|
|
||||||||
|
First published online August 17, 2007; 10.1104/pp.107.105973 Plant Physiology 145:1264-1271 (2007) © 2007 American Society of Plant Biologists OPEN ACCESS ARTICLE
Yeast-Plant Coupled Vector System for Identification of Nuclear Proteins1,[OA]Department of Biochemistry and Cell Biology, State University of New York, Stony Brook, New York 11794–5215 (A.Z., B.-Y.Y., A.K., V.C.); Department of Environmental Horticulture, University of Seoul, Tongdaemoon, Seoul 130–743, Korea (B.-Y.Y.); and Department of Genetics, Agricultural Research Organization, Volcani Center, Bet Dagan 50250, Israel (Y.G.)
Nuclear proteins are involved in many critical biological processes within plant cells and, therefore, are in the focus of studies that usually begin with demonstrating that the protein of interest indeed exhibits nuclear localization. Thus, studies of plant nuclear proteins would be facilitated by a convenient experimental system for identification of proteins that are actively imported into the cell nucleus and visualization of their nuclear accumulation in vivo. To this end, we developed a system of vectors that allows screening for cDNAs coding for nuclear proteins in a simple genetic assay in yeast cells, and verification of nuclear accumulation in planta following one-step transfer and autofluorescent tagging of the identified clones into a multiple cloning site-compatible and reading frame-compatible plant expression vector. In a recommended third experimental step, the plant expression cassette containing the identified clone can be transferred, also by a one-step cloning, into a binary multigene expression vector for transient or stable coexpression with any other proteins.
Nuclear proteins perform a multitude of diverse cellular functions, from structure (e.g. lamins and histones) to maintenance (e.g. DNA repair and replication) to chromatin dynamics and gene regulation (e.g. chromatin modifiers and transcription factors). Thus, different nuclear proteins represent the focus of numerous studies that often begin with a single observation that a protein of interest indeed resides within the cell nucleus. This first experimental step of protein characterization would be facilitated by a convenient experimental system that allows identification of nuclear proteins and demonstration of their nuclear import in vivo.
Protein nuclear import occurs through the nuclear pore complex. While small proteins (40–60 kD) often diffuse through the nuclear pore complex, nuclear entry of larger molecules and even of some small endogenous proteins, such as histones (Breeuwer and Goldfarb, 1990 Here, we describe a system of vectors that allows (1) identification of nuclear proteins from products encoded by large numbers of cDNA clones, or even entire libraries, via a simple genetic assay in yeast cells, and (2) verification of nuclear accumulation in planta following one-step transfer and autofluorescent tagging of the identified clones into a multiple cloning site (MCS)-compatible and open reading frame (ORF)-compatible plant expression vector. In a recommended third experimental step, the plant expression cassette containing the identified clone can be transferred, also by a one-step cloning, into a binary multigene expression vector for transient or stable coexpression—following biolistic delivery or Agrobacterium-mediated genetic transformation, respectively—with any other proteins, such as subcellular localization markers or potential interactors.
Design of the Assay We designed a simple two-stage assay for identification of proteins containing an active NLS, with a third recommended stage for transgenic expression of the identified proteins (Fig. 1 ). In the first stage, a cDNA library is constructed in (or transferred to) a yeast nuclear import assay (NIA) expression vector, pNIA-C, which allows specific induction of a reporter gene if the expressed protein reaches the yeast cell nucleus. For this library construction, the cDNA can be either inserted into one of the pNIA-C vectors, or it can be cloned into the mixture of all three vectors, i.e. pNIA-Ca, pNIA-Cb, and pNIA-Cc (Fig. 2 ), which allows better representation of all three reading frames in the library. The resulting library is introduced into a yeast strain with an inducible selectable heterotrophic marker; the same strain also carries an inducible β-galactosidase marker that allows verification of the reporter gene induction in the selected colonies. This experimental step allows initial selection of NLS-containing protein products from a cDNA expression library. Alternatively, it is also very useful for rapid and inexpensive testing of individual proteins of interest for the presence of active NLS sequences.
For plant nuclear proteins, it is important to verify their nuclear accumulation directly in planta. Thus, the second stage of our assay is one-step transfer of the selected cDNA clones into a modular plant expression vector, pSAT6-EGFP-C (Fig. 1). Subcellular localization of GFP-tagged proteins transiently expressed from this vector is easily determined directly in living plant tissues by confocal or epifluorescence microscopy. In pNIA-C and pSAT6-C vectors, the proteins are tested as N-terminal fusions with the corresponding reporter protein. Although C-terminal fusions, i.e. fusions between the C terminus of the tested protein and the N terminus of the reporter, can also be used for determination of protein localization (see, for example, Tzfira et al. [2005]
Finally, it is often useful to augment the initial identification of a nuclear protein by comparing its localization to that of known subcellular markers or by analyzing potential colocalization with its interactors. Furthermore, it may also be useful to express the identified clones stably, in transgenic plants, for example, for studies of its nuclear import during plant development and morphogenesis, or in response to biotic and abiotic factors. These goals are achieved in the third stage of our assay (Fig. 1), during which the expression cassette is transferred—also by a single-step cloning—to a binary multigene expression vector. This vector, pPZP-RCS2, does not contain promoter and terminator sequences and is specifically designed to accept expression cassettes based on pSAT vectors (or comparable constructs; Goderis et al., 2002
We produced three vectors, pNIA-Ca, pNIA-Cb, and pNIA-Cc, which constitutively produce translational fusions of the tested protein to the C terminus of a chimeric transcriptional activator mLexA-Gal4AD in all three ORFs (Fig. 2A). mLexA-Gal4AD is derived from our first-generation pNIA vector (Rhee et al., 2000 For easy fusion of genes of interest with mLexA-Gal4AD, we constructed an MCS with 12 unique restriction endonuclease recognition sites (Fig. 2A). Importantly, this MCS was engineered to maintain the same reading frames as the pSAT6-EGFP-C vectors for simple, one-step transfer of a target sequence between the yeast and plant expression vectors. In addition, all expression cassettes carried a stop codon after the MCS (as illustrated in Fig. 2A), allowing expression of protein fragments suspected to carry an NLS.
We then constructed two pNIA fusions for use as positive and negative controls in the NIA (Fig. 2B). For the positive control, we used the Agrobacterium virulence D2 (VirD2) protein known to be efficiently imported into the nucleus of a wide range of eukaryotic species, plant and nonplant (e.g. Howard et al., 1992
To test the functionality of pNIA plasmids, we used them to assay nuclear import of an Arabidopsis (Arabidopsis thaliana) basic Leu zipper domain protein, VIP1, known to reside within the cell nucleus (Tzfira et al., 2001
Detection of Protein Nuclear Import in Planta
Once plant proteins with active NLS sequences are identified in yeast, their nuclear accumulation in plant tissues is tested using three plant constitutive expression vectors, pSAT6-EGFP-Ca, pSAT6-EGFP-Cb, and pSAT6-EGFP-Cc, which allow fusion of the tested proteins to the C terminus of the autofluorescent tag GFP in all three ORFs (Fig. 4A
). The MCSs and reading frames of the pSAT6-EGFP-C vectors are identical to those of the corresponding pNIA-C vectors; thus, the tested protein can be transferred from the yeast nuclear localization assay system to the plant nuclear localization detection system by a single cloning step. For positive and negative controls of nuclear accumulation, we inserted VirD2 and VirD2
In addition to their stand-alone use for transient expression, the pSAT6-EGFP-C vectors can serve as modules for the pPZP-RCS2-based binary plasmids (Goderis et al., 2002
As proof of concept, we transferred VIP1 and At1g31350 from the pNIA-C constructs to pSAT6-EGFP-C and transiently expressed the resulting GFP-VIP1 and GFP-At1g31350 fusions in plant tissues following microbombardment. Figure 5
shows that both fluorescently tagged VIP1 and At1g31350 accumulated in the plant cell nucleus (A and B). Interestingly, another F-box protein, the Agrobacterium VirF, which functions in plants, also has been shown to accumulate predominantly in the plant cell nucleus (Tzfira et al., 2004
Next, we coexpressed our tested and control proteins from a multigene expression vector pPZP-RCS2 with free DsRed2 (Fig. 4C). This reporter, as well as any other small autofluorescent protein, such as cyan fluorescent protein, is very useful for studies of nuclear import because it is known to partition between the cell cytoplasm and the nucleus, conveniently visualizing and identifying both of these cellular compartments (Dietrich and Maiss, 2002
Figure 6
shows that GFP-tagged VIP1 (panel A), At1g31350 (panel D), and VirD2 (panel G) accumulated in the plant cell nucleus. As expected, in the same cells, DsRed2 was found both in the cytoplasm and in the nucleus (Fig. 6, B, E, and H, respectively). Combined images of GFP and DsRed2 fluorescence showed overlapping signal (yellow color) within the cell nucleus, confirming the nuclear localization of these GFP-tagged proteins (Fig. 6, C, F, I, and L). In contrast, GFP-VirD2
Ideally, an assay for identification of nuclear proteins would combine an easy, high-throughput, and, preferably, selection-based approach with in vivo functionality. In plant biology applications, however, it is impractical to meet these two criteria in a single assay. Instead, we devised a two-step assay that seamlessly couples two well-established systems, pNIA vector-based genetic one-hybrid system that allows selection of nuclear proteins in yeast cells (Rhee et al., 2000 The first step of our experimental design is based on functional outcome of the nuclear import in which the imported protein activates a nuclear reporter gene. This step therefore is suited for easy selection of proteins with functional NLS sequences from large protein populations, for example, those encoded by cDNA expression libraries. Furthermore, this system is also useful for mutational analysis of nuclear proteins to delineate and characterize the NLS; in this case, large numbers of mutants can be produced directly in the pNIA-C vector and tested for the NLS activity.
The second step of our experimental design directly detects nuclear accumulation of the tested proteins in planta. This step is important for quality control of the nuclear import data and translation of the observations from the heterologous to homologous model system. In addition, instead of detection of nuclear import based on functionality of the imported protein, this assay visualizes the tagged protein within the plant cell. This allows observation of accumulation of the protein within the cell nucleus, confirming the results of the genetic assay, as well as determination of whether this protein is also found in any other cellular compartments. Furthermore, the capability of multiple pSAT vector-derived expression cassettes to be mounted onto a binary vector for coexpression (Tzfira et al., 2005
To couple both parts of the vector system together, pNIA-C and pSAT6-EGFP-C plasmids were generated with identical MCSs and reading frames, allowing one-step transfer of the tested sequences from one vector to another. For proof of concept, we put through the entire pNIA-C/pSAT6-EGFP-C protocol four unrelated proteins: Arabidopsis nuclear factor VIP1 and Arabidopsis F-box protein with an unknown localization (At1g31350), as tested proteins, and Agrobacterium VirD2 protein and its mutant VirD2
In summary, we described the construction and experimental application of two sets of vectors for identification of functional NLS sequences in yeast and subsequent demonstration of their nuclear import abilities in planta. We hope that these vectors will further facilitate experimentation in plant cell biology that often requires identification of proteins with nuclear import capabilities. Furthermore, in the future, this assay system can be expanded to incorporate pSAT vectors adapted for Gateway cloning and for use with other spectral variants of GFP (Tzfira et al., 2005
Construction of pNIA-C and pSAT6-EGFP-C Vectors
Standard DNA amplification and cloning methods were used to construct all vectors. pEGFP-C1 (CLONTECH) was used as the source of the MCS and SV40 terminator, which were amplified by PCR using 5'AACCGGTGTACAAGTCCGGACTCAGATCTCG3', 5'AACCGGTGTACAAAGTCCGGACTCAGATCTCG3', and 5'AACCGGTGTACAGTCCGGACTCAGATCTCG3' as forward primers for each of the three reading frames, and 5'TTGCCGGCGGCCGCTTACAATTTACGCGT3' as reverse primer. Each of the amplification products was digested with AgeI and NaeI and inserted into the XmaI-NaeI sites of pNIA (Rhee et al., 2000
For coexpression of a tested GFP-tagged protein with free DsRed2 from a single plasmid, we first produced pSAT5-DsRed2 by cloning the DsRed2 expression cassette as a AgeI-NotI fragment from pSAT6-DsRed2-C1 (Tzfira et al., 2005
For yeast nuclear import, the Saccharomyces cerevisiae strain L40 cells (Hollenberg et al., 1995
DNA (50 µg) was adsorbed onto 10 mg of 1-µm gold particles (Bio-Rad) and bombarded at 150 to 200 psi into the leaf epidermis of greenhouse-grown Nicotiana benthamiana plants using a Helios gene gun (PDS-1000/He; Bio-Rad), followed by incubation for 24 h at 25°C. For detection of fluorescently tagged proteins, the bombarded tissues were directly viewed under a Zeiss LSM 5 Pascal confocal laser scanning microscope. Experiments were repeated at least four times, with 10 to 20 expressing cells examined in each experiment. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers EF587311 (pNIA-Ca), EF587312 (pNIA-Cb), EF587313 (pNIA-Cc), EF587314 (pSAT6-EGFP-Ca), EF587315 (pSAT6-EGFP-Cb), and EF587316 (pSAT6-EGFP-Cc).
We thank Dr. Tzvi Tzfira for stimulating discussions. Received July 26, 2007; accepted August 13, 2007; published August 17, 2007.
1 This work was supported by grants from the National Institutes of Health, National Science Foundation, U.S. Department of Agriculture, and U.S.-Israel Binational Science Foundation to V.C., and from the U.S.-Israel Binational Agricultural Research and Development Fund (BARD) to V.C. and Y.G. A.Z. was supported by Vaadia-BARD Postdoctoral Fellowship from BARD. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Vitaly Citovsky (vitaly.citovsky{at}stonybrook.edu).
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.105973 * Corresponding author; e-mail vitaly.citovsky{at}stonybrook.edu.
Ballas N, Citovsky V (1997) Nuclear localization signal binding protein from Arabidopsis mediates nuclear import of Agrobacterium VirD2 protein. Proc Natl Acad Sci USA 94: 10723–10728 Breeuwer M, Goldfarb DG (1990) Facilitated nuclear transport of histone H1 and other small nucleophilic proteins. Cell 60: 999–1008[CrossRef][Web of Science][Medline] Citovsky V, Warnick D, Zambryski PC (1994) Nuclear import of Agrobacterium VirD2 and VirE2 proteins in maize and tobacco. Proc Natl Acad Sci USA 91: 3210–3214 Citovsky V, Zupan J, Warnick D, Zambryski PC (1992) Nuclear localization of Agrobacterium VirE2 protein in plant cells. Science 256: 1802–1805 Dietrich C, Maiss E (2002) Red fluorescent protein DsRed from Discosoma sp. as a reporter protein in higher plants. Biotechniques 32: 286–293[Web of Science][Medline] Dingwall C (1991) Transport across the nuclear envelope: enigmas and explanations. Bioessays 13: 213–218[CrossRef][Web of Science][Medline] Dingwall C, Laskey RA (1991) Nuclear targeting sequences—a consensus? Trends Biochem Sci 16: 478–481[CrossRef][Web of Science][Medline] Garcia-Bustos J, Heitman J, Hall MN (1991) Nuclear protein localization. Biochim Biophys Acta 1071: 83–101[Medline] Goderis IJ, De Bolle MF, Francois IE, Wouters PF, Broekaert WF, Cammue BP (2002) A set of modular plant transformation vectors allowing flexible insertion of up to six expression units. Plant Mol Biol 50: 17–27[CrossRef][Web of Science][Medline] Goldfarb DS, Gariepy J, Schoolnik G, Kornberg RD (1986) Synthetic peptides as nuclear localization signals. Nature 322: 641–644[CrossRef][Medline] Goodin MM, Dietzgen RG, Schichnes D, Ruzin S, Jackson AO (2002) pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. Plant J 31: 375–383[CrossRef][Web of Science][Medline] Guralnick B, Thomsen G, Citovsky V (1996) Transport of DNA into the nuclei of Xenopus oocytes by a modified VirE2 protein of Agrobacterium. Plant Cell 8: 363–373[Abstract] Hollenberg SM, Sternglanz R, Cheng PF, Weintraub H (1995) Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol Cell Biol 15: 3813–3822 Howard E, Zupan J, Citovsky V, Zambryski PC (1992) The VirD2 protein of A. tumefaciens contains a C-terminal bipartite nuclear localization signal: implications for nuclear uptake of DNA in plant cells. Cell 68: 109–118[CrossRef][Web of Science][Medline] Kalderon D, Roberts BL, Richardson WD, Smith AE (1984) A short amino acid sequence able to specify nuclear location. Cell 39: 499–509[CrossRef][Web of Science][Medline] Krichevsky A, Gutgarts H, Kozlovsky SV, Tzfira T, Sutton A, Sternglanz R, Mandel G, Citovsky V (2007) AtCZS, an Arabidopsis C2H2 zinc finger-SET histone methyltransferase is a plant-specific chromatin modifier. Dev Biol 303: 259–269[CrossRef][Web of Science][Medline] Lacroix B, Vaidya M, Tzfira T, Citovsky V (2005) The VirE3 protein of Agrobacterium mimics a host cell function required for plant genetic transformation. EMBO J 24: 428–437[CrossRef][Web of Science][Medline] Michael WM, Choi M, Dreyfuss G (1995) A nuclear export signal in hnRNP A1: a signal-mediated temperature-dependent nuclear protein export pathway. Cell 83: 415–422[CrossRef][Web of Science][Medline] Relic B, Andjelkovic M, Rossi L, Nagamine Y, Hohn B (1998) Interaction of the DNA modifying proteins VirD1 and VirD2 of Agrobacterium tumefaciens: analysis by subcellular localization in mammalian cells. Proc Natl Acad Sci USA 95: 9105–9110 Rhee Y, Gurel F, Gafni Y, Dingwall C, Citovsky V (2000) A genetic system for detection of protein nuclear import and export. Nat Biotechnol 18: 433–437[CrossRef][Web of Science][Medline] Robbins J, Dilworth SM, Laskey RA, Dingwall C (1991) Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell 64: 615–623[CrossRef][Web of Science][Medline] Rossi L, Hohn B, Tinland B (1993) The VirD2 protein of Agrobacterium tumefaciens carries nuclear localization signals important for transfer of T-DNA to plant. Mol Gen Genet 239: 345–353[CrossRef][Web of Science][Medline] Schultheiss H, Dechert C, Kogel KH, Hückelhoven R (2003) Functional analysis of barley RAC/ROP G-protein family members in susceptibility to the powdery mildew fungus. Plant J 36: 589–601[CrossRef][Web of Science][Medline] Smith AE, Kalderon D, Roberts BL, Colledge WD, Edge M, Gillett P, Markham AF, Paucha E, Richardson WD (1985) The nuclear location signal. Proc R Soc Lond B Biol Sci 226: 43–58[Medline] Tzfira T, Tian GW, Lacroix B, Vyas S, Li J, Leitner-Dagan Y, Krichevsky A, Taylor T, Vainstein A, Citovsky V (2005) pSAT vectors: a modular series of plasmids for fluorescent protein tagging and expression of multiple genes in plants. Plant Mol Biol 57: 503–516[CrossRef][Web of Science][Medline] Tzfira T, Vaidya M, Citovsky V (2001) VIP1, an Arabidopsis protein that interacts with Agrobacterium VirE2, is involved in VirE2 nuclear import and Agrobacterium infectivity. EMBO J 20: 3596–3607[CrossRef][Web of Science][Medline] Tzfira T, Vaidya M, Citovsky V (2004) Involvement of targeted proteolysis in plant genetic transformation by Agrobacterium. Nature 431: 87–92[CrossRef][Medline] Varagona MJ, Schmidt RJ, Raikhel NV (1991) Monocot regulatory protein Opaque-2 is localized in the nucleus of maize endosperm and transformed tobacco plants. Plant Cell 3: 105–113 Ziemienowicz A, Görlich D, Lanka E, Hohn B, Rossi L (1999) Import of DNA into mammalian nuclei by proteins originating from a plant pathogenic bacterium. Proc Natl Acad Sci USA 96: 3729–3733 Ziemienowicz A, Merkle T, Schoumacher F, Hohn B, Rossi L (2001) Import of Agrobacterium T-DNA into plant nuclei: two distinct functions of VirD2 and VirE2 proteins. Plant Cell 13: 369–384 This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|