|
|
||||||||
|
First published online December 27, 2007; 10.1104/pp.107.114702 Plant Physiology 146:492-504 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Functions of Chloroplastic Adenylate Kinases in Arabidopsis1,[W],[OA]Max-Planck-Institut für Molekulare Pflanzenphysiologie, 14476 Golm, Germany (P.R.L., C.G., R.Z.); and Freie Universität Berlin, Institut für Biologie, Pflanzenphysiologie, 14195 Berlin, Germany (G.T.)
Adenosine monophosphate kinase (AMK; adenylate kinase) catalyses the reversible formation of ADP by the transfer of one phosphate group from ATP to AMP, thus equilibrating adenylates. The Arabidopsis (Arabidopsis thaliana) genome contains 10 genes with an adenylate/cytidylate kinase signature; seven of these are identified as putative adenylate kinases. Encoded proteins of at least two members of this Arabidopsis adenylate kinase gene family are targeted to plastids. However, when the individual genes are disrupted, the phenotypes of both mutants are strikingly different. Although absence of AMK2 causes only 30% reduction of total adenylate kinase activity in leaves, there is loss of chloroplast integrity leading to small, pale-looking plantlets from embryo to seedling development. In contrast, no phenotype for disruption of the second plastid adenylate kinase was found. From this analysis, we conclude that AMK2 is the major activity for equilibration of adenylates and de novo synthesis of ADP in the plastid stroma.
Nucleotides are essential metabolites in a multitude of biochemical and developmental processes. Nucleotide levels depend on the interaction of purine and pyrimidine de novo synthesis and the respective degradation pathways, salvage reactions that recycle nucleosides and free bases, and phosphotransfer reactions that convert mono- and dinucleotides to the triphosphate form (Zrenner et al., 2006 2 ADP) and is considered to be a key enzyme activity in energy metabolism, equilibrating adenine nucleotides in vivo (Pradet and Raymond, 1983
Biochemical studies have shown the presence of this enzyme reaction in plants (Bomsel and Pradet, 1968
Database screening revealed that the genome of Arabidopsis (Arabidopsis thaliana) contains 10 genes with an adenylate/cytidylate kinase signature. To date, two of these genes have been further characterized; At5g26667 was identified as UMP/CMP kinase (Zhou et al., 1998
Phylogenetic Analysis of Adenylate Kinase Isoforms
For phylogenetic analysis, we used all 10 Arabidopsis kinases that belong to the same class of asparto-kinases (Cheek et al., 2002
The first branch of adenylate kinases contains two isoforms of Arabidopsis and two of rice. All these proteins are presumably cytosolic (Fig. 1A, yellow branch), as they are predicted not to have any signal, mitochondrial targeting, or chloroplast transit peptide. This was confirmed by stably transformed GFP-fusion with AMK3 (Fig. 1B, 1 and 2), but in subcellular proteome analyses both proteins (AMK3 and AMK4) were found in mitochondria (Millar et al., 2001
AMK2 and AMK5 together with two rice homologs are phylogenetically distinct and form the predicted plastid branch of plant adenylate kinases (Fig. 1A, green branch). The targeting of stably transformed GFP-fusions confirmed their plastidic localization (Fig. 1B, 3–6). This was supported by subcellular proteome analysis, where a stromal localization of AMK2 (Peltier et al., 2006
The more distantly related sequences are the previously characterized Arabidopsis AMK1, the potato ADK, and two further Arabidopsis AMKs together with three homologs of rice (Fig. 1A, gray branch). In comparison with adenylate kinases of other organisms (data not shown), this branch contains exclusively plant sequences. The closest homologs are from endoparasites like Plasmodium falciparum or Babesia bovis. Our study using a stably transformed GFP-fusion with AMK1 and transient expression of a GFP-fusion with AMK7 revealed mitochondrial localization of both proteins (Fig. 1B, 7–11). In contrast to these findings, there is a previous report describing particle bombardment with an AMK1 GFP-fusion construct and reduced adenylate kinase activity in isolated chloroplasts of mutants with disruption of AMK1. This led to the conclusion that AMK1 is located in plastids (Carrari et al., 2005
Correlation Analysis of Adenylate Kinase Expression in Arabidopsis
To elucidate putative specific functions, we screened available expression data for transcriptional co-regulation with all AMKs. Unfortunately, not all genes are represented on the Affymetrix ATH1 microarray including AMK6. Therefore, we also analyzed the expression patterns using quantitative real-time RT-PCR (Fig. 2A),
confirming that AMK1 to AMK5 are much higher expressed than AMK6, while AMK7 is at the detection limit. Using the Arabidopsis co-response database (Steinhauser et al., 2004
The co-response analysis showed distinct expression patterns for AMKs that are located on the previously identified phylogenetic branches. While AMK2 and AMK5 expression was positively correlated with the expression of genes involved in photosynthesis and major carbohydrate metabolism, the expression of AMK3, AMK4, and AMK1 was negatively correlated with genes of photosynthesis and uncorrelated with genes of carbohydrate metabolism. Whereas no significant correlation was detectable between the expression of AMK2, AMK5, AMK3, and AMK4 with genes of glycolysis, tricarboxylic acid cycle, mitochondrial electron transport, and ATP synthesis, a significant positive correlation was found for the expression of AMK1 with genes of light-independent energy metabolism. All these correlations were highly significant. Both genes of the unequivocal plastid branch (AMK2 and AMK5) showed identical expression correlations. Both genes of the probable cytosol branch (AMK3 and AMK4) also showed identical expression correlations; however, expression correlations of the plastid and the probable cytosol branch were obviously significantly different. This may lead to the speculation that adenylate kinases are redundant in their respective compartment. Interestingly, no correlated expressions were found with genes involved in nucleotide biosynthesis, although expression of genes involved in pyrimidine and purine de novo synthesis are coregulated to some extent (Giermann et al., 2002 Based on phylogenetic studies and the expression co-response analysis, we focused on the functional characterization of highly expressed plastidic adenylate kinases. For this purpose, we used two independent T-DNA insertion lines for the characterization of AMK2 and one line for the characterization of AMK5 (Fig. 3A). The structure of genes and regions of homology between both sequences demonstrate that the C terminus of AMK5 extends that of AMK2 by 290 amino acids. To date, no indication has been found of a possible function of this C-terminal domain.
Plants with insertions in AMK5 (SALK_000200) or AMK2 (SALK_031816, GABI-KAT_034C05) were obtained from the Salk collection (Alonso et al., 2003 Seeds from heterozygous plants that contain homozygous amk2 mutant embryos develop into slightly wrinkled seeds (data not shown). These seeds germinate and grow heterotrophically on medium containing Suc. The rescued homozygous amk2 seedlings were bleached and strongly retarded in growth compared to heterozygous mutants or wild types (Fig. 4A ). Under photoautotrophic conditions, both allelic amk2 mutations were lethal. For all experiments, the offspring of heterozygous Amk2 plants was used.
Homozygous amk5 mutants were isolated from a selfed population of SALK_000200. In comparison to wild types, no obvious growth or developmental differences were observed (Fig. 4B).
To determine whether the T-DNA insertion reduces the respective transcript level, quantitative real-time RT-PCR was performed. As shown in Figure 5 , virtually no AMK2 or AMK5 transcripts were detected in the respective mutant seedlings, thus confirming that amk2 and amk5 mutants can be regarded as complete knockout for the respective gene product.
To establish whether absence of either AMK2 or AMK5 expression results in altered transcript profiles for other genes involved in nucleotide metabolism, all genes of purine de novo synthesis, adenine recycling, and nucleotide phosphotransfer were analyzed. With the exception of PurE2 and APT4, all genes could be detected in 16-d-old, heterotrophically grown wild types (Supplemental Fig. S1). Although amk2 mutants show a rather severe phenotype, the differences observed for the tested transcript levels are considerably low (Fig. 5). Nevertheless, there is significantly reduced expression of genes involved in purine de novo synthesis (PurA, PurB, PurC, PurL, and PurM). Although amk5 mutants show no phenotype, there is significantly increased expression of genes involved in adenine salvage (Apt1 to Apt5, and Adk1 and Adk2). Also, the PRS genes, responsible for supplying phosphoribosyl pyrophosphate (PRPP) for de novo and salvage reactions, are significantly induced. Conspicuously, there is a 2.5-fold increase of AMK2 expression in amk5 mutants.
To establish whether the absence of either AMK2 or AMK5 expression results in altered protein abundance, polyclonal antibodies were raised against AMK2. Although the amino acid sequences in the N-terminal regions of the predicted mature proteins are highly homologous, the antibody turned out to be specific for AMK2 and does not cross react with AMK5 protein overexpressed in Escherichia coli (data not shown). Rosette leaves of amk2 plants contain no AMK2 protein (Fig. 6 ). Most striking is the increase of AMK2 protein in the amk5 mutants, confirming the doubling of AMK2 expression.
To provide evidence that AMK activities have been altered in the mutant lines, we measured total AMK activity of rosette leaves in both directions in heterotrophically grown amk2, amk5, and congenic wild types. Total adenylate kinase activity in amk2 was reduced by 21% in the forward reaction and 37% in the backward reaction compared to wild types, when activity was calculated on total leaf protein basis (Table I
). When calculated on a fresh weight (FW) basis, the reduction was a little more pronounced due to an altered protein to FW ratio in amk2 (data not shown). Wild-type activities measured in both directions in rosette leaves of heterotrophically grown Arabidopsis seedlings were approximately 4.1 nkat (mg protein)–1 and in agreement with previously reported values of tobacco (Nicotiana tabacum) leaf extracts (8.8 nkat [mg protein]–1; Schlattner et al., 1996
AMK5 Encodes AMK Activity As the complete loss of AMK5 transcript does not result in any reduction of AMK activity, it was tested whether AMK5 really encodes adenylate kinase. Full-length proteins of AMK2 and AMK5 using pET-DEST42 constructs were overexpressed in E. coli, and protein induction was checked with His-tag specific antibodies (Fig. 7A ). Production of AMK2 protein was always higher than AMK5. Purification of the His-tagged proteins proved to be impossible, as binding to nickel-nitrilotriacetic acid agarose could not be achieved under native conditions. Therefore, activity measurements were carried out with crude E. coli extracts together with control inductions. Total adenylate kinase activity of crude E. coli extracts was always higher in lines overexpressing AMK2 than in lines overexpressing AMK5, matching recombinant protein abundance (Fig. 7B). Independent of the variance in protein induction, there was always higher total AMK activity detectable in extracts that produced AMK2 or AMK5 compared to controls. This unequivocally demonstrates that both AMK2 and AMK5 encode adenylate kinase activity.
Nucleotide levels were investigated in rosette leaves of heterotrophically grown amk2, amk5, and congenic wild types. In comparison to controls, homozygous amk2 seedlings showed a significant reduction of total adenine nucleotides from 89.5 to 32.8 nmol (g FW)–1 (Table I). Inspection of the individual adenine nucleotides revealed that there was a significant decrease of ATP and ADP and no change of AMP. Calculation of the adenylate energy charge showed a significant decrease in amk2 plants. There is no change in nucleotide levels in plants in the absence of AMK5.
The co-response analyses showed that AMK2 transcription is coregulated with genes involved in photosynthesis, and the visual phenotype of amk2 mutants resembles that of mutants disrupted in genes involved in photosynthesis or "auxiliary" processes (Maiwald et al., 2003
We used antibodies raised against ATP synthase subunits atpF (subunit I of CFO) and atpA ( -subunit of CF1) to establish whether the ATP synthase complex is present in chloroplasts of amk2 mutants. Both protein complex subunits were detectable in wild types and in heterozygous mutants, while homozygous amk2 mutants lacked significant amounts of these two subunits (Fig. 8A
).
In addition, electron micrographs of wild-type, heterozygous, and homozygous amk2 seedlings were prepared. Chloroplasts of heterozygous and wild-type seedlings showed typical sun-leaf morphology (Fig. 8B, 1). In contrast, chloroplasts of homozygous amk2 mutants had generally lost the integrity of their thylakoid membrane structures and were very heterogeneous in their architecture. Many chloroplasts contained swollen grana thylakoids, whereas stroma thylakoids were rarely observed (Fig. 8B, 2 and 3). Very few examples of more intact chloroplasts could be found in amk2 (Fig. 8B, 4). Most chloroplasts from homozygous amk2 mutants were estimated to be 50% smaller than in heterozygous or wild-type plants. In addition, chloroplasts of homozygous amk2 seedlings regularly showed an increased number of lipophilic plastoglobuli.
To further investigate the function of AMK5, we created double mutants by intercrossing heterozygous amk2 and homozygous amk5 plants. Both genes are located on chromosome 5 with a genetic distance of approximately 27 cM between their loci. We determined the genotype of the F3 offspring from the F2 amk5 x AMK2-1/amk2-1 and amk5 x AMK2-2/amk2-2 plants. Both populations (209 and 208 seedlings, respectively) contained about 20% seedlings with a whitish amk2-like phenotype. PCR-based genotyping confirmed a Mendelian segregation for the amk2 mutation (data not shown). The slight reduction from the expected 25% homozygous amk2 mutants in the amk5 background can be attributed to the severity of the amk2 mutant phenotype and the weak genetic linkage of AMK2 and AMK5. We did not find additional phenotypic characteristics in double mutants. Thus, no hypothesis of the putative function of AMK5 can be given yet.
There are only a few reports of the in planta function of specific adenylate kinase isoforms so far. Regierer et al. (2002)
Stitt and coworkers found in their study using subcellular fractions of wheat (Triticum aestivum) protoplasts that 56% of total adenylate kinase activity is in plastids, 3% in the cytosol, and 41% associated with mitochondria (Stitt et al., 1982
Loss of AMK2 leads to an altered architecture of chloroplasts. This does not prevent embryo development and germination. Similar phenotypes have been observed with mutants in photosynthesis proteins (Maiwald et al., 2003
It was shown that two important subunits of the ATP synthase are not detectable in amk2. The loss of functional plastid ATP synthase is in agreement with a block of the photosynthetic electron transport chain of amk2, indicated by high qN. This correlates with low abundance of stroma thylakoids, the major location of ATP synthase. Grana thylakoids were present in amk2 mutants but were strongly swollen. From these observations, one might speculate that AMK2 is important for the photosynthetic electron flow by supplying the major part of ADP substrate to the ATP synthase complex. However, it is also likely that the severe chloroplast phenotype is an indirect result of the inability of the chloroplast to equilibrate its adenylates. This is supported by the impossibility to rescue amk2 seedlings by feeding with adenosine or IMP (Supplemental Fig. S2), while mutants in purine biosynthesis could be complemented by feeding nucleotide precursors (Hung et al., 2004
Nucleotide measurements showed that amk2 mutants have a reduced adenine nucleotide pool. These results indicate that disruption of AMK2 interferes with de novo synthesis of adenine nucleotides. Furthermore, a decrease of the adenylate energy charge was found. It has to be considered that these measurements include metabolites from plastids, the cytosol, and mitochondria. In mature leaves, approximately one-half of the adenylate pool is present in the plastids, 40% in the cytosol, and the remainder in mitochondria (Stitt et al., 1982
Several observations support the hypothesis that most ATP necessary for plastid-generated metabolites (such as nucleotides, lipids, or amino acids) is produced within the plastid. Most enzymes involved in the purine de novo synthesis are located in plastids (Moffatt and Ashihara, 2002
The complete loss of AMK5 transcript does not result in reduction of total AMK activity or any visible phenotype, indicating that AMK5 is nonessential or redundant with other adenylate kinases. The disruption of AMK5 is alleviated by the doubling of AMK2 expression and increasing AMK2 protein, demonstrating that other AMK activities can compensate loss of AMK5. This is in agreement with the fact that we were able to obtain amk2 x amk5 double mutants with no additional phenotypic characteristics. Both AMK2 and AMK5 show adenylate kinase activity and comparable transcript profiles in young embryos (Spencer et al., 2007
Adenylate kinases equilibrate adenylates by reversible formation of ADP through transfer of one phosphate group from ATP to AMP. Adenylate kinase activity is encoded by a gene family in Arabidopsis. Functional analysis using T-DNA insertion mutants revealed that only one member of the adenylate kinase gene family is important for equilibration of adenylates and de novo synthesis of ADP in the plastid stroma.
Plant Materials and Growth Conditions Arabidopsis (Arabidopsis thaliana) Columbia-0, SALK_031816 (amk2-1), and SALK_000200 (amk5) were obtained from Nottingham Arabidopsis Stock Centre (University of Nottingham, Loughborough, UK), and GABI_300A04 (amk2-2) was obtained from the GABI-Kat collection (Max-Planck-Institut für Züchtungsforschung, Cologne, Germany). Seeds were surface sterilized and aseptically grown on media containing one-half strength Murashige and Skoog (MS) salts, 0.25 mM MES, pH 5.7 (KOH), 0.5% (w/v) Suc, and 0.7% (w/v) agar. Seeds were imbibed at 5°C in darkness for 48 h and grown in a 12-h photoperiod (photon flux density, 150 µmol m–2 s–1; 22°C light, 18°C dark). Plants on soil were grown in a 16-h photoperiod (photon flux density, 120 µmol m–2 s–1; 60% relative humidity, 20°C light, 18°C dark).
The entire open reading frames of AMKs were amplified from first-strand cDNA by PCR with Pfu-polymerase (MBI Fermentas) using the following oligonucleotides: amk1_5, CACCATGGCGAGATTAGTGCGTGT; amk1_3, TGCTGCGACAGACTGTTTCTC; amk2_5, CACCATGACGGGCTGTGTGAATTC; amk2_3, ACTTAAAAGTGAACTTGGAGCAGTG; amk3_5, CACCATGGCAACGAGCAGTGC; amk3_3, TGTAGACACAACCTTCTTCACCAC; amk5_5, CACCATGGCGTCTCTTTCTCTCAGTTC; amk5_3, CGAAAACACGCTACTCAAGAACC; amk7_5, CACCATGGCCTGGCTTAGCCG; and amk7_3, GAAAAGTACCTCCTGTGCGTAGACA.
PCR products were inserted into entry vector PENTR/SD/D-TOPO according to the manufacturer's instructions (Invitrogen). For sequence confirmation, positive entry clones were sequenced (MWG Biotech). Clones were recombined into pK7FWG2 plant transformation vector for C-terminal GFP-fusion (Karimi et al., 2002
Gene and protein sequences were obtained from The Arabidopsis Information Resource (www.arabidopsis.org) and the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov) using homology (BLAST) searches. Sequence comparisons were done with ClustalW software (www.ebi.ac.uk/clustalW). For analysis of evolutionary relationships, we exploited the conserved domain database cdd (www.ncbi.nlm.nih.gov/Structure/cdd) with cd01428 ADK using CDTree (www.ncbi.nlm.nih.gov/Structure/cdtree). For predicting intracellular localization of mature proteins, the software packages Target P1.1 (www.cbs.dtu.dk/services/TargetP/; Emanuelsson et al., 2007
For transcriptional correlation analysis, we used the Arabidopsis co-response database (csbdb.mpimp-golm.mpg.de; Steinhauser et al., 2004
For the localization of GFP-fusions, a confocal microscope system (Leica and Leica Confocal Software LCS) was used. Pictures of dissected siliques and embryos were taken using a SPOT-RT camera (Visitron) attached to an Olympus Systemmicroscope BX41TF (Olympus) controlled by the MetaVue software package (Visitron).
For electron microscopy, pieces of 2 mm2 from rosette leaves were fixed for 2 h with 2.5% (v/v) glutaraldehyde in 0.1 M sodium-potassium phosphate, pH 7.0, including 2% (w/v) paraformaldehyde and 0.05% (w/v) tannic acid. After washing with phosphate buffer, samples were incubated for 12 h in 50 mM sodium-potassium phosphate, pH 7.0, containing 1% (w/v) osmium tetroxide. After washing with phosphate buffer, the samples were dehydrated in a graded series of ethanol, followed by propylene oxide, incubated in a mixture of propylene oxide/ERL (v/v) and pure ERL (Spurr, 1969
Screening and selection within the mutant population was done following the Signal Salk/GABI-Kat instructions (www.signalsalk.edu and www.mpiz-koeln.mpg.de/GABI-Kat/General_Information). For genotyping, a small leaf or a single dissected embryo and the following oligonucleotides were used: S_031816 L, CCAAATTTCAGGTGAATGATTGT; S_031816R, GCTATAAGTGGCCGAGTTAAGGT; G_034C05L, AAATACCAAATGCAAACGAATAGG; G_034C05R, CGATAATCGACGGAGATCTTGATA; S_000200 L, GTTTACCGGATAGGAACCTTGAT; S_000200R, GATATTTACCAATTGCACCAAGC; GABI_R, CCAAAGATGGACCCCCACCCAC; and SALK_LBb1, GCGTGGACCGCTTGCTGCAACT. All measurements were carried out with plants of the fourth or fifth generation.
Total RNA was isolated using the NucleoSpin plant kit (Macherey & Nagel), including an on-column DNaseI digestion. For quantitative real-time RT-PCR, complete 16-d-old sterile, culture-grown seedlings were used.
For real-time RT-PCR, single-stranded cDNA synthesis was carried out with total RNA using SuperScript III RNase H– reverse transcriptase (Invitrogen). Quantitative two-step RT-PCR was performed using the SYBR Green 1 protocol (Wittwer et al., 1997
Overexpression in E. coli and His-tagged purification of recombinant proteins were done using standard procedures (QIAexpressionist; Qiagen), with the exception that induction was performed at 20°C. Denaturing purification was used to isolate AMK2. Antibodies were produced in rabbits by Eurogentec. Native isolation was applied for activity measurements. As control, pET-DEST42 was used containing a 370-bp fragment of β-lactamase that does not encode any peptide sequence.
Frozen plant material was ground in liquid nitrogen using a ball-mill. Then 10- to 20-mg aliquots were extracted by vortexing with 50 to 200 µL of extraction buffer. Composition of extraction buffer was 100 mM Tricine, pH 7.8 (KOH), 10% (v/v) glycerol, 0.1% (v/v) Triton X-100, 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine, 1 mM
Proteins were extracted with homogenization buffer containing 150 mM Tris-HCl, pH 7.5, 10 mM KCl, 10% (v/v) glycerol, 0.01% Triton X-100, and 1 mM β-mercaptoethanol. Extracts were centrifuged at 15,000g, 10 min, 4°C. After quantification, 10 µg of each extract was subjected to SDS-PAGE (12%). For immunodetection, proteins were transferred to Immobilon-P membranes (Millipore) by semidry electroblotting (Bio-Rad). The membranes were incubated with antisera raised against AMK2 protein or thylakoid membrane proteins (generously provided by J. Meurer, Ludwig-Maximilians University, Munich), and signals were detected using secondary antibody alkaline phosphatase conjugates and NBT/BCIP (Sigma) as substrate. For detection of His-tags, the INDIA-HisProbe-HRP (Pierce) and chemiluminescence detection were used.
Chlorophyll fluorescence measurements were performed using pulse amplitude modulated fluorometer PAM (2000) interfaced with the data acquisition system (Pamwin; Walz). Leaves were dark adapted for 20 min prior to induction fluorescence measurements. Minimal (Fo) and maximal (Fm) fluorescence, Fm in the light (Fm'), steady-state fluorescence immediately prior to the flash (Ft), and the ratio ([Fm' – Ft]/Fm') reflecting the
Plant material was quickly frozen in liquid nitrogen and extracts were made using the trichloroacetic acid procedure (Jelitto et al., 1992
The following materials are available in the online version of this article.
We thank the Nottingham Arabidopsis Stock Centre (NASC) and German Plant Genomics Program (GABI-Kat) for seeds. The authors thank J. Meurer (Ludwig-Maximilians Universität, Munich ) for providing antibodies against atpA and atpF, J. Fisahn (Max-Planck-Institut für Molekulare Pflanzenphysiologie, Golm, Germany) for providing assistance with the chlorophyll fluorescence analysis, B. Usadel (Max-Planck-Institut für Molekulare Pflanzenphysiologie, Golm, Germany) for help with gene expression correlations, F. Kaulbars (Freie Universität Berlin, Institut für Biologie, Berlin) for help with electron microscopy, and M. Stitt (Max-Planck-Institut für Molekulare Pflanzenphysiologie, Golm, Germany) for critically reading the manuscript and the very helpful discussions. Received December 7, 2007; accepted December 21, 2007; published December 27, 2007.
1 This work was supported by the Deutsche Forschungsgemeinschaft (fellowship no. Zr3/2 to R.Z.) as part of The Arabidopsis Functional Genomics Network, and by the Max-Planck-Society.
2 Present address: Leibniz-Institut für Pflanzenbiochemie, Weinberg 3, 06120 Halle, Germany. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Rita Zrenner (zrenner{at}mpimp-golm.mpg.de).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.114702 * Corresponding author; e-mail zrenner{at}mpimp-golm.mpg.de.
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657 Arnon GI (1949) Copper enzymes in isolated chloroplasts. Plant Physiol 24: 1–15 Atkinson DE (1968) The energy charge of the adenylate pool as a regulatory parameter. Interaction with feedback modifiers. Biochemistry 7: 4030–4034[CrossRef][ISI][Medline] Bannai H, Tamada Y, Maruyama O, Nakai K, Miyano S (2002) Extensive feature detection of N-terminal protein sorting signals. Bioinformatics 9: 298–305 Birkenhead K, Walker D, Foyer CH (1982) The intracellular distribution of adenylate kinase in the leaves of spinach, wheat and barley. Planta 156: 171–175[CrossRef][ISI] Boldt R, Zrenner R (2003) Purine and pyrimidine biosynthesis in higher plants. Physiol Plant 117: 297–304[CrossRef][Medline] Bomsel JL, Pradet A (1968) Study of adenosine 5'-mono-,di- and triphosphates in plant tissues. IV. Regulation of the level of nucleotides, in vivo, by adenylate kinase: theoretical and experimental study. Biochim Biophys Acta 162: 230–242[Medline] Bosco CD, Lezhneva L, Biehl A, Leister D, Strotmann H, Wanner G, Meurer J (2004) Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. J Biol Chem 279: 1060–1069 Buchanan JM, Hartmann SC (1959) Enzymatic reactions in the synthesis of purines. Adv Enzymol Relat Areas Mol Biol 21: 199–216[CrossRef] Carrari F, Coll-Garcia D, Schauer N, Lytovchenko A, Palacios-Rojas N, Balbo I, Rosso M, Fernie AR (2005) Deficiency of a plastidial adenylate kinase in Arabidopsis results in elevated photosynthetic amino acid biosynthesis and enhanced growth. Plant Physiol 137: 70–82 Chapman AG, Fall L, Atkinson DE (1971) Adenylate energy charge in Escherichia coli during growth and starvation. J Bacteriol 108: 1072–1086 Cheek S, Zhang H, Grishin NV (2002) Sequence and structure classification of kinases. J Mol Biol 320: 855–881[CrossRef][ISI][Medline] Christopherson RI, Szabados E (1997) Nucleotide biosynthesis in mammals. In L Agius, HAS Sherratt, eds, Channeling in Intermediary Metabolism. Portland Press, London, pp 315–335 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][ISI][Medline] Duchene AM, Giritch A, Hoffmann B, Cognat V, Lancelin D, Peeters NM, Zaepfel M, Marechal-Drouard L, Small ID (2005) Dual targeting is the rule for organellar aminoacyl-tRNA synthetases in Arabidopsis thaliana. Proc Natl Acad Sci USA 102: 16484–16489 Emanuelsson O, Brunak S, von Heijne G, Nielsen H (2007) Locating proteins in the cell using TargetP, SignalP, and related tools. Nat Protoc 2: 953–971[CrossRef][Medline] Farre EM, Tiessen A, Roessner U, Geigenberger P, Tretheway RN, Willmitzer L (2001) Analysis of the compartmentation of glycolytic intermediates, nucleotides, sugars, amino acids and sugar alcohols in potato tubers using a non-aqueous fractionation method. Plant Physiol 127: 685–700 Froehlich JE, Wilkerson CG, Ray WK, McAndrew RS, Osteryoung KW, Gage DA, Phinney BS (2003) Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. J Proteome Res 2: 413–425[CrossRef][ISI][Medline] Geigenberger P, Stitt M (2000) Diurnal changes in sucrose, nucleotides, starch synthesis and AGPS transcript in growing potato tubers that are suppressed by decreased expression of sucrose phosphate synthase. Plant J 23: 795–806[CrossRef][ISI][Medline] Giege P, Heazlewood JL, Roessner-Tunali U, Millar AH, Fernie AR, Leaver CJ, Sweetlove LJ (2003) Enzymes of glycolysis are functionally associated with the mitochondrion in Arabidopsis cells. Plant Cell 15: 2140–2151 Giermann N, Schröder M, Ritter T, Zrenner R (2002) Molecular analysis of de novo pyrimidine synthesis in solanaceous species. Plant Mol Biol 50: 393–403[CrossRef][ISI][Medline] Hampp R, Goller M, Ziegler H (1982) Adenylate levels, energy charge, and phosphorylation potential during dark-light and light-dark transition in chloroplasts, mitochondria, and cytosol of mesophyll protoplasts from Avena sativa L. Plant Physiol 69: 448–455 Heazlewood JL, Tonti-Filippini JS, Gout AM, Day DA, Whelan J, Millar AH (2004) Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. Plant Cell 16: 241–256 Hung WF, Chen LJ, Boldt R, Sun CW, Li HM (2004) Characterization of Arabidopsis glutamine phosphoribosyl pyrophosphate amidotransferase-deficient mutants1. Plant Physiol 135: 1314–1323 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||