xu et al., 2004 For enzyme kinetic assays, the reaction was stopped by adding 1 N HCl at different time points. Concentrations of the substrates used in the kinetic assay were 0.5 mM, 2 mM, 5 mM, 10 mM, and 20 mM. The kinetic assay for each substrate concentration was repeated at least three times. Km and Vmax were calculated using the Lineweaver-Burk plot based on the Michaelis-Menton equation.
The NUDT7 genomic clone used for the complementation experiment and the NUDT7 cDNA clone used for expression in E. coli were mutagenized using the QuikChange XL site-directed mutagenesis kit (Stratagene) according to the manufacturer's instruction manual. E154Q mutation was generated by using the primer pair E154Qf (GATATATGGACTGGAGTAGCTAGGCAAGTGGAAGAAGAAACTGG) and E154Qr (CCAGTTTCTTCTTCCACTTGCCTAGCTACTCCAGTCCATATATC). The underlined nucleotides indicate the position of mutagenesis. The mutagenized genomic clone was then subcloned into the binary vector pPZP221 and transformed into nudt7 mutant plants. The mutagenized cDNA clone was subcloned into the E. coli expression vector. Expression and purification of NUDT7 E154Q followed the same protocol as that for wild-type NUDT7.
Glutathione levels were determined according to a previously described method (Griffith, 1980
For ADPR determination, extraction, purification, and HPLC separation of cellular ADP-Rib was performed essentially as described previously (Gasser and Guse, 2005
The pyrimidine nucleotides were measured by the cycling assay as described previously (Matsumura and Miyachi, 1980
PQ (methyl viologen; 856177; Sigma) was dissolved in water and sprayed onto plants using a hand spray bottle in solution containing 0.02% Silwet-77 as a detergent.
We thank Barbara Kunkel for all Pst strains, including Pst hrcC; Jian-min Zhou for the Psp strain; Xinnian Dong for the npr1 mutant seeds; and Christine Ehret for editing the manuscript. Received June 4, 2007; accepted July 19, 2007; published July 27, 2007.
1 This work was supported by the National Institutes of Health (grant no. GM076420 to Y.X.), by the Natural Science Foundation of China (grant no. 30670178 to X.G.), and by the Shanghai Pujiang Program (grant no. 06PJ14005 to X.G.).
2 These authors contributed equally to the article.
3 Present address: College of Bioengineering, Inner Mongolia Agricultural University, Huhhot, Inner Mongolia 010018, China. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Yiji Xia (yxia{at}danforthcenter.org).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.103374 * Corresponding author; e-mail yxia{at}danforthcenter.org.
Alexander WS, Hilton DJ (2004) The role of suppressors of cytokine signaling (SOCS) proteins in regulation of the immune response. Annu Rev Immunol 22: 503–529[CrossRef][ISI][Medline] Alvarez ME, Pennell RI, Meijer PJ, Ishikawa A, Dixon RA, Lamb C (1998) Reactive oxygen intermediates mediate a systemic signal network in the establishment of plant immunity. Cell 92: 773–784[CrossRef][ISI][Medline] Bartsch M, Gobbato E, Bednarek P, Debey S, Schultze JL, Bautor J, Parker JE (2006) Salicylic acid-independent ENHANCED DISEASE SUSCEPTIBILITY1 signaling in Arabidopsis immunity and cell death is regulated by the monooxygenase FMO1 and the Nudix hydrolase NUDT7. Plant Cell 18: 1038–1051 Belkhadir Y, Subramaniam R, Dangl JL (2004) Plant disease resistance protein signaling: NBS-LRR proteins and their partners. Curr Opin Plant Biol 7: 391–399[CrossRef][ISI][Medline] Bessman MJ, Frick DN, O'Handley SF (1996) The MutT proteins or "Nudix" hydrolases, a family of versatile, widely distributed, "housecleaning" enzymes. J Biol Chem 271: 25059–25062 Bobalova J, Bobal P, Mutafova-Yambolieva VN (2002) High-performance liquid chromatographic technique for detection of a fluorescent analogue of ADP-ribose in isolated blood vessel preparations. Anal Biochem 305: 269–276[CrossRef][ISI][Medline] Boch J, Joardar V, Gao L, Robertson TL, Lim M, Kunkel BN (2002) Identification of Pseudomonas syringae pv. tomato genes induced during infection of Arabidopsis thaliana. Mol Microbiol 44: 73–88[CrossRef][ISI][Medline] Cameron RK, Dixon RA, Lamb CJ (1994) Biologically induced systemic acquired resistance in Arabidopsis thaliana. Plant J 5: 715–725[CrossRef][ISI] Cao H, Bowling SA, Gordon AS, Dong X (1994) Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6: 1583–1592[Abstract] Conyers GB, Bessman MJ (1999) The gene, ialA, associated with the invasion of human erythrocytes by Bartonella bacilliformis, designates a nudix hydrolase active on dinucleoside 5'-polyphosphates. J Biol Chem 274: 1203–1206 Dangl JL, Jones JD (2001) Plant pathogens and integrated defence responses to infection. Nature 411: 826–833[CrossRef][Medline] Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gut-Rella M, Kessmann H, Ward E, et al (1994) A central role of salicylic acid in plant disease resistance. Science 266: 1247–1250 Durner J, Wendehenne D, Klessig DF (1998) Defense gene induction in tobacco by nitric oxide, cyclic GMP, and cyclic ADP-ribose. Proc Natl Acad Sci USA 95: 10328–10333 Eulgem T (2005) Regulation of the Arabidopsis defense transcriptome. Trends Plant Sci 10: 71–78[CrossRef][ISI][Medline] Foyer CH, Noctor G (2005) Redox homeostasis and antioxidant signaling: a metabolic interface between stress perception and physiological responses. Plant Cell 17: 1866–1875 Gasser A, Guse AH (2005) Determination of intracellular concentrations of the TRPM2 agonist ADP-ribose by reversed-phase HPLC. J Chromatogr B Analyt Technol Biomed Life Sci 821: 181–187[ISI][Medline] Glazebrook J, Rogers EE, Ausubel FM (1997) Use of Arabidopsis for genetic dissection of plant defense responses. Annu Rev Genet 31: 547–569[CrossRef][ISI][Medline] Gomez-Gomez L, Boller T (2002) Flagellin perception: a paradigm for innate immunity. Trends Plant Sci 7: 251–256[CrossRef][ISI][Medline] Griffith OW (1980) Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Anal Biochem 106: 207–212[CrossRef][ISI][Medline] Hammond-Kosack KE, Parker JE (2003) Deciphering plant-pathogen communication: fresh perspectives for molecular resistance breeding. Curr Opin Biotechnol 14: 177–193[CrossRef][ISI][Medline] Hara Y, Wakamori M, Ishii M, Maeno E, Nishida M, Yoshida T, Yamada H, Shimizu S, Mori E, Kudoh J, et al (2002) LTRPC2 Ca2+-permeable channel activated by changes in redox status confers susceptibility to cell death. Mol Cell 9: 163–173[CrossRef][ISI][Medline] Jambunathan N, Mahalingam R (2006) Analysis of Arabidopsis growth factor gene 1 (GFG1) encoding a nudix hydrolase during oxidative signaling. Planta 224: 1–11[CrossRef][ISI][Medline] Jones JD, Dangl JL (2006) The plant immune system. Nature 444: 323–329[CrossRef][Medline] Klaus SM, Wegkamp A, Sybesma W, Hugenholtz J, Gregory JF III, Hanson AD (2005) A nudix enzyme removes pyrophosphate from dihydroneopterin triphosphate in the folate synthesis pathway of bacteria and plants. J Biol Chem 280: 5274–5280 Kobayashi KS, Flavell RA (2004) Shielding the double-edged sword: negative regulation of the innate immune system. J Leukoc Biol 75: 428–433 Koebnik R, Kruger A, Thieme F, Urban A, Bonas U (2006) Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes. J Bacteriol 188: 7652–7660 Laxalt AM, Munnik T (2002) Phospholipid signalling in plant defence. Curr Opin Plant Biol 5: 332–338[CrossRef][ISI][Medline] Maksel D, Guranowski A, Ilgoutz SC, Moir A, Blackburn MG, Gayler KR (1998) Cloning and expression of diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase from Lupinus angustifolius L. Biochem J 329: 313–319[ISI][Medline] Matsumura H, Miyachi S (1980) Cycling assay for nicotinamide adenine dinucleotides. Methods Enzymol 69: 465–470 Mildvan AS, Xia Z, Azurmendi HF, Saraswat V, Legler PM, Massiah MA, Gabelli SB, Bianchet MA, Kang LW, Amzel LM (2005) Structures and mechanisms of Nudix hydrolases. Arch Biochem Biophys 433: 129–143[CrossRef][ISI][Medline] Mitchell S, Minnick M (1995) Characterization of a two-gene locus from Bartonella bacilliformis associated with the ability to invade human erythrocytes. Infect Immun 63: 1552–1562[Abstract] Moorhead GB, Meek SE, Douglas P, Bridges D, Smith CS, Morrice N, MacKintosh C (2003) Purification of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays. Eur J Biochem 270: 1356–1362[ISI][Medline] Mukaihara T, Tamura N, Murata Y, Iwabuchi M (2004) Genetic screening of Hrp type III-related pathogenicity genes controlled by the HrpB transcriptional activator in Ralstonia solanacearum. Mol Microbiol 54: 863–875[CrossRef][ISI][Medline] Nawrath C, Heck S, Parinthawong N, Metraux JP (2002) EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. Plant Cell 14: 275–286 Noctor G (2006) Metabolic signalling in defence and stress: the central roles of soluble redox couples. Plant Cell Environ 29: 409–425[CrossRef][Medline] Ogawa T, Ueda Y, Yoshimura K, Shigeoka S (2005) Comprehensive analysis of cytosolic Nudix hydrolases in Arabidopsis thaliana. J Biol Chem 280: 25277–25283 Olejnik K, Kraszewska E (2005) Cloning and characterization of an Arabidopsis thaliana Nudix hydrolase ho | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||