|
|
||||||||
|
First published online September 20, 2007; 10.1104/pp.107.103689 Plant Physiology 145:875-889 (2007) © 2007 American Society of Plant Biologists A Proteinaceous Elicitor Sm1 from the Beneficial Fungus Trichoderma virens Is Required for Induced Systemic Resistance in Maize1,[W] 2Department of Plant Pathology and Microbiology, Texas A&M University, College Station, Texas 77843
We have previously shown that the beneficial filamentous fungus Trichoderma virens secretes the highly effective hydrophobin-like elicitor Sm1 that induces systemic disease resistance in the dicot cotton (Gossypium hirsutum). In this study we tested whether colonization of roots by T. virens can induce systemic protection against a foliar pathogen in the monocot maize (Zea mays), and we further demonstrated the importance of Sm1 during maize-fungal interactions using a functional genomics approach. Maize seedlings were inoculated with T. virens Gv29-8 wild type and transformants in which SM1 was disrupted or constitutively overexpressed in a hydroponic system or in soil-grown maize seedlings challenged with the pathogen Colletotrichum graminicola. We show that similar to dicot plants, colonization of maize roots by T. virens induces systemic protection of the leaves inoculated with C. graminicola. This protection was associated with notable induction of jasmonic acid- and green leaf volatile-biosynthetic genes. Neither deletion nor overexpression of SM1 affected normal growth or development of T. virens, conidial germination, production of gliotoxin, hyphal coiling, hydrophobicity, or the ability to colonize maize roots. Plant bioassays showed that maize grown with SM1-deletion strains exhibited the same levels of systemic protection as non-Trichoderma-treated plants. Moreover, deletion and overexpression of SM1 resulted in significantly reduced and enhanced levels of disease protection, respectively, compared to the wild type. These data together indicate that T. virens is able to effectively activate systemic disease protection in maize and that the functional Sm1 elicitor is required for this activity.
Plants in their natural settings are surrounded by a range of beneficial or deleterious microorganisms. By evolving mechanisms that enable recognition of the invader followed by production of an arsenal of antimicrobial and/or antiherbivory compounds, plants have the ability to localize and reduce the impact of the pathogen invasion (Paul et al., 2000
In addition to plant growth-promoting rhizobacteria, there is another group of root-colonizing beneficial microorganisms that have been found to induce plant resistance to pathogens. They represent the anamorphic stages of several fungi, including Trichoderma spp., Fusarium spp., binucleate Rhizoctonia, and Pythium oligandrum, and are commonly found in most soils throughout the world (Hwang and Benson, 2003
The highly coordinated molecular dialogue that occurs between plants and microbes during the early stages of their association, in which signaling molecules play an essential role, determines the final outcome of the relationship, which ranges from parasitism to mutualism (Bais et al., 2004
To obtain new insights into the events underlining the processes of plant-Trichoderma interactions, we previously identified and characterized an elicitor produced by Trichoderma virens named Sm1, a novel proteinaceous nonenzymatic elicitor from this group of rhizosphere-competent fungi (Djonovic et al., 2006a
Most of the molecular mechanisms that underlie the Trichoderma-mediated systemic induced resistance have been studied in dicot plants (Yedidia et al., 2003 In this study we aimed (1) to determine whether colonization of roots by T. virens can induce systemic protection against a foliar pathogen in the monocot maize (Zea mays); (2) to examine the requirement of a functional Sm1 for induction of systemic resistance in maize; (3) to elucidate the potential involvement of signaling pathways mediated by SA, JA, and other oxygenated fatty acids in the induced resistance of maize triggered by T. virens; and (4) to assess a number of phenotypic traits to address a potential role of Sm1 in the physiology of T. virens. This study provides compelling evidence that, similar to dicot plants, colonization of maize roots by T. virens induces ISR-like systemic protection of the leaves inoculated with Colletotrichum graminicola. Furthermore, our results demonstrate that Sm1 is required for activation of ISR in maize, since plants grown with SM1-deletion strains exhibited the same levels of systemic protection as the control (non-Trichoderma-treated) plants and, conversely, plants grown with SM1-overexpression strains displayed increased protection compared to the wild type.
Identification of SM1-Deletion and -Overexpression Transformants
Previously, we showed that a T. virens hydrophobin-like elicitor, Sm1, induced plant defense responses and provided high levels of systemic resistance against the foliar pathogen Colletotrichum sp. in cotton (Djonovic et al., 2006a
The overexpression vector pSZD26 was constructed for constitutive overproduction of the SM1 gene (Fig. 2A ). From 14 randomly selected putative overexpression transformants, 10 demonstrated the presence of the overexpression cassette based on PCR analysis (data not shown). These 10 candidates were further verified by Southern-blotting analysis. As Figure 2 demonstrates, the SM1 probe hybridized to the native gene, yielding a 4-kb and a 1.5-kb band in overexpression strains, as expected (Fig. 2B). The intensity of hybridization of the 1.5-kb band in some of the transformants, such as OE38 and OE39, suggests integration of multiple copies of the construct at one site, resulting in tandem repeats.
Expression of SM1 in Transformants Gene expression analysis was performed to test whether disruption or overexpression of the SM1 gene resulted in the expected alteration of transcript and protein accumulation. Northern-blot experiments showed no transcripts of SM1 in any of the deletion transformants (KO25, KO46, or KO70; Fig. 3A ). These results were further verified by western-blot analysis (Fig. 3B), confirming the successful replacement of the gene. Additionally, there was no obvious difference in the extracellular protein profile of the wild-type and deletion strains except for the absence of 12.6-kD Sm1 band in deletion strains (data not shown). Examination of the seven overexpression strains (OE8, OE9, OE24, OE38, OE39, OE126, and OE150) revealed higher SM1 mRNA levels than for the wild type after 3 d of growth in a complete medium (GYEC; Fig. 3C). Polypeptide levels for the overexpression strains (OE38 and OE39) with the highest SM1 mRNA levels were compared to the wild type by western-blot analysis. Both overexpression stains produced greater amounts of Sm1 than the wild type (Fig. 3D).
Phenotypic Analysis of Transformants A number of phenotypic assays were conducted with the gene-disruption, gene-overexpression, and wild-type strains to assess if the morphology and physiology of strains were affected by genetic manipulations of SM1.
There were no evident changes in the cultures of the deletion or overexpression transformants when compared to the wild type with respect to colony appearance and pigmentation during sporulation. We further assessed the possible involvement of SM1 in fungal growth under different nutritional conditions. Three disruptants, KO25, KO46, and KO70, and two overexpression strains, OE38 and OE39, were selected for growth analysis. Growth area was compared after 1 and 2 d growth on minimal (Vogel's minimal medium [Vogel, 1956
Since Sm1 is a hydrophobin-like protein, we further assessed the hydrophobicity of transformants by performing two different assays. In the first experiment, the hydrophobicity of the mycelia was visualized by placing water droplets on the T. virens strains growing on a solid agar medium (Fig. 4A
). The greater the contact angle of a droplet, the greater the hydrophobicity and vice versa (van der Mei et al., 1991
Genetic Manipulation of SM1 Results in Altered Local and Systemic Expression of a Defense-Related PAL Gene in Hydroponically Grown Maize
We have previously shown that colonization of cotton roots by T. virens resulted in an increased expression of PR genes (Djonovic et al., 2006a
Detection of Sm1 during Fungal-Maize Interaction in the Hydroponic System
As we have previously shown that Sm1 was abundantly secreted outside the cell in the presence of cotton seedlings (Djonovic et al., 2006a
To assess the in vivo biological relevance of T. virens to induce disease resistance in maize through Sm1 expression, wild-type strain, two deletion strains, and two overexpression strains were compared in their ability to systemically protect 2-week-old maize seedlings challenged with the foliar pathogen C. graminicola. Maize seedlings from T. virens-treated seed were inoculated with a spore suspension of the pathogen with disease assessment conducted 4 d following inoculation. In contrast to the typical large lesions that appeared earlier and had began to coalesce in the plants not treated with T. virens or plants treated with SM1-deletion strains, the lesions were significantly smaller in plants treated with either wild-type strain or SM1-overexpression strains. Disease protection due to treatment with overexpression strains was even more evident than with the wild type, as the lesions were much smaller, and development of some lesions was delayed or arrested (Fig. 6A ). The mean lesion area for the plants treated with the disruptant strains was significantly greater than wild-type or overexpression strains, but was the same as the nontreated control. Both overexpression strains increased disease protection as compared to the wild-type strain with OE38 significantly reducing lesion area (P < 0.05; Fig. 6B).
Colonization of Roots by T. virens Strains in Hydroponics and in Soil Is Not Affected by SM1 Deletion or Overexpression
As Sm1 is a hydrophobin-like protein and hydrophobins are known to be involved in several plant-fungal symbiotic interactions (Tagu et al., 2002
To further examine the colonization of maize seedlings roots by the wild-type and SM1-deletion strains, we generated T. virens wild-type and deletion strains expressing GFP. Southern analysis of genomic DNAs of transformants confirmed integration of the GFP and HPH (hygromycin B phosphotransferase gene) vectors, pTEFEGFP and pCSN44, respectively (data not shown). The growth rate and colony morphology of selected cotransformants were similar to the original strains as evaluated by growth comparison on various nutritional media (PDA, VMS, and WA plates). Six-day-old maize seedlings grown in the hydroponic system were examined for the pattern of colonization by these strains. The extent of colonization (fungal hyphae along the main root axis as well as encircling the roots) as well terminal and intercalary formation of chlamydospores appeared similar for both strains (Fig. 7 ).
Expression of Maize Defense Genes during T. virens-Induced Resistance to C. graminicola
To elucidate the potential involvement of signaling pathways mediated by SA, JA, and other octadecanoids in the induced resistance of maize triggered by T. virens, we examined the expression of nine well-characterized maize defense genes. The housekeeping gene, the cytosolic form of glycerol phosphate dehydrogenase (GAPc; Farag et al., 2005
The maize genes of the SA-responsive pathway examined were PR1 and PR5 (Morris et al., 1998
Since lipoxygenase (LOX) products such as jasmonates and other oxygenated fatty acids called oxylipins were implicated as signals in ISR (Conrath et al., 2006
LOX10 and HPL are most likely GLV-producing enzymes in maize (Nemchenko et al., 2006
It has been shown recently that several proteins that are involved in Trichoderma-plant early interaction are up-regulated during the interaction with plants but also expressed in planta (Viterbo et al., 2004
T. virens Induces Systemic Disease Resistance in Maize
Resistance responses triggered by defense-related signal compounds such as SA or its chemical analogs have been described in maize (Morris et al., 1998
The important component of local and systemic resistance induced by Trichoderma asperellum in cucumber plants (Yedidia et al., 2000
As we have shown that T. virens induces systemic resistance in maize, we further tested the hypothesis that deletion of SM1 in T. virens results in attenuated defense responses reducing the levels of protection against pathogen attack. Results from biological assays performed in this study support this hypothesis. We show that SM1-disruptant strains appear not to trigger ISR as plants grown with deletion strains exhibited similar levels of symptoms as control plants (non-Trichoderma-treated plants). Moreover, this effect was further supported by our results showing that SM1-overexpression strains induced even higher levels of protection than wild-type strain-treated plants (Fig. 6). The enhanced levels of protection with overexpression strain-treated plants may have resulted from the higher levels of production of Sm1 in overexpression strains compared to the wild type. This observation is in agreement with our previous finding that Sm1 secreted by the wild type was up-regulated in the presence of the plants compared to the growth in culture medium (Murashige and Skoog + 0.05% Suc) without the plants (Djonovic et al., 2006a All together, these data indicate that Sm1 is a key player for T. virens-induced systemic disease resistance in maize. To date, most studies report the effect of exogenous application of purified microbial elicitor on plant resistance. This study provides genetic evidence that an elicitor of defense response is required for ISR.
Since we demonstrated that root colonization of maize plants by T. virens Gv29-8 triggered systemic disease resistance, we sought to determine which defense-related pathways were associated with the observed protection. Considerable progress has been made recently to elucidate the molecular mechanisms involved in Trichoderma-induced systemic resistance; however, most of this work has been performed with dicot plants (Yedidia et al., 2003
We further tested the expression of the JA/ET-responsive and -biosynthetic genes in T. virens-mediated resistance responses. Expression of PAL has been reported to be activated by the JA/ET signaling pathway (Diallinas and Kanellis, 1994
Existing evidence has implicated 13-LOX-derived oxylipins, including jasmonates and GLVs, in plant resistance mechanisms against diverse pathogens and pests. Both jasmonates produced by the AOS branch of the LOX pathway, and GLVs, the derivatives of the HPL branch, have potent signaling activities that regulate expression of numerous defense-related and developmental genes (Bate and Rothstein, 1998 Taken together, the gene expression data suggest that T. virens induces systemic resistance in maize by an ISR-like mechanism involving JA/ET/GLV-mediated pathways rather than a SAR-like mechanism that requires SA.
The role of hydrophobins in several mutualistic symbioses has been reported previously (Honegger, 1991
While the colonization of roots by T. virens does not yield the elaborate hyphal structures seen with ectomycorrhizal fungi or the level of penetration as with arbuscular mycorrhizal fungi, an intimate association is formed that involves a signaling process (Yedidia et al., 2003
Sm1 is a member of a new cerato-platanin (Pazzagli et al., 1999 In summary, this study provides evidence that, similar to dicotyledonous plants, colonization of maize roots by T. virens induces ISR-like systemic protection associated with notable induction of JA- and GLV-biosynthetic genes. We also demonstrated that the activity of a functional Sm1 elicitor was required for T. virens-mediated ISR. The fact that overexpression of this gene led to enhanced levels of systemic protection suggests that genetic manipulation of fungal biocontrol agents or plants to express this elicitor may lead to improved crop resistance against pests.
Fungal and Plant Materials
Two strains of Trichoderma virens were used in this study, a wild-type strain, Gv29-8, and an Arg auxotrophic strain, Tv10.4, as the recipient for fungal transformation (Baek and Kenerley, 1998
Maize (inbred line B73) seedlings used in this study were grown in a hydroponic system (Djonovic et al., 2006a
To obtain the flanking regions of the SM1 ORF for construction of deletion strains, a clone with a high-molecular-mass insert was isolated from T. virens BAC library as described previously (Djonovic et al., 2006a
The SM1-disruption vector (pSZD25) was constructed by replacing a 483-bp ORF with a 3.0-kb SmaI/EcoRV fragment of the T. virens ARG2 gene (Baek and Kenerley, 1998
Stable prototrophic transformants were selected by consecutive transfer of single colonies to VMS, PDA, and VMS (Baek and Kenerley, 1998
Conidia of 7-d-old T. virens wild type or transformants cultured on PDA were used to inoculate VMS (for deletion strains) or GYEC (15 g of Glc, 3 g of yeast extract, 5 g of casein hydrolysate per liter; for overexpression strains) liquid medium (Thomas and Kenerley, 1989
Fungal CFs were obtained by inoculating 200 mL of VMS with a conidial suspension of the appropriate fungal strain to a final concentration of 106/mL conidia. Following incubation on a rotary shaker at 130 rpm for 5 d at 23°C, CFs were successively filtered through a 10-µm NITEX nylon cloth (TETKO) and a 0.45-µm filter (Fisher Scientific). Proteins in the CFs were precipitated by 80% ammonium sulfate (Fisher Scientific). Pellets were resuspended in small amounts of 10 mM Tris, pH 7.8, and dialyzed against the same buffer (10-kD mwco; Pierce). Protein concentrations were determined by Bio-Rad Bradford microassay using bovine serum albumin as a standard. Protein extracts were subjected to SDS-PAGE following silver or Coomassie Brilliant Blue R-250 staining for protein visualization. Prestained SDS-PAGE broad-range molecular mass standards (Bio-Rad) or Kaleidoscope polypeptide molecular mass standards (Bio-Rad) were used for molecular mass determination.
Protein extracts (obtained as described above) were electrophoresed on SDS-PAGE gels and electroblotted to a nitrocellulose membrane (Osmonics). Sm1 protein was detected using Sm1 polyclonal antibodies (dilution 1:1,000) in a standard western-blot procedure (Sambrook et al., 1989
Cultures of selected transformants were compared with the wild-type strain for colony morphology and radial growth. Agar plugs from actively growing colonies were inoculated in the center of VMS, PDA, or WA plates. Plates were visually inspected for production of aerial hyphae, and color and morphology of the colony. Hyphal extension was recorded at 24 and 48 h of growth at 27°C. The border of the hyphal extension was marked each day, and each plate was photographed and the surface area of growth for each day determined using ImageJ software (http://rsb.info.nih.gov/ij/). Each treatment contained four repetitions and each experiment was repeated at least twice. Data were analyzed by ANOVA and Fisher's PLSD test (P < 0.05; Statview Version 5.0.1; SAS Institute). For germination study, conidial suspensions (1 x 106 /mL) of each strain were plated onto PDA and incubated for 10 d at 27°C. Sterile glass slides were coated with approximately 1 mL of PDA. Conidia were gently removed from the plates and spread onto the coated slides at a concentration of 103 per slide. The slides were incubated for 12 h at 27°C in the dark in moist chambers. The number of germinated conidia was determined by observing 100 conidia along random transects on the slides. Each strain was replicated three times and the experiment repeated at least twice.
Two methods were used to assay hydrophobicity of the mutants and the wild type. In the first assay, each strain was assayed on PDA solid medium at 2 d prior to sporulation. Water drops (20 µL) were placed on the surface and digitally photographed immediately. The shape of the drop and the angle of contact of the drop with the colony provide an indication of the hydrophobicity of the surface (van der Mei et al., 1991 For experiment to detect the coiling phase of mycoparasitism, glass slides were coated with VMS by dipping the slides into the molten agar. An agar plug (3 mm in diameter) of the selected strain of T. virens was added to one side of the coated slide and incubated at 27°C for 36 h. The isolate of R. oryzae was then placed (agar plugs) opposite the hyphae of T. virens (1–1.5 cm) and the slides further incubated at 27°C. After 24 to 48 h, the slides were microscopically examined (see section "Microscopy and Imaging") for evidence of mycoparasitism (coiling) at the zones of interaction.
Cultures of C. graminicola for inoculation were grown for 14 d on PDA at room temperature under constant light. Conidia were scraped from plates, filtered through Miracloth (Calbiochem), and washed three times in distilled water, followed by centrifugation for 1 min at 10,000 rpm. Conidia were counted by using a hemacytometer, spore suspension was adjusted to 6.5 x 104 conidia/mL, and Tween 20 was added to a final concentration of 0.005%.
Inoculation of maize seeds with the wild type, KO26, KO46, OE38, or OE39 was performed by first coating the seeds with a latex sticker (Phoplex AC-33; Rohm and Haas), followed by the addition of fine powder of chlamydospore preparations (Weaver and Kenerley, 2005 Fourteen-day-old plants (at the V4 developmental stage) were inoculated with C. graminicola by placing the plants in trays (78.7 x 63.5 x 6.9 cm; Molded Fiber Glass Tray Company) and taping the leaves onto moist paper towels in the bottom of the trays. The third leaf from all plants was inoculated with six droplets (10 µL), each containing 650 conidia, placed on the adaxial side, away from the midvein of the leaf. The trays were sealed with plastic wrap to maintain the moisture and incubated for 24 h. After incubation, the plants were left for 3 to 4 h for droplets to dry, and the location of each droplet was marked to allow for later identification. Then, the plants were gently untaped, returned to controlled growth conditions, and monitored for the appearance of symptoms. Following a 4-d incubation period, inoculated leaves were scanned and percentage of the leaf area with symptomatic lesions was determined using ImageJ software. Each treatment, consisting of six spots per leaf per one plant, was replicated four times, and the experiment was repeated three times. Data were analyzed by ANOVA and Fisher's PLSD test (P < 0.05; Statview Version 5.0.1; SAS Institute).
Plants were removed from the hydroponic system and the roots were excised from the plant. The entire root system was placed in 100 mL of 1% sodium hexametaphosphate and 0.1% Tergitol P10 (Sigma Aldrich) and shaken for 45 min at 100 rpm on an orbital shaker. The roots were then removed, rinsed twice in sterile water, and then shaken for 45 min in 100 mL of sterile water. Root systems were then spread apart in a petri dish (150 mm diameter) containing sterile water and harvested (excised with a scalpel) for plating on GVSM (Park et al., 1992 After 14 d of growth in soil, plants were removed from containers, shoots excised from the root systems, root systems extensively washed under tap water and collected on a sieve. The same washing protocol was followed as cited above. Roots were excised and plated on GVSM. Over a 48 h period of incubation, colonies of T. virens growing from the root fragments onto GVSM were assessed. Root fragments were measured and the data are expressed as colonies/cm of root length.
T. virens wild-type and KO25 strains expressing GFP were constructed by cotransformation (Djonovic et al., 2007
Stable cotransformants were selected on PDA plates supplemented with hygromycin (Dave et al., 1994
Expression of defense-related genes was analyzed in maize seedlings (roots and leaves) grown hydroponically without or with wild-type, SM1-deletion, and SM1-overexpression strains (as described above). In the experiment with maize seeds coated with wild-type strain, two deletion strains, and two overexpression strains (described in section above) and challenged with C. graminicola, the seedlings were grown in soil. Plants were harvested after 14 d of growth with Trichoderma, 1 d after incubation with the pathogen, and 4 d after inoculation when the symptoms were evaluated. All harvested samples were immediately frozen in liquid nitrogen. Total RNA from maize was extracted using TRI reagent (Molecular Research Center) according to the manufacturer's protocols.
Expression of plant defense-related genes in this study was assessed by sqRT-PCR. Sequences for gene-specific primer pairs were obtained from published studies (ZmOPR2, ZmOPR7, and ZmOPR8 [Zhang et al., 2005
To detect SM1 mRNA in roots of maize plants inoculated with T. virens wild-type or mutant strains, total RNA from roots was extracted and used for RT-PCR experiments. After harvesting, the roots were washed with tergitol-metaphosphate solution as described above and total RNA was extracted. Reverse transcription reactions were performed using 2.5 µg of total RNA. The reactions for SM1 and ACT genes from T. virens were carried out for 40 cycles of 94°C (30 s), 58°C (30 s), and 72°C (30 s), plus a single final step at 72°C for 5 min, and using the primers 5'GACACTGGTGAGACAAGCAC3' (forward) and 5'TTAGAGACCGCAGTTCTTAACAG3' (reverse) for the SM1 gene or 5'GTATCATGATCGGTATGGGTCAGAA3' (forward) and 5'TAGAAGGTGTGGTGCCAGATCTT3' (reverse) for the ACT gene. PCR reactions for GAPc were conducted on the conditions mentioned above. PCR products were separated on 2% agarose gels, ethidium bromide stained, and visualized under UV light. Maize defense gene expression was profiled from two independent experiments. As the results from the two experiments were similar, the data from one trial are presented here.
Microscopy of coiling experiments was carried out with an Olympus BX60 microscope and 100x magnification. The images were captured using the Q-Free Olympus camera and processed using Adobe Photoshop imaging software. Fluorescence microscopy was performed with an Olympus BX51 fluorescence microscope. Excitation and emission wavelengths of 470 to 490 and 510 to 550 nm, respectively, and 200x magnification were used. Images were recorded using an Olympus DP70 camera and processed with DPController 1.1.165 software.
The following materials are available in the online version of this article.
We thank Dr. Serenella Sukno for sharing the protocol for Colletotrichum inoculation of maize; Dr. Brain Shaw for expert assistance in fluorescence microscopy; Dr. Daniel Cullen for providing the GFP vector and Dr. Deborah Bell-Pedersen for providing the hygromycin vector; Dr. Xiquan Gao and Dr. Andriy Nemchenko for providing the primers for maize gene expression; and Gloria Vittone for assistance with plant bioassays and hydrophobicity assay. Received June 10, 2007; accepted September 17, 2007; published September 20, 2007.
1 This work was supported by grants from the U.S. Department of Agriculture National Research Initiative (2003–35316–13861) and the National Science Foundation (IOB0445650) to C.M.K., and a fellowship to S.D. from the Storkan-Hanes-McCaslin Foundation.
2 Present address: Department of Molecular Biology, Massachusetts General Hospital and Department of Genetics, Harvard Medical School, Boston, MA 02114. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Charles M. Kenerley (c-kenerley{at}tamu.edu).
[W] The online version of this article contains Web-only data. www.plantphysiol.org/cgi/doi/10.1104/pp.107.103689 * Corresponding author; e-mail c-kenerley{at}tamu.edu.
Agrawal GK, Jwa NS, Rakwal R (2000) A novel rice (Oryza sativa L.) acidic PR1 gene highly responsive to cut, phytohormones, and protein phosphatase inhibitors. Biochem Biophys Res Commun 274: 157–165[CrossRef][Web of Science][Medline] Baek JM, Kenerley CM (1998) The arg2 gene of Trichoderma virens: cloning and development of a homologous transformation system. Fungal Genet Biol 23: 34–44[CrossRef][Web of Science][Medline] Bailey BA, Korcak RF, Anderson JD (1992) Alterations in Nicotiana tabacum L. cv xanthi cell membrane function following treatment with an ethylene biosynthesis-inducing endoxylanase. Plant Physiol 100: 749–755 Bais HP, Park SW, Weir TL, Callaway RM, Vivanco JM (2004) How plants communicate using the underground information superhighway. Trends Plant Sci 9: 26–32[CrossRef][Web of Science][Medline] Bate NJ, Rothstein SJ (1998) C6-volatiles derived from the lipoxygenase pathway induce a subset of defense-related genes. Plant J 16: 561–569[CrossRef][Web of Science][Medline] Benitez T, Rincon AM, Limon MC, Codon AC (2004) Biocontrol mechanisms of Trichoderma strains. Int Microbiol 7: 249–260[Medline] Birkett MA, Campbell CA, Chamberlain K, Guerrieri E, Hick AJ, Martin JL, Matthes M, Napier JA, Pettersson J, Pickett JA, et al (2000) New roles for cis-jasmone as an insect semiochemical and in plant defense. Proc Natl Acad Sci USA 97: 9329–9334 Boddi S, Comparini C, Calamassi R, Pazzagli L, Cappugi G, Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. platani. FEMS Microbiol Lett 233: 341–346[CrossRef][Web of Science][Medline] Calderon AA, Zapata JM, Munoz R, Pedreno MA, Barcelo AR (1993) Resveratrol production as a part of the hypersensitive-like response of grapevine cells to an elicitor from Trichoderma viride. New Phytol 124: 455–463[CrossRef][Web of Science] Chern M, Fitzgerald HA, Canlas PE, Navarre DA, Ronald PC (2005) Overexpression of a rice NPR1 homolog leads to constitutive activation of defense response and hypersensitivity to light. Mol Plant Microbe Interact 18: 511–520[Web of Science][Medline] Conrath U, Beckers GJ, Flors V, Garcia-Agustin P, Jakab G, Mauch F, Newman MA, Pieterse CM, Poinssot B, Pozo MJ, et al (2006) Priming: getting ready for battle. Mol Plant Microbe Interact 19: 1062–1071[Web of Science][Medline] Dave KI, Lauriano C, Xu B, Wild JR, Kenerley CM (1994) Expression of organophosphate hydrolase in the filamentous fungus Gliocladium virens. Appl Microbiol Biotechnol 41: 352–358[CrossRef][Web of Science][Medline] Diallinas G, Kanellis AK (1994) A phenylalanine ammonia-lyase gene from melon fruit: cDNA cloning, sequence and expression in response to development and wounding. Plant Mol Biol 26: 473–479[CrossRef][Web of Science][Medline] Dixon RA, Achnine L, Kota P, Liu CJ, Reddy MSS, Wang LJ (2002) The phenylpropanoid pathway and plant defence—a genomics perspective. Mol Plant Pathol 3: 371–390[CrossRef] Djonovic S, Pozo MJ, Dangott LJ, Howell CR, Kenerley CM (2006a) Sm1, a proteinaceous elicitor secreted by the biocontrol fungus Trichoderma virens induces plant defense responses and systemic resistance. Mol Plant Microbe Interact 19: 838–853[Web of Science][Medline] Djonovic S, Pozo MJ, Kenerley CM (2006b) Tv-bgn3, a beta-1,6-glucanase from the biocontrol fungus Trichoderma virens is involved in mycoparasitism and control of Pythium ultimum. Appl Environ Microbiol 72: 7661–7670 Djonovic S, Vittone G, Mendoza-Herrera A, Kenerley C (2007) Enhanced biocontrol activity of Trichoderma virens transformants constitutively co-expressing Dong X (2001) Genetic dissection of systemic acquired resistance. Curr Opin Plant Biol 4: 309–314[CrossRef][Web of Science][Medline] Dong X (2004) NPR1, all things considered. Curr Opin Plant Biol 7: 547–552[CrossRef][Web of Science][Medline] Duplessis S, Courty PE, Tagu D, Martin F (2005) Transcript patterns associated with ectomycorrhiza development in Eucalyptus globulus and Pisolithus microcarpus. New Phytol 165: 599–611[CrossRef][Web of Science][Medline] Durrant WE, Dong X (2004) Systemic acquired resistance. Annu Rev Phytopathol 42: 185–209[CrossRef][Web of Science][Medline] Farag MA, Fokar M, Zhang HA, Allen RD, Pare PW (2005) (Z)-3-Hexenol induces defense genes and downstream metabolites in maize. Planta 220: 900–909[CrossRef][Web of Science][Medline] Feussner I, Wasternack C (2002) The lipoxygenase pathway. Annu Rev Plant Biol 53: 275–297[CrossRef][Medline] Furman-Matarasso N, Cohen E, Du Q, Chejanovsky N, Hanania U, Avni A (1999) A point mutation in the ethylene-inducing xylanase elicitor inhibits the Gao X, Starr J, Göbel C, Engelberth J, Feussner I, Tumlinson J, Kolomiets M (2007) Maize 9-lipoxygenase ZmLOX3 controls development, root-specific expression of defense genes and resistance to root-knot nematodes. Mol Plant Microbe Interact (in press) Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 43: 205–227[CrossRef][Web of Science][Medline] Glazebrook J, Chen WJ, Estes B, Chang HS, Nawrath C, Metraux JP, Zhu T, Katagiri F (2003) Topology of the network integrating salicylate and jasmonate signal transduction derived from global expression phenotyping. Plant J 34: 217–228[CrossRef][Web of Science][Medline] Gozzo F (2003) Systemic acquired resistance in crop protection: from nature to a chemical approach. J Agric Food Chem 51: 4487–4503[CrossRef][Web of Science][Medline] Hanson LE, Howell CR (2004) Elicitors of plant defense responses from biocontrol strains of Trichoderma virens. Phytopathology 94: 171–176[CrossRef][Web of Science][Medline] Harman GE, Howell CR, Viterbo A, Chet I, Lorito M (2004a) Trichoderma species—opportunistic, avirulent plant symbionts. Nat Rev Microbiol 2: 43–56[CrossRef][Web of Science][Medline] Harman GE, Petzoldt R, Comis A, Chen J (2004b) Interactions between Trichoderma harzianum strain T22 and maize inbred line Mo17 and effects of these interactions on diseases caused by Pythium ultimum and Colletotrichum graminicola. Phytopathology 94: 147–153[CrossRef][Web of Science][Medline] He GZ, Tarui Y, Iino M (2005) A novel receptor kinase involved in jasmonate-mediated wound and phytochrome signaling in maize coleoptiles. Plant Cell Physiol 46: 870–883 Heath MC (2000) Hypersensitive response-related death. Plant Mol Biol 44: 321–334[CrossRef][Web of Science][Medline] Heil M, Bostock RM (2002) Induced systemic resistance (ISR) against pathogens in the context of induced plant defences. Ann Bot (Lond) 89: 503–512 Heil M, Silva Bueno JC (2007) Within-plant signaling by volatiles leads to induction and priming of an indirect plant defense in nature. Proc Natl Acad Sci USA 104: 5467–5472 Honegger R (1991) Functional aspects of the lichen symbiosis. Annu Rev Plant Physiol Plant Mol Biol 42: 553–578[CrossRef][Web of Science] Howell CR, Hanson LE, Stipanovic RD, Puckhaber LS (2000) Induction of terpenoid synthesis in cotton roots and control of Rhizoctonia solani by seed treatment with Trichoderma virens. Phytopathology 90: 248–252[CrossRef][Medline] Hwang J, Benson DM (2003) Expression of induced systemic resistance in poinsettia cuttings against Rhizoctonia stem rot by treatment of stock plants with binucleate Rhizoctonia. Biol Control 27: 73–80[CrossRef] Kato M, Hayakawa Y, Hyodo H, Ikoma Y, Yano M (2000) Wound-induced ethylene synthesis and expression and formation of 1-aminocyclopropane-1-carboxylate (ACC) synthase, ACC oxidase, phenylalanine ammonia-lyase, and peroxidase in wounded mesocarp tissue of Cucurbita maxima. Plant Cell Physiol 41: 440–447[Web of Science][Medline] Kogel KH, Beckhove U, Dreschers J, Munch S, Romme Y (1994) Acquired resistance in barley (the resistance mechanism induced by 2,6-dichloroisonicotinic acid is a phenocopy of a genetically based mechanism governing race-specific powdery mildew resistance). Plant Physiol 106: 1269–1277[Abstract] Le Floch G, Benhamou N, Mamaca E, Salerno MI, Tirilly Y, Rey P (2005) Characterisation of the early events in atypical tomato root colonisation by a biocontrol agent, Pythium oligandrum. Plant Physiol Biochem 43: 1–11[CrossRef][Web of Science][Medline] Matsui K (2006) Green leaf volatiles: hydroperoxide lyase pathway of oxylipin metabolism. Curr Opin Plant Biol 9: 274–280[CrossRef][Web of Science][Medline] Mei C, Qi M, Sheng G, Yang Y (2006) Inducible overexpression of a rice allene oxide synthase gene increases the endogenous jasmonic acid level, PR gene expression, and host resistance to fungal infection. Mol Plant Microbe Interact 19: 1127–1137[CrossRef][Web of Science][Medline] Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen gene network of plants. Trends Plant Sci 9: 490–498[CrossRef][Web of Science][Medline] Morris SW, Vernooij B, Titatarn S, Starrett M, Thomas S, Wiltse CC, Frederiksen RA, Bhandhufalck A, Hulbert S, Uknes S (1998) Induced resistance responses in maize. Mol Plant Microbe Interact 11: 643–658[Web of Science][Medline] Nemchenko A, Kunze S, Feussner I, Kolomiets M (2006) Duplicate maize 13-lipoxygenase genes are differentially regulated by circadian rhythm, cold stress, wounding, pathogen infection, and hormonal treatments. J Exp Bot 57: 3767–3779 Nicholson RL, Hammerschmidt R (1992) Phenolic compounds and their role in disease resistance. Annu Rev Phytopathol 30: 369–389[Web of Science] Nimchuk Z, Eulgem T, Holt BF III, Dangl JL (2003) Recognition and response in the plant immune system. Annu Rev Genet 37: 579–609[CrossRef][Web of Science][Medline] Ongena M, Duby F, Rossignol F, Fauconnier ML, Dommes J, Thonart P (2004) Stimulation of the lipoxygenase pathway is associated with systemic resistance induced in bean by a nonpathogenic Pseudomonas strain. Mol Plant Microbe Interact 17: 1009–1018[Web of Science][Medline] Park YH, Kenerley CM, Stack JP (1992) Inoculum dynamics of Gliocladium virens associated with roots of cotton seedlings. Microb Ecol 23: 169–179[CrossRef][Web of Science] Paul ND, Hatcher PE, Taylor JE (2000) Coping with multiple enemies: an integration of molecular and ecological perspectives. Trends Plant Sci 5: 220–225[CrossRef][Web of Science][Medline] Pazzagli L, Cappugi G, Manao G, Camici G, Santini A, Scala A (1999) Purification, characterization, and amino acid sequence of cerato-platanin, a new phytotoxic protein from Ceratocystis fimbriata f. sp. platani. J Biol Chem 274: 24959–24964 Pieterse CM, van Loon LC (1999) Salicylic acid-independent plant defence pathways. Trends Plant Sci 4: 52–58[CrossRef][Web of Science][Medline] Pieterse CMJ, Van Pelt JA, Verhagen BWM, Ton J, Van Wees SCM, Leon-Kloosterziel KM, Van Loon LC (2003) Induced systemic resistance by plant growth-promoting rhizobacteria. Symbiosis 35: 39–54[Web of Science] Pozo MJ, Van Loon LC, Pieterse CMJ (2005) Jasmonates—signals in plant-microbe interactions. J Plant Growth Regul 23: 211–222 Rakwal R, Komatsu S (2000) Role of jasmonate in the rice (Oryza sativa L.) self-defense mechanism using proteome analysis. Electrophoresis 21: 2492–2500[CrossRef][Web of Science][Medline] Rotblat B, Enshell-Seijffers D, Gershoni JM, Schuster S, Avni A (2002) Identification of an essential component of the elicitation active site of the EIX protein elicitor. Plant J 32: 1049–1055[CrossRef][Web of Science][Medline] Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schaffrath U, Freydl E, Dudler R (1997) Evidence for different signaling pathways activated by inducers of acquired resistance in wheat. Mol Plant Microbe Interact 10: 779–783[CrossRef][Web of Science] Schenk PM, Kazan K, Wilson I, Anderson JP, Richmond T, Somerville SC, Manners JM (2000) Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proc Natl Acad Sci USA 97: 11655–11660 Scherrer S, De Vries OMH, Dudler R, Wessels JGH, Honegger R (2000) Interfacial self-assembly of fungal hydrophobins of the lichen-forming ascomycetes Xanthoria parietina and X. ectaneoides. Fungal Genet Biol 30: 81–93[CrossRef][Web of Science][Medline] Schweizer P, Schlagenhauf E, Schaffrath U, Dudler R (1999) Different patterns of host genes are induced in rice by Pseudomonas syringae, a biological inducer of resistance, and the chemical inducer benzothiadiazole (BTH). Eur J Plant Pathol 105: 659–665[CrossRef] Shiojiri K, Kishimoto K, Ozawa R, Kugimiya S, Urashimo S, Arimura G, Horiuchi J, Nishioka T, Matsui K, Takabayashi J (2006) Changing green leaf volatile biosynthesis in plants: an approach for improving plant resistance against both herbivores and pathogens. Proc Natl Acad Sci USA 103: 16672–16676 Shoresh M, Gal-On A, Leibman D, Chet I (2006) Characterization of a mitogen-activated protein kinase gene from cucumber required for Trichoderma-conferred plant resistance. Plant Physiol 142: 1169–1179 Shoresh M, Yedidia I, Chet I (2005) Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology 95: 76–84[CrossRef][Web of Science][Medline] Staben C, Jensen B, Singer M, Pollock J, Schechtman M, Kinsey J, Selker E (1989) Use of a bacterial hygromycin B resistance gene as a dominant selectable marker in Neurospora crassa transformation. Fungal Genet Newsl 36: 79–81 Tagu D, Lapeyrie F, Martin F (2002) The ectomycorrhizal symbiosis: genetics and development. Plant Soil 244: 97–105[CrossRef][Web of Science] Tagu D, Nasse B, Martin F (1996) Cloning and characterization of hydrophobins-encoding cDNAs from the ectomycorrhizal Basidiomycete Pisolithus tinctorius. Gene 168: 93–97[CrossRef][Web of Science][Medline] Thomas MD, Kenerley CM (1989) Transformation of the mycoparasite Gliocladium. Curr Genet 15: 415–420[CrossRef][Web of Science] Ton J, Van Pelt JA, Van Loon LC, Pieterse CMJ (2002) Differential effectiveness of salicylate-dependent and jasmonate/ethylene-dependent induced resistance in Arabidopsis. Mol Plant Microbe Interact 15: 27–34[Web of Science][Medline] Turner JG, Ellis C, Devoto A (2002) The jasmonate signal pathway. Plant Cell (Suppl) 14: S153–S164 van der Mei HC, Rosenberg M, Busscher HJ (1991) Assessment of microbial cell surface hydrophobicity. In N Mozes, PS Handley, HJ Busscher, PG Rouxhet, eds, Microbial Cell Surface Analysis. VCH, New York, pp 265–287 van Loon LC, Bakker PA, Pieterse CM (1998) Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol 36: 453–483[CrossRef][Web of Science][Medline] Van Loon LC, Van Strien EA (1999) The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol 55: 85–97[CrossRef] Vanden Wymelenberg AJ, Cullen D, Spear RN, Schoenike B, Andrews JH (1997) Expression of green fluorescent protein in Aureobasidium pullulans and quantification of the fungus on leaf surfaces. Biotechniques 23: 686–690[Web of Science][Medline] Veronese P, Ruiz MT, Coca MA, Hernandez-Lopez A, Lee H, Ibeas JI, Damsz B, Pardo JM, Hasegawa PM, Bressan RA, et al (2003) In defense against pathogens. Both plant sentinels and foot soldiers need to know the enemy. Plant Physiol 131: 1580–1590 Viterbo A, Chet I (2006) TasHyd1, a new hydrophobin gene from the biocontrol agent Trichoderma asperellum, is involved in plant root colonization. Mol Plant Pathol 7: 249–258[CrossRef] Viterbo A, Harel M, Chet I (2004) Isolation of two aspartyl proteases from Trichoderma asperellum expressed during colonization of cucumber roots. FEMS Microbiol Lett 238: 151–158[Web of Science][Medline] Viterbo A, Harel M, Horwitz BA, Chet I, Mukherjee PK (2005) Trichoderma mitogen-activated protein kinase signaling is involved in induction of plant systemic resistance. Appl Environ Microbiol 71: 6241–6246 Vogel HJ (1956) A convenient growth medium for Neurospora (Medium N). Microbiol Genet Bull 13: 42–43 Waller F, Achatz B, Baltruschat H, Fodor J, Becker K, Fischer M, Heier T, Huckelhoven R, Neumann C, von Wettstein D, et al (2005) The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield. Proc Natl Acad Sci USA 102: 13386–13391 Weaver M, Kenerley C (2005) Density independent population dynamics by Trichoderma virens in soil and defined substrates. Biocontrol Sci Technol 15: 847–857[CrossRef] Whiteford JR, Spanu PD (2001) The hydrophobin HCf-1 of Cladosporium fulvum is required for efficient water-mediated dispersal of conidia. Fungal Genet Biol 32: 159–168[CrossRef][Web of Science][Medline] Wilson LM, Idnurm A, Howlett BJ (2002) Characterization of a gene (sp1) encoding a secreted protein from Leptosphaeria maculans, the blackleg pathogen of Brassica napus. Mol Plant Pathol 3: 487–493[CrossRef] Xu BW, Wild JR, Kenerley CM (1996) Enhanced expression of a bacterial gene for pesticide degradation in a common soil fungus. J Ferment Bioeng 81: 473–481[CrossRef] Yedidia I, Benhamou N, Chet I (1999) Induction of defense responses in cucumber plants (Cucumis sativus L.) by the biocontrol agent Trichoderma harzianum. Appl Environ Microbiol 65: 1061–1070 Yedidia I, Benhamou N, Kapulnik Y, Chet I (2000) Induction and accumulation of PR proteins activity during early stages of root colonization by the mycoparasite Trichoderma harzianum strain T-203. Plant Physiol Biochem 38: 863–873[CrossRef][Web of Science] Yedidia I, Shoresh M, Kerem Z, Benhamou N, Kapulnik Y, Chet I (2003) Concomitant induction of systemic resistance to Pseudomonas spingae pv. lachrymans in cucumber by Trichoderma asperellum (T-203) and accumulation of phytoalexins. Appl Environ Microbiol 69: 7343–7353 Zhang J, Simmons C, Yalpani N, Crane V, Wilkinson H, Kolomiets M (2005) Genomic analysis of the 12-oxo-phytodienoic acid reductase gene family of Zea mays. Plant Mol Biol 59: 323–343[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|