|
|
||||||||
|
First published online August 31, 2007; 10.1104/pp.107.101428 Plant Physiology 145:411-425 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Nonadditive Expression and Parent-of-Origin Effects Identified by Microarray and Allele-Specific Expression Profiling of Maize Endosperm1,[W],[OA]Center for Plant and Microbial Genomics, Department of Plant Biology, University of Minnesota, St. Paul, Minnesota 55108
Plant endosperm cells have a nuclear ratio of two maternal genomes to one paternal genome. This 2 to 1 dosage relationship provides a unique system for studying the additivity of gene expression levels in reciprocal hybrids. A combination of microarray profiling and allele-specific expression analysis was performed using RNA isolated from endosperm tissues of maize (Zea mays) inbred lines B73 and Mo17 and their reciprocal hybrids at two developmental stages, 13 and 19 d after pollination. The majority of genes exhibited additive expression in reciprocal hybrids based on microarray analyses. However, a substantial number of genes exhibited nonadditive expression patterns, including maternal like, paternal like, high parent like, low parent like, and expression patterns outside the range of the parental inbreds. The frequency of hybrid expression patterns outside of the parental range in maize endosperm tissue is much higher than that observed for vegetative tissues. For a set of 90 genes, allele-specific expression assays were employed to monitor allelic bias and regulatory variation. Eight of these genes exhibited evidence for maternally or paternally biased expression at multiple stages of endosperm development and are potential examples of differential imprinting. Our data indicate that parental effects on gene expression are much stronger in endosperm than in vegetative tissues.
Endosperm tissue, a terminally differentiated tissue that functions as the storage organ of the seed and provides a large proportion of the world's food supply, provides a unique system for studying the effect of gene dosage on expression levels in reciprocal hybrids. The endosperm is a triploid tissue produced from the double-fertilization event in plants and consists of two maternal genomes and one paternal genome (denoted 2m:1p). This unbalanced dosage of the maternal and paternal genomes provides a controlled biological system for studying the effects of allelic dosage and parental effects on gene expression.
Studies of F1 hybrid vegetative tissues from maize (Zea mays) have revealed high levels of additive (equal to the average of the two parents) expression with low levels of nonadditive (different from the average of the two parents) expression levels (Guo et al., 2006
A growing body of evidence suggests that the endosperm is subject to genetic mechanisms that differ from vegetative tissues. The most abundantly expressed mRNA gene families in the maize endosperm, the zein protein storage genes, exhibit variable expression patterns among gene family members and nonadditive expression patterns in F1 hybrid endosperm tissue (Woo et al., 2001
In this study, we investigated the gene expression of inbred and hybrid maize endosperm tissues at two developmental time points using the Affymetrix 18 K maize GeneChip microarray. We have found that endosperm tissues at both developmental stages exhibit a greater range of nonadditive expression in hybrids than was previously observed using the same experimental approaches in three vegetative tissues (Stupar and Springer, 2006
Affymetrix 18 K maize GeneChips were used to profile gene expression in three biological replicates of maize endosperm tissues isolated at 13 and 19 d after pollination (DAP) from B73, Mo17, and the reciprocal F1 crosses. The two developmental time points of 13 and 19 DAP were chosen based on the developmental program of the endosperm in maize (Kowles and Phillips, 1985
The four different endosperm genotypes can be represented as follows: BBB, MMM, BBM, and MMB (the first two letters represent the maternal contribution and the final letter represents the paternal contribution). The presence or absence of a given transcript was determined using MAS 5.0 data processing, as described previously (Stupar and Springer, 2006
Correlation plots indicate high levels of differential expression between the genotypes in both 13- and 19-DAP endosperm tissues (Supplemental Fig. S3). We performed statistical tests (ANOVA across the BBB, MMM, BBM, and MMB genotypes; see "Materials and Methods" for details) to identify genes that are differentially expressed among genotypes in 13- or 19-DAP tissues (Table I ). Following the statistical tests, the lists of differentially expressed genes were further filtered by imposing minimal expression (genotype with highest expression must have a microarray signal >50) and fold change (must be >2-fold change between any highest and lowest genotypes) criteria. These filtering criteria were employed to limit our set of differentially expressed genes to those with robust evidence for differential expression and to allow for classification of hybrid expression patterns as additive or nonadditive. Whereas it is likely that some examples of differential expression with less than 2-fold change are biologically significant, it is quite difficult to classify the specific mode of additive or nonadditive expression of such patterns using the tests described below.
A list of 1,725 genes meeting the statistical and filtering criteria were identified in 13-DAP endosperm (Supplemental Table S4) and 1,557 such genes were identified at 19-DAP endosperm (Supplemental Table S5). These 13- and 19-DAP endosperm gene lists were compared to determine their overlap (Table I). Approximately 60% of these genes (939) were identified in both 13- and 19-DAP endosperm tissue, indicating that many genes exhibit differential expression among genotypes at multiple stages of endosperm development. The vast majority of genes that were identified as differentially expressed in comparisons of these four genotypes were differentially expressed in B73 relative to Mo17 in both 13-DAP (97.4%) and 19-DAP (98.2%) endosperm (Table I). This indicates that there are relatively few examples of genes with similar expression in the inbred parents and novel expression states in one or both of the hybrids.
The use of microarrays to compare gene expression levels in different genotypes can be complicated by sequence polymorphisms in the regions detected by array features (Borevitz et al., 2003
An allele-specific detection platform (Jurinke et al., 2005 We proceeded to compare allele-specific expression data and microarray data for all 81 genes analyzed by both methods. The allele-specific expression data and the microarray data exhibited strong correlation between the two platforms (Supplemental Fig. S4C). However, a few genes displayed significant differences in the microarray data relative to allele-specific detection assays. In some cases, such as AI600480 and BM381185, the microarray data show much more severe differences in B73 relative to Mo17 than is detected by allele-specific assays. This may be the result of polymorphisms that affect the hybridization of one of the alleles to the array. In other instances, such as CA403984 and CF009268, analysis of both 13- and 19-DAP tissues finds evidence for strong allelic bias with relatively little differential signal between B73 and Mo17 on the microarrays. The general finding from these cross-platform comparisons was that both platforms found similar relative expression levels in B73 and Mo17 for the majority of genes with a few instances in which the two platforms do not agree.
Due to the 2m:1p genome dosage in the endosperm, we expected that the majority of genes would exhibit additive expression patterns in hybrid endosperm such that the hybrids are more similar to the maternal parent than to the paternal parent. Clustering analysis of the gene expression levels for all differentially expressed genes provided evidence that many genes exhibit this type of additive expression pattern reciprocal hybrid (Fig. 1 ). However, this clustering analysis reveals evidence for some groups of genes with specific types of nonadditive expression. For example, the gene expression profiles indicated by brackets in Figure 1A (and magnified in Fig. 1B) exhibited hybrid expression levels more similar to the paternal parent than the maternal parent. Statistical analyses of inbred and hybrid expression levels were used to identify the proportion of additive and nonadditive expression profiles. Each gene was tested by comparing the hybrid expression value against the expected additive expression value based on the parental expression, while factoring for the 2m:1p dosage (see "Materials and Methods"). Most genes (58.8%) in the 13-DAP endosperm tissues did not exhibit nonadditive patterns in either reciprocal hybrid; however, many genes (30.8%) exhibited nonadditive expression in one reciprocal hybrid and fewer (10.3%) exhibited nonadditive expression in both reciprocal hybrids. Similar proportions were identified in the 19-DAP endosperm tissues (61.1% were nonadditive in neither, 29.7% were nonadditive in one, and 9.1% were nonadditive in both reciprocal hybrids).
We defined 14 specific types of nonadditive expression that could occur in endosperm tissue (see "Materials and Methods" for definitions and descriptions of each class; sample visualizations are provided in Supplemental Fig. S5). A set of fold-change and statistical significance criteria (as described in Supplemental Table S6) were applied to all 13- and 19-DAP differentially expressed genes to identify genes with strong evidence for any of the 14 different classes of nonadditive expression (Table II ). Note that many of the genes that exhibit nonadditive expression (based on a per-gene test for additivity) do not classify into these 14 specific types of nonadditive expression.
We identified a total of 306 genes (out of 2,343 differentially expressed genes tested) belonging to one of the 14 specific types of nonadditive expression in at least one endosperm developmental stage (Supplemental Table S7). Despite the use of relatively stringent filters, the MLE patterns were the most prevalent type of nonadditive expression observed (Table II). Expression patterns with one hybrid outside the range of the parents, either above the high parent (AHP) or below the low parent (BLP), were also relatively common. PLE and hybrid expression outside the range of the parents in opposite directions (AHP and BLP) were rarely detected. We did not find any examples with consistent AHP or BLP expression patterns in both hybrids (Table II). To further assess and confirm whether the same patterns of nonadditive expression were consistently observed for a gene at both 13 and 19 DAP, we visually inspected the relative transcript levels for the four genotypes at both 13 and 19 DAP to determine whether the same type of nonadditive expression patterns were consistently observed for a gene at both developmental stages (Supplemental Figs. S5–S12). We observed consistent evidence for a similar pattern of nonadditive expression at both stages of development for many of these genes.
Previous studies have identified unique expression phenomena in endosperm tissues (see introduction). We utilized previously published microarray data on 11-d seedling and immature ear tissues (Stupar and Springer, 2006 Figure 2, A and B , shows the distribution of d/a values for genes exhibiting differential expression in endosperm and vegetative tissues (11-d seedling and immature ear), respectively. As expected, the maternal and paternal hybrid endosperm values centered on 0.33 and –0.33, respectively. The maternal and paternal hybrids in vegetative tissues exhibit a distribution centered on 0. The endosperm tissues exhibit a larger spread around the peak and display more values that are outside the parental range (above 1.0 or below –1.0). In Figure 2C, we have compared the d/a values for the reciprocal hybrids in endosperm and vegetative tissues; the d/a values for the maternal hybrid (relative to the higher expressing parent) are on the y axis and the d/a values for the paternal hybrid are on the x axis. Genes that plot within the black square represent genes that exhibit hybrid expression values within the range of the parents. Deviation toward the top left (MLE) and bottom right (PLE) indicates parental effects on hybrid expression levels. Deviation toward the top right (HP) and bottom left (LP) indicates hybrid expression patterns that are consistently toward the high or low expressing parent. Whereas the majority of data points are near the expected additive values for both tissue types, there are numerous points that exhibit deviation from this center. Interestingly, there is much greater evidence for parental effects in endosperm than in vegetative tissues (the distribution of nonadditive endosperm genes tend to plot from PLE to MLE, whereas the distribution of nonadditive vegetative genes tend to plot from HP to LP). To further compare nonadditive expression patterns in endosperm and vegetative tissues, we determined the number of genes in the 14 specific nonadditive expression classes (described above) in seedling and immature ear tissues. The total percentage of genes with nonadditive expression in both hybrids was similar in endosperm and vegetative tissues (Table III ). However, as was observed in the d/a plot (Fig. 2B), vegetative tissues display a markedly different distribution of nonadditive expression patterns with essentially no examples of nonadditive expression influenced by the parent of origin (Table III). Many of the nonadditive expression patterns in hybrid vegetative tissues are examples of HP or LP (Table III).
Allelic Variation Affecting Expression Levels of the B73 and Mo17 Alleles We were interested in further studying the maternal and paternal contributions to gene expression in developing endosperm tissue. Whereas the microarray hybridizations were quite useful for assessing the steady-state transcript levels, they did not provide information on the relative expression of the maternal and paternal alleles. Allele-specific expression assays can be used to determine the ratio of maternal and paternal transcripts. A set of 90 quantitative allele-specific expression assays were derived from 72 randomly selected endosperm-expressed genes, 15 genes with differential expression in B73 relative to Mo17 (according to statistical analysis of the Affymetrix data), and three genes with observed nonadditive expression in the microarray data, including two MLE and one PLE gene (see "Materials and Methods" for further details on assay development). Many (81/90) of these allele-specific expression assays represented genes that are also on the Affymetrix maize GeneChip; data from these genes were initially used to assess the prevalence of differential expression of the B73 and Mo17 genes in 13- and 19-DAP endosperm of inbred plants (see section above on cross-platform validation of microarray data and tests for sequence polymorphism effects).
For differentially expressed genes, it is possible to evaluate the relative contribution of cis- and trans-acting regulatory variation by comparing the allele-specific expression ratios in F1 hybrids relative to mixes of the parental RNA (Wittkopp et al., 2004
We assessed regulatory variation for a set of 46 genes that exhibit evidence for differential expression in both microarray and allele-specific expression analyses (including 21 genes with >2-fold change). This included 19 genes with differential expression in both 13- and 19-DAP tissue, 11 genes with differential expression only in 13-DAP tissue, and 16 genes with differential expression only in 19-DAP tissue. A series of statistical tests (as described in Stupar and Springer, 2006
We investigated developmental effects on allelic expression ratios by comparing the transcribed allelic ratios in 13- and 19-DAP hybrid endosperm. Previous studies have demonstrated variation in allelic bias in different tissues or environmental conditions (Guo et al., 2004
Differential Imprinting in Hybrid Endosperms The availability of allele-specific expression data from reciprocal hybrid endosperm tissue allowed us to address the prevalence of parental effects on the relative expression of the two alleles, or imprinting. As a control to determine the noise in a comparison of reciprocal hybrids using this technique, we first compared the B73:Mo17 allelic proportions in a 2:1 mix relative to a 1:2 mix of B73 to Mo17 RNA (Fig. 5A ). This comparison between 2:1 and 1:2 mixes of inbred RNA simulates a situation in which hybrid endosperms will exhibit biallelic, nonimprinted expression of the two alleles. For any given gene, the proportions of the B73 allele present in the 2:1 and 1:2 inbred mixes are necessarily dependent upon one another and will theoretically plot along the curve displayed in Figure 5A (labeled as the biallelic curve). The control comparison plotted in Figure 5A represents an estimate of the degree of variance from the biallelic curve that can be attributed to the experimental approach. Whereas we observed some instances of assays deviating from the curve (toward the underside, in particular), the majority of the experimental data exhibit a trend similar to the expected biallelic curve.
Allele-specific expression analysis was performed on the reciprocal hybrid RNA and a similar graph was produced (Fig. 5B). In this graph, genes that plot along the curve displayed biallelic patterns, genes that plot above the curve toward the top left displayed biased expression of the maternal alleles in both hybrids, and genes that plot below the curve toward the bottom right displayed biased expression of the paternal alleles in both hybrids. Our data indicate that 82 of the 90 genes displayed biallelic expression patterns along or near the curve at both 13- and 19-DAP time points. However, eight of the 90 genes consistently displayed either maternally or paternally biased allelic expression in both the 13- and 19-DAP endosperms (Fig. 5B). Interestingly, only one of these eight genes, BM347950, was a gene that was selected based on displaying nonadditive expression. The other two nonadditive genes for which we performed allele-specific expression assays each displayed allelic expression patterns bias along the biallelic curve. Two genes, AY111942 and CF628018, displayed maternally biased expression in reciprocal hybrids at both 13 and 19 DAP. In both cases, there was also evidence for low levels of expression from the paternal allele, suggesting that these are cases of differential imprinting. We proceeded to confirm the maternally biased expression for both of these genes using cleaved amplified polymorphic sequence (CAPS) assays on the same RNA samples used for the single-nucleotide polymorphism-based analyses (Fig. 6 ). For each of the 12 samples, the maternal allele is highly enriched, but there are low levels of paternal allele present. We proceeded to determine whether this differential imprinting could be consistently observed throughout endosperm development. RNA samples isolated from a series of endosperm tissue samples collected between 10 and 24 DAP were analyzed using the CAPS assays (Fig. 6). The gene CF628019, a putative polygalacturonase-inhibiting protein, exhibits evidence for differential imprinting in most of the samples analyzed. However, there is evidence for an increase in the expression of the paternal allele in some of the samples from later developmental time points (22 DAP in BBM; 16, 18, and 22 DAP in MMB). Similar results are obtained for the putative sugar transporter gene AY111942; differential imprinting (low levels of paternal allele observed) in some samples and potentially biallelic expression in other samples. There was not a strict developmental relationship that was observed such that imprinting was becoming more or less pronounced in later time points for this gene. Instead, there is evidence for variable parent-of-origin effects on the expression level of the maternal and paternal alleles of this gene.
Six genes exhibited consistent evidence for biased expression of the paternal allele in reciprocal hybrid endosperm tissue at 13 and 19 DAP. For each of these genes, we were able to detect expression of both the maternal and paternal alleles. However, instead of being expressed in a manner consistent with the 2:1 allelic dosage, we observed similar allelic ratios between the reciprocal hybrids. Allele-specific assays performed on endosperm DNA controls confirm that the 2:1 allelic dosage is maintained in genomic DNA. These genes are potential examples of differential imprinting favoring the paternal allele or may be genes that are subject to dosage compensation. These genes include a putative zinc-dependent protease, a putative casein kinase, a putative lipoxygenase, a ubiquitin-associated domain protein, and two hypothetical proteins.
The endosperm tissue plays an important role in seed development in angiosperms and is a critical part of the world's food supply. Despite this importance, we still have a limited understanding of the basic processes that affect gene expression patterns in the endosperm. The endosperm expression profiles in this study were compared with previous profiling experiments using maize vegetative tissues (Stupar and Springer, 2006
Most of the differentially expressed genes in our study exhibited additive levels of gene expression in hybrid endosperm tissues. However, approximately 10% of the differentially expressed genes exhibit nonadditive expression in both reciprocal hybrids (Table III). Some of these genes with nonadditive expression could be classified into nonadditive expression patterns that can be divided into four main categories: MLE, PLE, dominant patterns (HP and/or LP), and hybrid outside the range of the parents (AHP and/or BLP). For each category, we will provide a short description and discuss potential mechanisms that could be involved.
MLE patterns, defined here as reciprocal hybrid expression levels that are each statistically indistinguishable from the maternal parent, were the most common type of nonadditive expression in endosperm tissue. There are several potential mechanisms that might account for MLE patterns. Binary or differential imprinting of a gene that is differentially expressed in B73 relative to Mo17 may produce a MLE pattern (Dilkes and Comai, 2004 PLE patterns, classified here as reciprocal hybrid expression levels that are more similar to the paternal parent than to the maternal parent, were much more rare than MLE patterns, occurring in only 12 genes (<0.5%) of the differentially expressed gene subset. PLE patterns may be the result of paternal imprinting or may result from complex interactions between the two parental genomes. Allele-specific expression for one of the PLE genes identified in this study, BM347950, indicated an expression bias for the paternal allele in hybrid maize endosperm, suggesting differential imprinting for this gene.
It is worthwhile to note the limitations in using microarray expression profiling for the discovery of imprinted expression. MLE and PLE patterns do not necessarily imply imprinting and many genes with imprinted expression will not be classified as MLE or PLE. Microarray expression profiling can only classify MLE or PLE patterns when the gene is differentially expressed in the two parental genotypes. Therefore, examples of imprinting in which the gene is expressed at similar levels in the two parents will not be classified as MLE. Indeed, the two genes in our study with differential maternal imprinting displayed roughly equivalent microarray expression levels in both parental inbreds and therefore could not be assessed for MLE or PLE patterns. Current hypotheses suggest that imprinting may function as a mechanism for controlling the expression level for the imprinted genes (Dilkes and Comai, 2004 Dominant HP and LP expression patterns were observed for a set of 44 genes in 13- and/or 19-DAP endosperm. Genes were classified as dominant HP or LP expression patterns if both reciprocal hybrids display expression levels that were not statistically different from the HP or LP level, respectively. These genes are putative examples in which the expression level might be controlled by a dominant trans-acting regulator. Cases in which both hybrids are expressed at the level of the HP may be examples of variation in which one of the two inbreds possesses a dominant trans-acting activator. Conversely, expression of both hybrids at the level of the LP may stem from variation in which one of the two inbreds possesses a dominant trans-acting repressor.
Some genes exhibited hybrid endosperm expression levels that were outside the parental range, either AHP or BLP. In some studies, these genes have been referred to as overdominant or underdominant expression patterns. We have avoided the use of these terms because they are often used to refer to the genetic action of a locus; thus, the application of these terms to both expression patterns and gene action may be nonsynonymous (Springer and Stupar, 2007a
Dilkes and Comai (2004) It is likely that there are relatively few characterized examples of differential imprinting because such discoveries require reliable quantitative allele-specific expression analyses. The use of mass spectrometry-based allele-specific analysis provides a highly quantitative assay for studying the relative expression of two alleles in the same individual. Using this technique, we studied the relative expression of 90 genes for which quantitative assays were available. Interestingly, we found evidence to suggest differential imprinting for eight of these genes. Six cases reflect examples of paternal bias and two cases are examples of maternal bias. Further characterization of the two maternally biased genes provided additional evidence for differential imprinting. However, there is also evidence for some variability in the strength of the parent-of-origin effects for both of these genes. We did not perform further characterization on the examples of putative paternal differential imprinting. Each of these six cases resulted in a change from the expected 2m:1p ratio to an observed approximately 1m:1p ratio (Fig. 5). CAPS markers are not sufficiently quantitative to accurately discriminate between allelic proportions of 0.66 and 0.50. However, for each of these six genes, we observed a consistent paternal bias in both 13 and 19 DAP in all biological replicates studied.
Our data indicate that differential imprinting may be more common than binary imprinting in maize endosperm, raising new questions about the molecular mechanisms that may generate high rates of differential imprinting. There is evidence that imprinting in maize may be caused by allele-specific modifications within relatively small regions (Gutierrez-Marcos et al., 2006
Several studies have documented prevalent additive expression in maize hybrids (Guo et al., 2006
The dosage imbalance between the maternal and paternal genomes may contribute to the novel types of expression observed in endosperm tissue. The types of nonadditive expression observed in endosperm suggest that dosage compensation mechanisms in endosperm tissues differ from those in vegetative tissues. Studies of dosage dependence and gene expression in aneuploids have noted differences in the response of endosperm and embryo tissues (Guo and Birchler, 1994
In this study, we have found that additive patterns are the most common form of gene expression in hybrid endosperm; however, these additive patterns inherently generate expression differences between the reciprocal hybrids due to the unequal distribution of parental alleles in the triploid tissues. We have also observed numerous genes with novel hybrid expression patterns, with a far greater frequency of hybrid gene expression outside the parental range than had been previously observed in vegetative tissues. These observations highlight the exceptional diversity of gene expression in maize endosperm. Previous studies have documented unique genetic and epigenetic alterations that occur in the endosperm, including imprinting and altered DNA methylation patterns (Baroux et al., 2002
Microarray Platform 18 K oligonucleotide microarrays designed for detection of maize (Zea mays) genes were purchased from Affymetrix. This microarray was designed using EST contig sequences. There are 15 probes for each represented gene on the microarray and, in most cases, these probes are contiguous adjacent sequences of a transcript. The EST sequences are derived from multiple inbred lines and contain sequence polymorphisms. All polymorphic positions were masked such that, when possible, the probe sets will be robust for multiple genotypes. The maize Affymetrix array contains 17,622 probe sets that are designed to detect the expression of 13,495 genes. Some genes are represented by multiple probes sets designed to detect sense and antisense expression or the expression of alternative transcripts.
Endosperm tissues were isolated from kernels of inbreds MMM and BBB and hybrids MMB and BBM for gene expression analysis. Samples were collected during August 2005 from field-grown maize plants grown on the St. Paul campus Agricultural Experiment Station. Inbred and hybrid crosses were performed at three different dates to produce biological replicates. The crosses for all genotypes within a biological replicate were performed within 30 min of each other. Six ears of each genotype were harvested at 13 and 19 DAP per biological replicate. Six endosperms were collected from each of the six ears and pooled for a total of 36 endosperms from each genotype by biological replicate combination. All tissues were flash frozen in a dry-ice-cooled ethanol bath and subsequently stored at –80°C.
Information on the plant growth and tissue collection of 11-d seedling and immature ear tissues is described in Stupar and Springer (2006)
RNA for 13-DAP endosperm tissues was isolated using the plant RNeasy kit, according to the manufacturer's instructions (Qiagen). Initial isolation of 19-DAP endosperm RNA involved a combination of phenol-chloroform extraction and the TRIzol procedure, and essentially followed published methods (Leiva-Neto et al., 2004
The methods used to isolate RNA from 11-d seedling and immature ear tissues are described in Stupar and Springer (2006)
Microarray hybridizations were performed to assess the steady-state level of transcripts in endosperm tissue derived from two maize inbred lines and their reciprocal hybrids. Hybridizations for three biological replicates per tissue type were performed for each of four genotypes: inbreds MMM and BBB and hybrids MMB and BBM. Eight micrograms of total RNA were labeled for each hybridization according to the manufacturer's instructions (Affymetrix). Hybridization chemistries were performed at the University of Minnesota Microarray Facility. Previously published microarray data from 11-d seedling and immature ear tissues were obtained using the same methodologies (Stupar and Springer, 2006 The signal data from the microarrays was processed using two different methods, MAS 5.0 and GC-robust multiarray average (RMA). The GCOS software package (Affymetrix) was used to produce a MAS 5.0 signal and produce presence-absence calls. The signal from each array was normalized to a value of 1 with a scaling target factor of 500 and the default parameters. After importing the MAS 5.0 values into GeneSpring (Agilent Technologies), per-chip normalization to the fiftieth percentile and per-gene normalization to median were performed. GC-RMA processing of the signal was performed using GeneSpring software with per-gene normalization. Differentially expressed genes were identified by performing a one-way ANOVA on the GC-RMA or MAS 5.0 values using a parametric test with no assumption of equal variance. A Benjamini and Hochberg multiple testing correction was applied with a false-discovery rate of 0.05 (unless otherwise noted) such that 5% of the genes identified in a test are likely to be falsely identified. Separate ANOVAs were performed to identify genes that were differentially expressed among developmental stages and among genotypes. The lists of differentially expressed genes among genotypes were further filtered using minimal expression (genotype with highest expression must have signal >50) and fold change (must be >2-fold change between any two genotypes) criteria. Clustering analyses were performed using GeneSpring and were based on specified gene lists, conditions, and genotypes. Statistical analyses were performed on individual microarray probes to test for the possibility of probe-specific polymorphisms resulting in false discovery of differential expression. The individual probe signals were extracted and per-chip normalization was applied. For each differentially expressed gene, the difference between each of the 15 perfect match-mismatch probe signals was determined for each of the three biological replicates and used to perform an independent sample comparison of means assuming normality with a cutoff of P = 0.05. The number of probe pairs that pass this test for each gene was determined.
Genes that were present in the endosperm transcriptomes and absent in other tissue transcriptomes were identified based on the MAS 5.0 presence-absence calls. BLAST analyses were performed using these sequences to query the National Center for Biotechnology Information genome survey sequences derived from maize. Primers were designed using primer 3 software (Rozen and Skaletsky, 2000
All genes that were determined to be differentially expressed among genotypes based on ANOVA (analysis described above) were investigated for nonadditive expression patterns. The inbred expression values were used to calculate the expected additive expression level of each reciprocal hybrid. To account for the 2m:1p endosperm dosage, the expected additive values were calculated as: additive expression = [(2 x maternal expression level) + paternal expression level]/3. The expected additive values were compared with the appropriate reciprocal hybrid values for all three biological replications. A two-tailed homoscedastic t test was performed and all genes with P < 0.05 were considered to be nonadditively expressed. Both reciprocal hybrids were independently tested for each gene. The nonadditive patterns were divided into six general classes. (1) PLE, genes that exhibit hybrid transcription levels similar to the male parent; (2) MLE, genes that exhibit hybrid transcription levels that are more similar to the female parent than intermediate levels; (3) HP, genes that exhibit expression patterns in which both hybrids are similar to the HP; (4) LP, genes that exhibit expression patterns in which both hybrids are similar to the LP; (5) AHP, genes in which at least one hybrid is expressed AHP; (6) BLP, genes in which at least one hybrid is expressed BLP. We defined 14 nonadditive expression patterns that a given gene may exhibit among the four genotypes in this study (see Supplemental Fig. S5). There is one pattern that fits the PLE class, one pattern that fits the MLE classes, two different patterns that fit the HP class, two patterns that fit the LP class, and eight patterns that fit the AHP and/or BLP classes. A stringent procedure (see Supplemental Table S6) was applied to assign the nonadditive genes into the 14 classes based on the microarray data. The d/a ratios were calculated for all genes differentially expressed among genotypes, such that the d/a value would indicate the hybrid expression relative to the HP and LP values for each gene. The d value was calculated as the hybrid signal minus the average signal of the two parents. The a value was calculated as the HP signal minus the average signal of the two parents (thus the a value is equivalent to the absolute value of the difference between either parent and the average of the two parents). Genes with d/a values >1.0 or <–1.0 indicated genes with hybrid expression levels AHP or BLP, respectively. For each gene, a d/a value was calculated for the maternal hybrid, which is the hybrid genotype derived by crossing the genotype with the higher expression as the female parent to the genotype with the lower expression as the male parent. Similarly, a d/a value was calculated for the paternal hybrid, which is the reciprocal hybrid that is generated by crossing the lower expression genotype (as a female) by the higher expression genotype (as a male).
A series of allele-specific expression assays were designed to further investigate expression patterns in endosperm tissue. Allele-specific expression assays are quite useful for determining the relative contribution of the maternal and paternal allele to the total level of transcript for a particular gene, whereas microarray hybridizations assess total transcript levels. Allele-specific expression assays were designed for a set of 208 genes that were selected either at random (176 genes), due to differential expression in B73 relative to Mo17 (25 genes), or because they exhibited nonadditive expression levels in reciprocal hybrids (seven genes). The evidence for differential or nonadditive expression was derived from the Affymetrix microarray experiments described above. The single-nucleotide polymorphisms used to design these assays were derived from Panzea (Zhao et al., 2006
RNA from all tissues was treated with DNAse prior to allele-specific expression analyses. cDNA was synthesized from all three biological replicates of Mo17 x B73 and B73 x Mo17 hybrid RNA from both 13- and 19-DAP endosperms. cDNA was also synthesized from 2:1 and 1:2 mixes of Mo17 and B73 inbred RNA for both 13- and 19-DAP endosperms; these mixed cDNAs were made from all three biological replicates. The cDNA was reverse transcribed using SuperScript III reverse transcriptase, according to the manufacturer's instructions (Invitrogen).
PCR-based assays for allele-specific expression analyses were standardized and performed as described (Stupar and Springer, 2006
CAPS assays were designed to validate biased maternal allele expression for two genes. Reverse transcription (RT)-PCR was performed on the same cDNA templates from 13- and 19-DAP hybrid endosperm samples as were used in the allele-specific expression analyses (described above). Additionally, RT-PCR was performed on cDNA samples synthesized from individual hybrid endosperm tissues from six different developmental stages between 10 and 24 DAP. The primers used for gene CF628018 (a putative polygalacturonase-inhibiting protein): CGTGGAACTACCTCAACTTCGAC (forward) and ACACGTACACAGCTGTCATTTCG (reverse). RT-PCR products from gene CF628018 were digested with enzyme Bme1580I (New England Biolabs), which has a restriction site in the amplicon of the Mo17 allele but does not recognize the B73 allele. The CAPS products were evaluated using agarose gel electrophoresis. The primers used for gene AY111942 (a putative sugar transporter): AAGGAGAAGGTGGTGGAAATGTC (forward) and TTCGTTGAGAGGGAATTTTCTTG (reverse). RT-PCR products from gene AY111942 were digested with enzyme PleI (New England Biolabs), which has a differential restriction sites for the B73 and Mo17 allele amplicons. The CAPS products were evaluated on high-resolution Metaphor gels. The microarray data generated for this study are available at Gene Expression Omnibus (GEO). The endosperm microarray data can be accessed under series accession number GSE8308 and the embryo, seedling, and immature ear microarray data can be accessed under series accession number GSE8194.
The following materials are available in the online version of this article.
We would like to thank Irina Makarevitch, Elizabeth Chrans, and Dinesha Walek for providing technical help with sample preparation and/or data collection. The Minnesota Supercomputing Institute provided access to software packages used for data analysis. We are very grateful to Shawn Kaeppler and Ronald Phillips for providing invaluable discussions and feedback. We also appreciate the comments and suggestions of four anonymous reviewers and the journal editor. Received April 23, 2007; accepted August 24, 2007; published August 31, 2007.
1 This work was supported by the National Science Foundation (grant no. DBI–0227310) and the Minnesota Agriculture Experiment Station (grant to N.M.S.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Nathan M. Springer (springer{at}umn.edu).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.101428 * Corresponding author; e-mail springer{at}umn.edu.
Adams KL (2007) Evolution of duplicate gene expression in polyploid and hybrid plants. J Hered 98: 136–141 Adams KL, Wendel JF (2005) Allele-specific, bidirectional silencing of an alcohol dehydrogenase gene in different organs of interspecific diploid cotton hybrids. Genetics 171: 2139–2142 Auger DL, Gray AD, Ream TS, Kato A, Coe EH Jr, Birchler JA (2005) Nonadditive gene expression in diploid and triploid hybrids of maize. Genetics 169: 389–397 Baroux C, Pecinka A, Fuchs J, Schubert I, Grossniklaus U (2007) The triploid endosperm genome of Arabidopsis adopts a peculiar, parental, dosage-dependent chromatin organization. Plant 19: 1782–1794 Baroux C, Spillane C, Grossniklaus U (2002) Genomic imprinting during seed development. Adv Genet 46: 165–214[Web of Science][Medline] Birchler JA, Veitia RA (2007) The gene balance hypothesis: from classical genetics to modern genomics. Plant Cell 19: 395–402 Borevitz JO, Liang D, Plouffe D, Chang HS, Zhu T, Weigel D, Berry CC, Winzeler E, Chory J (2003) Large-scale identification of single-feature polymorphisms in complex genomes. Genome Res 13: 513–523 Dilkes BP, Comai L (2004) A differential dosage hypothesis for parental effects in seed development. Plant Cell 16: 3174–3180 Emrich SJ, Barbazuk WB, Li L, Schnable PS (2007) Gene discovery and annotation using LCM-454 transcriptome sequencing. Genome Res 17: 69–73 Feil R, Berger F (2007) Convergent evolution of genomic imprinting in plants and mammals. Trends Genet 23: 192–199[CrossRef][Web of Science][Medline] Gehring M, Choi Y, Fischer RL (2004) Imprinting and seed development. Plant Cell 16: S203–S213 Guo M, Birchler JA (1994) Trans-acting dosage effects on the expression of model gene systems in maize aneuploids. Science 266: 1999–2002 Guo M, Rupe MA, Danilevskaya ON, Yan X, Hu Z (2003) Genome-wide mRNA profiling reveals heterochronic allelic variation and a new imprinted gene in hybrid maize endosperm. Plant J 36: 30–44[CrossRef][Web of Science][Medline] Guo M, Rupe MA, Yang X, Crasta O, Zinselmeier C, Smith OS, Bowen B (2006) Genome-wide transcript analysis of maize hybrids: allelic additive gene expression and yield heterosis. Theor Appl Genet 113: 831–845[CrossRef][Web of Science][Medline] Guo M, Rupe MA, Zinselmeier C, Habben J, Bowen BA, Smith OS (2004) Allelic variation of gene expression in maize hybrids. Plant Cell 16: 1707–1716 Gutierrez-Marcos JF, Costa LM, Dal Pra M, Scholten S, Kranz E, Perez P, Dickinson HG (2006) Epigenetic asymmetry of imprinted genes in plant gametes. Nat Genet 38: 876–878[CrossRef][Web of Science][Medline] Haun WJ, Laoueille-Duprat S, O'Connell MJ, Spillane C, Grossniklaus U, Phillips AR, Kaeppler SM, Springer NM (2007) Genomic imprinting, methylation and molecular evolution of maize enhancer of zeste (Mez) homologs. Plant J 49: 325–337[CrossRef][Web of Science][Medline] Jurinke C, Denissenko MF, Oeth P, Ehrich M, van den Boom D, Cantor CR (2005) A single nucleotide polymorphism based approach for the identification and characterization of gene expression modulation using MassARRAY. Mutat Res 573: 83–95[Web of Science][Medline] Kirst M, Caldo R, Casati P, Tanimoto G, Walbot V, Wise RP, Buckler ES (2006) Genetic diversity contribution to errors in short oligonucleotide microarray analysis. Plant Biotechnol J 4: 489–498[Medline] Kowles RV, Phillips RL (1985) DNA amplification patterns in maize endosperm nuclei during kernel development. Proc Natl Acad Sci USA 82: 7010–7014 Lai J, Dey N, Kim CS, Bharti AK, Rudd S, Mayer KF, Larkins BA, Becraft P, Messing J (2004) Characterization of the maize endosperm transcriptome and its comparison to the rice genome. Genome Res 14: 1932–1937 Lauria M, Rupe M, Guo M, Kranz E, Pirona R, Viotti A, Lund G (2004) Extensive maternal DNA hypomethylation in the endosperm of Zea mays. Plant Cell 16: 510–522 Leiva-Neto JT, Grafi G, Sabelli PA, Dante RA, Woo YM, Maddock S, Gordon-Kamm WJ, Larkins BA (2004) A dominant negative mutant of cyclin-dependent kinase A reduces endoreduplication but not cell size or gene expression in maize endosperm. Plant Cell 16: 1854–1869 Meyer S, Pospisil H, Scholten S (2007) Heterosis associated gene expression in maize embryos 6 days after fertilization exhibits additive, dominant and overdominant pattern. Plant Mol Biol 63: 381–391[CrossRef][Web of Science][Medline] Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132: 365–386[Medline] Schweizer L, Yerk-Davis GL, Phillips RL, Srienc F, Jones RJ (1995) Dynamics of maize endosperm development and DNA endoreduplication. Proc Natl Acad Sci USA 92: 7070–7074 Song R, Messing J (2003) Gene expression of a gene family in maize based on non-collinear haplotypes. Proc Natl Acad Sci USA 100: 9055–9060 Springer NM, Stupar RM (2007a) Allelic variation and heterosis in maize: how do two halves make more than a whole? Genome Res 17: 264–275 Springer NM, Stupar RM (2007b) Allele-specific expression patterns reveal biases and embryo-specific parent-of-origin effects in hybrid maize. Plant Cell http://dx.doi.org/10.1105/tpc.107.052258 Stupar RM, Springer NM (2006) Cis-transcriptional variation in maize inbred lines B73 and Mo17 leads to additive expression patterns in the F1 hybrid. Genetics 173: 2199–2210 Swanson-Wagner RA, Jia Y, DeCook R, Borsuk LA, Nettleton D, Schnable PS (2006) All possible modes of gene action are observed in a global comparison of gene expression in a maize F1 hybrid and its inbred parents. Proc Natl Acad Sci USA 103: 6805–6810 Uzarowska A, Keller B, Piepho HP, Schwarz G, Ingvardsen C, Wenzel G, Lubberstedt T (2007) Comparative expression profiling in meristems of inbred-hybrid triplets of maize based on morphological investigations of heterosis for plant height. Plant Mol Biol 63: 21–34[CrossRef][Web of Science][Medline] Verza NC, Silva E, Neto TR, Nogueira GC, Fisch FT, de Rosa PH, Jr VE, Rebello MM, Vettore AL, da Silva FR, et al (2005) Endosperm-preferred expression of maize genes as revealed by transcriptome-wide analysis of expressed sequence tags. Plant Mol Biol 59: 363–374[CrossRef][Web of Science][Medline] West MA, Kim K, Kliebenstein DJ, van Leeuwen H, Michelmore RW, Doerge RW, St Clair DA (2007) Global eQTL mapping reveals the complex genetic architecture of transcript-level variation in Arabidopsis. Genetics 175: 1441–1450 Wittkopp PJ, Haerum BK, Clark AG (2004) Evolutionary changes in cis and trans gene regulation. Nature 430: 85–88[CrossRef][Medline] Woo YM, Hu DW, Larkins BA, Jung R (2001) Genomics analysis of genes expressed in maize endosperm identifies novel seed proteins and clarifies patterns of zein gene expression. Plant Cell 13: 2297–2317 Wood AJ, Oakey RJ (2006) Genomic imprinting in mammals: emerging themes and established theories. PLoS Genet 2: e147[CrossRef][Medline] Zhang MS, Yan HY, Zhao N, Lin XY, Pang JS, Xu KZ, Liu LX, Liu B (2007) Endosperm-specific hypomethylation, and meiotic inheritance and variation of DNA methylation level and pattern in sorghum (Sorghum bicolor L.) inter-strain hybrids. Theor Appl Genet 115: 195–207[CrossRef][Web of Science][Medline] Zhao W, Canaran P, Jurkuta R, Fulton T, Glaubitz J, Buckler E, Doebley J, Gaut B, Goodman M, Holland J, et al (2006) Panzea: a database and resource for molecular and functional diversity in the maize genome. Nucleic Acids Res 34: D752–D757 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|