| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online December 14, 2007; 10.1104/pp.107.112334 Plant Physiology 146:515-528 (2008) © 2008 American Society of Plant Biologists Sucrose Transporter StSUT4 from Potato Affects Flowering, Tuberization, and Shade Avoidance Response1,[W]Institute of Biology, Plant Physiology, Humboldt University, 10115 Berlin, Germany (I.A.C., J.L., U.K., B.G., C.K.); and Max Planck Institut für Molekulare Pflanzenphysiologie, 14476 Potsdam-Golm, Germany (J.M., P.G.)
Sucrose (Suc) transporters belong to a large gene family. The physiological role of SUT1 proteins has been intensively investigated in higher plants, whereas that of SUT4 proteins is so far unknown. All three known Suc transporters from potato (Solanum tuberosum), SUT1, SUT2, and SUT4, are colocalized and their RNA levels not only follow a diurnal rhythm, but also oscillate in constant light. Here, we examined the physiological effects of transgenic potato plants on RNA interference (RNAi)-inactivated StSUT4 expression. The phenotype of StSUT4-RNAi plants includes early flowering, higher tuber production, and reduced sensitivity toward light enriched in far-red wavelength (i.e. in canopy shade). Inhibition of StSUT4 led to tuber production of the strict photoperiodic potato subsp. andigena even under noninductive long-day conditions. Accumulation of soluble sugars and Suc efflux from leaves of transgenic plants are modified in StSUT4-RNAi plants, leading to modified Suc levels in sink organs. StSUT4 expression of wild-type plants is induced by gibberellins and ethephon, and external supply of gibberellic acid leads to even more pronounced differences between wild-type and StSUT4-RNAi plants regarding tuber yield and internode elongation, indicating a reciprocal regulation of StSUT4 and gibberellins.
Phylogenetic analysis of the Suc transporter gene family shows redundancies in the SUT1 clade representing transporters involved in phloem loading and long-distance transport of Suc (Riesmeier et al., 1993  ; Kühn, 2003). The well-characterized members of the SUT1 family are highly expressed and essential in phloem loading. In contrast, the SUT2 and SUT4 families are represented with only one member each per species and expressed at a very low level, suggesting a function different from SUT1 (Kühn, 2003). For example, LeSUT2 plays an important role in pollen tube growth and pollen germination, thereby affecting fruit yield in tomato (Lycopersicon esculentum) plants (Hackel et al., 2006).
The function of the SUT4 protein remains to be elucidated. The activity of SUT4 proteins has been shown by Suc uptake experiments and yeast (Saccharomyces cerevisiae) complementation with AtSUT4 from Arabidopsis (Arabidopsis thaliana), StSUT4 from potato (Solanum tuberosum; Weise et al., 2000
The aim of our work is the elucidation of the undercharacterized Suc transporter StSUT4 by help of transgenic plants. We addressed the putative role of StSUT4 in the regulation of flower induction and tuberization in potato plants. Potato is a short-day (SD) plant regarding tuberization and a long-day (LD) plant regarding flowering (Schittenhelm et al., 2004
Photoperiodic regulation is not only important to determine flowering time in many plants, but promotes tuberization in potato as well. Flowering tobacco (Nicotiana tabacum) shoots grafted onto potato stocks promote tuberization, indicating that the floral and tuber-inducing signals might be similar. Thus, common regulatory pathways were assumed to be involved in both flowering and tuberization responses (Rodriguez-Falcon et al., 2006 Inhibition of StSUT4 expression in transgenic potato plants by RNA interference (RNAi) leads to early flowering and increased tuber yield. The interrelation between the observed phenomena with photoperiodic control was tested by using the strictly photoperiodic potato subsp. andigena instead of subsp. tuberosum. Graft experiments showed that the flower and tuber-inducing stimulus is graft transmissible and requires the presence of source leaves, arguing for a phloem-mobile leaf-derived signal. In addition, StSUT4-RNAi plants do not alter the elongation of internodes, leaf angle, flowering, or apical dominance in response to shading by neighboring plants or in response to far-red light enrichment. They do not display what is summarized by the shade avoidance syndrome (SAS), suggesting that photoreceptor signaling is deregulated. It will be discussed whether there is convergence of the signal transduction mechanisms triggering flowering, tuberization, and shade avoidance response.
StSUT4 Is a Plasma Membrane Protein
Whereas StSUT1 is mainly expressed in exporting source leaves (Riesmeier et al., 1993
StSUT4 is functional in Suc uptake in yeast cells (Weise et al., 2000 ). Thus, plasma membrane-specific localization is a prerequisite for this Suc uptake. Two-phase partitioning of plant microsomal membranes separating the plasma membrane and endosomal membrane fraction revealed preferential localization of StSUT4 in the plasma membrane fraction (Fig. 1B) as shown by the use of a StSUT4-specific peptide antibody (Weise et al., 2000). In the microsomal and endosomal fraction, a smaller band of 38 kD is recognized by the StSUT4-specific antibody, which might represent a degradation product of the StSUT4 protein. Western-blot analysis was confirmed by localization studies with a StSUT4-GFP fusion protein in infiltrated tobacco and potato leaves. The protein was localized at the plasma membrane (Fig. 1C) and, in addition, in a perinuclear ring (Fig. 1, D–G). A similar phenomenon is observed when LeSUT4 from tomato fused to GFP is expressed in yeast cells (Fig. 1H). Expression of GFP fusion constructs in yeast and plant cells is interpreted as dual targeting of SUT4 to both the plasma membrane and endomembranes surrounding the nucleus.
SUT1 transcript levels from tomato show diurnal oscillation with the highest expression at the end of the light period (Kühn et al., 1997
Inhibition of SUT4 Leads to Early Flowering and Tuberization As many as nine independent transformant lines have been identified with efficiently down-regulated expression of the StSUT4 gene (Supplemental Fig. S1). PCR analysis confirmed the presence of the StSUT4-RNAi construct and real-time PCR revealed reduction of StSUT4 expression in the tissue of highest endogenous StSUT4 RNA content. StSUT4 expression level is reduced up to 67% in flowers compared to wild-type flowers. StSUT4 inactivation is specific and StSUT1 expression was not significantly altered in StSUT4-RNAi plants (Supplemental Fig. S2). Seven transformant lines with significant reduction of StSUT4 expression in flowers were selected for further analysis. After 4 weeks of growth under LD conditions, potato plants with reduced StSUT4 expression started to flower at least 6 d before wild-type flowering (Figs. 3A and 4A ). StSUT4-RNAi plants had significantly fewer leaves at flowering time than wild-type plants (Fig. 4A). Neither potato ‘Désirée’ wild-type plants nor StSUT4-RNAi plants were able to flower under SD conditions. The selected transformants showed reduced internode elongation regardless of the day length or light quality (Figs. 3B and 8B; Supplemental Fig. S3). Moreover, they tuberized earlier than control plants and showed significantly increased tuber yields (with P < 0.05) when grown under LD conditions (Fig. 4B; Table I ) and only slightly increased yield when grown under SD conditions compared to wild-type plants (data not shown).
Whereas potato subsp. tuberosum is able to tuberize under LD conditions, potato subsp. andigena requires an obligatory SD period for tuberization and does not tuberize under LD conditions (Jackson et al., 1998 ). We tested whether the effect of StSUT4 on tuberization depends on the day length. Transformation of the strictly photoperiodic potato subsp. andigena was performed with the same StSUT4-RNAi construct as used for transformation of potato ‘Désirée’. Six independent transformant lines with reduced StSUT4 expression were selected (Supplemental Fig. S1; up to 50% reduction of the StSUT4 expression level in source leaves of transgenic potato plants). All six transformant lines (1) were able to produce tubers in at least two out of three independent experiments when grown in the greenhouse under noninductive LD conditions (Fig. 3, D and E); (2) had shorter internodes (Fig. 3C); and (3) showed early flowering compared to andigena wild-type plants (Fig. 3F). The ability to produce tubers even under LD conditions is correlated with a reduction of the StSUT4 expression in these plants (Supplemental Fig. S1). Thus, nine independent transgenic lines of potato subsp. tuberosum and six independent transgenic lines of the photoperiodic potato subsp. andigena show similar effects on flowering and tuberization upon inhibition of StSUT4 expression.
To analyze whether the flower and tuber-inducing signal is graft transmissible, reciprocal grafts were performed with transgenic StSUT4-RNAi and wild-type potato plants (subsp. tuberosum and subsp. andigena) after the plants had developed four to five leaves, and with or without removal of the source leaves of the corresponding graft rootstock. Flowering time was recorded and tubers of grafted plants were harvested 3 months after transfer of the plants into the greenhouse. Wild-type potato plants from both species, which were grafted with StSUT4-RNAi plants that included their leaves, showed a similar phenotype as transgenic StSUT4-RNAi plants: They displayed early flowering (Fig. 5A ) and produced higher amounts of tubers as compared to grafts with control plants (Fig. 5C). Therefore, it is suggested that a phloem-mobile information molecule is involved in triggering flowering time and tuberization in a SUT4-dependent manner. Both early flowering as well as higher tuber yield strongly depend on the presence of source leaves of the rootstock regardless of its genotype. It cannot be excluded that the reduced total leaf area available for assimilation has an impact on the tuber yield.
SUT4 Inhibition Induces Increased Suc Efflux and Changes in Sugar Accumulation Detailed analysis of the content of soluble sugars at different time points over the day revealed significant differences between wild-type and RNAi plants, depending on the time of day (Fig. 6, A–C ). Whereas soluble sugars are present in lower concentration in the source leaves of transgenic plants than in those of wild-type plants at the beginning and in the middle of the light period, they accumulate to much higher amounts at the end of the light period. This increase in the content of soluble sugars in StSUT4-RNAi plants is accompanied by an increase in Suc efflux. Suc export from petioles of transgenic plants as measured by exudation in the presence of EDTA was twice as much as in wild-type plants at the end of the light period (Fig. 6D).
As expected, due to the strong increase of Suc efflux rates at the end of the light period, Suc content in sink organs was consequently affected as well. Suc as well as starch content are significantly increased in in vitro-induced microtubers of StSUT4-RNAi plants compared to wild-type tubers (Fig. 6E). Suc content in the shoot apical meristems was measured at different developmental stages (Fig. 6F). Whereas the content of Glc and Fru was not significantly changed between wild-type and transgenic plants, the level of Suc differs conspicuously. As already described in Arabidopsis (Eriksson et al., 2006 ), a Suc peak can be observed in the shoot apical meristem shortly before flower onset when the wild type undergoes transition from the vegetative to the generative phase. In contrast, Suc levels in StSUT4-RNAi apical meristems show peak levels much earlier. This correlates with early flower induction in transgenic plants. Floral buds are detectable when the transgenics developed five to six mature leaves, whereas wild-type plants had more than 10 mature leaves when first buds are visible (Fig. 6F). Thus, modified Suc efflux from leaves is accompanied by changes of Suc levels in terminal sinks.
Transgenic plants have shorter stems due to reduced internode elongation, and show early flowering and higher tuber yield. Tuberization in potato is negatively controlled by GAs and phytochrome B (phyB; Jackson and Prat, 1996
At least for tobacco plants it was shown that ethylene and GAs interact in phy-mediated SAS (Pierik et al., 2004a
Transcript levels of both ethylene and GA biosynthetic key enzymes were determined by quantitative real-time PCR. Quantification of the transcript level of the GA biosynthetic enzyme GA20ox1 as well as 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase StACO3 showed significant changes in StSUT4-RNAi plants compared to potato wild-type plants (Fig. 7, B and C). The level of GA20ox1 is significantly decreased in StSUT4-RNAi plants at dawn, which might explain the increase in tuber yield and the reduction of internode elongation (Fig. 7B). StSUT4 expression is not only increased by GAs, but also by ethephon treatment, a precursor of ethylene (Fig. 7A). Quantification of the transcript level of the ethylene biosynthetic enzyme ACC oxidase StACO3 was found to be significantly decreased in StSUT4-RNAi plants at any time of day (Fig. 7C). Ethylene as well as GA biosynthesis might therefore be affected in StSUT4-RNAi plants.
Stem elongation and early flowering belong to SAS. The shade avoidance response is phyB-mediated and antagonized by phyA (Vandenbussche et al., 2005 The experiment was repeated under artificial shade conditions in the phytochamber, where plants were grown under white light or under white light with an additional source of far-red light (>730 nm). After 3 weeks of growth under these artificial shade conditions, internode elongation of StSUT4-RNAi plants was not significantly increased if compared to identical plants grown under white light, whereas wild-type plants showed significantly increased internode elongation and stem length, as expected (Fig. 8, C and D). Thus, StSUT4-RNAi plants behave similarly under canopy shade as under far-red light enrichment.
Because StSUT4-RNAi plants behave similar to GA20ox1 antisense potato plants regarding internode elongation, stem length, and tuberization (Carrera et al., 2000 Regarding tuber yield, not only the tuber size was increased in StSUT4-RNAi plants, but also the tuber number (Fig. 9B), indicating that not only the starch accumulation and tuber development is disturbed but also the induction of tuberization. However, paclobutrazol, a specific inhibitor of GA biosynthesis, was able to mimic the StSUT4-RNAi phenotype in wild-type plants. Paclobutrazol treatment resulted in the same internode length in wild-type and StSUT4-RNAi plants (Fig. 9C), indicating that the GA-induced response is already impaired in StSUT4-RNAi plants.
Localization of SUT4-GFP in Plant Cells
Members of the SUT4 subfamily, namely, AtSUT4 from Arabidopsis, StSUT4 from potato, and HvSUT2, the SUT4 ortholog in barley, are able to contribute to the 14C-Suc uptake into yeast cells at the plasma membrane (Weise et al., 2000
SUT1 is the most important Suc transporter for the efflux of Suc from mature leaves because it is highly expressed in source leaves. SUT2 and SUT4 expression is more prominent in sink tissues (Fig. 1A). Our transcript analysis of StSUT4 confirms its low expression and revealed a significant reduction of StSUT4 in flowers of StSUT4-RNAi plants (Supplemental Fig. S1). StSUT1 mRNA levels are unaffected in StSUT4-RNAi plants (Supplemental Fig. S2). Thus, transcriptional control of SUT1 via SUT4 is unlikely. Nevertheless, Suc efflux from leaves is significantly increased at the end of the light period in StSUT4-RNAi plants and Suc content is increased in in vitro-grown tubers and at earlier stages in the shoot apical meristem of StSUT4-RNAi plants (Fig. 6). Changes in source-to-sink allocation in transgenic plants might be one reason for the early onset of flowering and tuberization.
Overexpression of a SUT1 gene in transgenic tobacco plants leads to a similar early-flowering phenotype as observed for StSUT4 inhibition in potato plants (Riesmeier and Frommer, 1994
It is known from yeast two-hybrid studies that the LeSUT4 protein is able to interact with LeSUT1 protein in yeast (Reinders et al., 2002
SAS is a very complex reaction of plants toward canopy shade of neighboring plants involving photoperiodic control and the interaction of phytochromes and blue-light receptors. SAS is not only triggered by the red to far-red light ratio via phytochromes, but also by a reduction of blue light under canopy shade (Pierik et al., 2004b
PhyB is known to inhibit flowering in LD plants like Arabidopsis because phyB mutants show early flowering (Guo et al., 1998 Thus, phyB inhibits tuberization and flowering in LD conditions and is relevant for the induction of a shade avoidance response under a far-red-enriched light regime. StSUT4-RNAi plants flower and tuberize earlier and do not show shade avoidance response, suggesting that mediation of the photoreceptor signal transduction correlates with sufficient SUT4 levels. Because StSUT4-RNAi plants have a lower phyB-mediated shade avoidance response, phy-mediated inhibition of flowering parallels with StSUT4 expression in potato plants. Thus, in StSUT4-RNAi plants, the phyB transcript level is unaffected, but StSUT4 seems to be required to transfer the phyB-emitted signal further downstream.
StSUT4 might act downstream of photoreceptors detecting the light quality in source leaves, and upstream of ethylene and GAs (as summarized in Fig. 10
). So far, it is known that both photoreceptors, sugar, and phytohormones such as ethylene and GAs are involved in shade avoidance (Pierik et al., 2004a
SUT4 Is Involved in GA Signaling
PhyB action negatively affects flowering in LD plants and inhibits tuberization in potato plants (Jackson and Prat, 1996
In tobacco plants, the phy-mediated shade avoidance response involves ethylene action by modulating GA action (Pierik et al., 2004a
The phenotype of StSUT4-RNAi plants including decreased length of internodes and early tuberization leading to higher tuber yields was exactly described for plants with reduced expression of GA20ox1 (Carrera et al., 2000
Feedback control of GA3 biosynthetic enzymes by GA3 and diurnal oscillation in potato under SD conditions has already been described (Carrera et al., 1999
Strong expression of StSUT4 in flowers and tubers argues for an important role of this membrane protein in sink organs. Nevertheless, the observed effects regarding photoperiodically regulated developmental processes in StSUT4-RNAi plants like early flowering and tuberization under LD conditions are graft transmissible and depend on the presence or absence of source leaves, indicating an important role of SUT4 not only in sink tissues, but also in source leaves where photoperception occurs. Therefore, a long-distance component is needed to transmit the information from photoreceptors in leaves to GA biosynthesis in tubers and flower induction in the shoot apical meristem. Several phloem-mobile signaling molecules are discussed and Suc itself might play a role as a phloem-mobile signaling molecule (Smeekens, 2000
It is also discussed that assimilates act as a part of a complex flowering signal (Bernier and Perilleux, 2005 We were able to show that peak Suc levels are detectable earlier in the apical meristem of StSUT4-RNAi plants, which is a strong argument for the Suc molecule to be necessary to build up a flower-inducing component in potato plants. Temporal and spatial fine tuning of Suc concentrations as well as GA levels seems to be extremely important to integrate flower and tuber-inducing mechanisms. Therefore, we conclusively suggest that StSUT4 seems to play an important role in the interconnection of carbon availability with flower-inducing mechanisms, thereby linking light quality with light quantity effects on flowering and tuberization.
Recombinant DNA
Isolation of StSUT4 cDNA was described previously (Weise et al., 2000
The RNAi construct was cloned into the pRT 100 derivative (Töpfer et al., 1987
Gene transfer into plants was performed with Agrobacterium tumefaciens (strain C58C1, pGV2260; Deblaere et al., 1985
Potato plants in sterile culture were grown on 2x Murashige and Skoog medium (Murashige and Skoog, 1962
Stem segments including at least one node of 6-week-old sterile potato plants were prepared under sterile conditions and planted on Murashige and Skoog medium containing 10% Suc. After 1 week under LD conditions in the growth chamber (16 h light/8 h dark, 24°C), scions were transferred into darkness to induce tubers. In vitro tubers were harvested after 20 d.
Transgenic plants were amplified in tissue culture and 60 plants were transferred to soil and grown in a cycle of 16 h light (22°C)/8 h dark (15°C) in 60% humidity. The mean photosynthetic photon flux density (PPFD; 400–700 nm) was about 150 µmol photons m–2 s–1 and additional illumination was provided by high-pressure sodium lamps SON-T Green Power and metal halide lamps MASTER LPI-T Plus (Philips Belgium). Emitted light from Philips SON-T Green Power has a red to far-red ratio (660/730 nm) of 2.63 and from Philips HPI-T Plus of 1.25. Both lamps are distributed equally in the greenhouse.
Experiments were repeated independently using either in vitro-propagated clones of the transformants or potato tubers. Determination of internode elongation was performed as described elsewhere (Martinez-Garcia et al., 2001 Phytohormone treatment was performed over a 2-week period by spraying plants with 20 µM GA3 solution supplied with two drops of Triton X-100 per liter. Control plants were sprayed with water containing two drops of Triton X-100. Ethephon and paclobutrazol were supplied in a concentration of 350 µM, AgNO3 as a 1 mM solution. All chemicals were purchased from Sigma-Aldrich.
Plants were grown for 3 weeks in a phytochamber (Heraeus) at 24°C under LD conditions with a white-light source (Osram L36W-31) and an additional far-red light source (Chopper light type 730 supplied with a Hama 730-nm filter; Chopper Light GmbH). Control plants were exposed to white light alone. PPFD was 290 µmol photons m–2 s–1 as determined with a LI-189 (LI-COR). The experiment was performed with the wild type and three different transgenic lines (n = 3 per plant line).
Plants had four to five leaves in total when grafted. The experiment was performed as described elsewhere (Martinez-Garcia et al., 2001
Soluble sugars and starch were quantified in potato leaf samples extracted with 80% ethanol and 20 mM HEPES-KOH, pH 7.5, as described previously (Hackel et al., 2006
RNA was isolated from different organs of greenhouse-grown potato ‘Désirée’ and andigena or from leaf discs of potato plants grown in the phytochamber. RNA extraction was performed with Trisure (Bioline) or peqGold Trifast (Peqlab) according to the manufacturer's protocol. Reverse transcription (RT) was performed with the Qiagen Omniscript RT kit according to the manual. Optimized conditions included using oligo(dT) primers for the initial RT reaction on approximately 1 µg of total RNA after digestion with RNase-free DNase (Qiagen). Aliquots of 0.2 µL of the 10-µL RT reaction were used for the subsequent PCR reaction in the presence of SYBR Green with HotGoldStar DNA polymerase (Eurogentec) in a Rotor Gene 3000 cycler (LTF Labortechnik) using Rotor Gene software (version 4.6.94). The best products were obtained with the following program: denaturation at 95°C for 30 s, annealing for 30 s at 61°C, and elongation for 30 s at 72°C, in a program of 45 cycles in a 20-µL reaction volume. Relative quantification of transcript amounts was always calculated in relation to the respective ubiquitin transcript level and given as percentage of ubiquitin. Primers were designed to obtain a 50- to 150-bp amplicon using Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Primer sequences used for real-time PCR analysis were: ubiquitin forward, CACCAAGCCAAAGAAGATCA and ubiquitin reverse, TCAGCATTAGGGCACTCCTT; LC-SUT1 forward, TTCCATAGCTGCTGGTGTTC and LC-SUT1 reverse, TACCAGAAATGGGTCCACAA; StSUT2 forward, GGCATTCCTCTTGCTGTAACC and StSUT2 reverse, GCGATACAACCATCTGAGGGTAC; StSUT4 forward, GCTCTTGGGCTTGGACAAGGC and StSUT4 reverse, GGCTGGTGAATTGCCTCCACC; PhyB forward, TTTGCCTGATGCTGGGTATC and PhyB reverse, CTTTGCACCACCCCACTTA; GA20ox1 forward, CAAGATTGTGTTGGCGGACT and Ga20ox1 reverse, ACTGCTCTGTGCAGGCAACT; PhyA forward, TGCTCACTCTCGTGGAGGAT and PhyA reverse, CCCTGCAATGCTAATTCCAA; and StACO3 forward, GTGAGGCCATCATTTCTCCA and StACO3 reverse, CTTGAAAGCGGAGGTGACAG. Real-time PCR data were corrected by calculation of the PCR efficiency individually using LinReg PCR software. Statistical analysis was performed with Student's t test with 0.05 > P > 0.01 (+), 0.01 > P > 0.001 (++), and 0.001 > P (+++).
Isolation of the microsomal fraction from plant material as well as two-phase partitioning and western blotting were performed as previously described (Lemoine et al., 1996 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number AF237780.
The following materials are available in the online version of this article.
We gratefully acknowledge Hanjo Hellmann for helpful discussion and Sutton Mooney for English corrections. We thank Yvonne Pörs for setting the light conditions for shading experiments and Dieter Oellerich for setting the artificial shade experiment; Karin Schumacher for providing material; Aleksandra Hackel for excellent technical assistance; and Angelika Pötter for excellent care of greenhouse plants. Received November 2, 2007; accepted December 6, 2007; published December 14, 2007.
1 This work was supported by the Deutsche Forschungsgemeinschaft (SFB 429 to C.K., P.G., and J.M.) and Nachwuchsförderungsgesetz (stipend to I.C.).  The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Christina Kühn (christina.kuehn{at}biologie.hu-berlin.de).
[W] The online version of this article contains Web-only data. www.plantphysiol.org/cgi/doi/10.1104/pp.107.112334 * Corresponding author; e-mail christina.kuehn{at}biologie.hu-berlin.de.
Bernier G, Perilleux C (2005) A physiological overview of the genetics of flowering time control. Plant Biotechnol J 3: 3–16[CrossRef][Medline] Carrera E, Bou J, Garcia-Martinez JL, Prat S (2000) Changes in GA 20-oxidase gene expression strongly affect stem length, tuber induction and tuber yield of potato plants. Plant J 22: 247–256[CrossRef][Web of Science][Medline] Carrera E, Jackson SD, Prat S (1999) Feedback control and diurnal regulation of gibberellin 20-oxidase transcript levels in potato. Plant Physiol 119: 765–774 Cerdan PD, Chory J (2003) Regulation of flowering time by light quality. Nature 423: 881–885[CrossRef][Medline] Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van Montagu M, Leemans J (1985) Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants. Nucleic Acids Res 13: 4777–4788 Endler A, Meyer S, Schelbert S, Schneider T, Weschke W, Peters SW, Keller F, Baginsky S, Martinoia E, Schmidt UG (2006) Identification of a vacuolar sucrose transporter in barley and Arabidopsis mesophyll cells by a tonoplast proteomic approach. Plant Physiol 141: 196–207 Endo M, Nakamura S, Araki T, Mochizuki N, Nagatani A (2005) Phytochrome B in the mesophyll delays flowering by suppressing FLOWERING LOCUS T expression in Arabidopsis vascular bundles. Plant Cell 17: 1941–1952 Eriksson S, Bohlenius H, Moritz T, Nilsson O (2006) GA4 is the active gibberellin in the regulation of LEAFY transcription and Arabidopsis floral initiation. Plant Cell 18: 2172–2181 Friend D (1984) The interaction of photosynthesis and photoperiodism in induction. In D Vince-Prue, B Thomas, E Cockchull, eds, Light and Flowering Process. Academic Press, London Guo H, Yang H, Mockler TC, Lin C (1998) Regulation of flowering time by Arabidopsis photoreceptors. Science 279: 1360–1363 Hackel A, Schauer N, Carrari F, Fernie AR, Grimm B, Kühn C (2006) Sucrose transporter LeSUT1 and LeSUT2 inhibition affects tomato fruit development in different ways. Plant J 45: 180–192[CrossRef][Web of Science][Medline] Harmer SL, Kay SA (2005) Positive and negative factors confer phase-specific circadian regulation of transcription in Arabidopsis. Plant Cell 17: 1926–1940 Hirner A, Ladwig F, Stransky H, Okumoto S, Keinath M, Harms A, Frommer WB, Koch W (2006) Arabidopsis LHT1 is a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. Plant Cell 18: 1931–1946 Jackson SD, Heyer A, Dietze J, Prat S (1996) Phytochrome B mediated the photoperiodic control of tuber formation in potato. Plant J 9: 159–166[CrossRef][Web of Science] Jackson SD, James P, Prat S, Thomas B (1998) Phytochrome B affects the levels of a graft-transmissible signal involved in tuberization. Plant Physiol 117: 29–32 Jackson SD, Prat S (1996) Control of tuberization in potato by gibberellins and phytochrome B. Physiol Plant 98: 407–412[CrossRef] Kozuka T, Horiguchi G, Kim GT, Ohgishi M, Sakai T, Tsukaya H (2005) The different growth responses of the Arabidopsis thaliana leaf blade and the petiole during shade avoidance are regulated by photoreceptors and sugar. Plant Cell Physiol 46: 213–223 Kühn C (2003) Comparison of the sucrose transporter systems of different plant species. Plant Biol 5: 215–232[CrossRef] Kühn C, Franceschi VR, Schulz A, Lemoine R, Frommer WB (1997) Macromolecular trafficking indicated by localization and turnover of sucrose transporters in enucleate sieve elements. Science 275: 1298–1300 Lemoine R, Kühn C, Thiele N, Delrot S, Frommer WB (1996) Antisense inhibition of the sucrose transporter: effects on amount of carrier and sucrose transport activity. Plant Cell Environ 19: 1124–1131[CrossRef] Martinez-Garcia JF, Garcia-Martinez JL, Bou J, Prat S (2001) The interaction of gibberellins and photoperiod in the control of potato tuberization. J Plant Growth Regul 20: 377–386[Medline] Martinez-Garcia JF, Virgos-Soler A, Prat S (2002) Control of photoperiod-regulated tuberization in potato by the Arabidopsis flowering-time gene CONSTANS. Proc Natl Acad Sci USA 99: 15211–15216 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15: 473–497[CrossRef] Pierik R, Cuppens ML, Voesenek LA, Visser EJ (2004a) Interactions between ethylene and gibberellins in phytochrome-mediated shade avoidance responses in tobacco. Plant Physiol 136: 2928–2936 Pierik R, Whitelam GC, Voesenek LA, de Kroon H, Visser EJ (2004b) Canopy studies on ethylene-insensitive tobacco identify ethylene as a novel element in blue light and plant-plant signalling. Plant J 38: 310–319[CrossRef][Web of Science][Medline] Reed JW, Foster KR, Morgan PW, Chory J (1996) Phytochrome B affects responsiveness to gibberellins in Arabidopsis. Plant Physiol 112: 337–342[Abstract] Reinders A, Schulze W, Kühn C, Barker L, Schulz A, Ward JM, Frommer WB (2002) Protein-protein interactions between sucrose transporters of different affinities colocalized in the same enucleate sieve element. Plant Cell 14: 1567–1577 Riesmeier JW, Frommer WB (1994) Einfluß der Überexpression von Saccharosetransportern auf das Blühverhalten von Pflanzen. German Patent No. P 44 39 748.8 Riesmeier JW, Hirner B, Frommer WB (1993) Potato sucrose transporter expression in minor veins indicates a role in phloem loading. Plant Cell 5: 1591–1598[Abstract] Riesmeier JW, Willmitzer L, Frommer WB (1992) Isolation and characterization of a sucrose carrier cDNA from spinach by functional expression in yeast. EMBO J 11: 4705–4713[Web of Science][Medline] Rocha-Sosa M, Sonnewald U, Frommer W, Stratmann M, Schell J, Willmitzer L (1989) Both developmental and metabolic signals activate the promoter of a class I patatin gene. EMBO J 8: 23–29[Web of Science][Medline] Rodriguez-Falcon M, Bou J, Prat S (2006) Seasonal control of tuberization in potato: conserved elements with the flowering response. Annu Rev Plant Biol 57: 151–180[CrossRef][Medline] Rolland N, Ferro M, Seigneurin-Berny D, Garin J, Douce R, Joyard J (2003) Proteomics of chloroplast envelope membranes. Photosynth Res 78: 205–230[CrossRef][Web of Science][Medline] Schittenhelm S, Menge-Hartmann U, Oldenburg E (2004) Photosynthesis, carbohydrate metabolism, and yield of phytochrome-B-overexpressing potatoes under different light regimes. Crop Sci 44: 131–143 Searle I, Coupland G (2004) Induction of flowering by seasonal changes in photoperiod. EMBO J 23: 1217–1222[CrossRef][Web of Science][Medline] Smeekens S (2000) Sugar-induced signal transduction in plants. Annu Rev Plant Physiol Plant Mol Biol 51: 49–81[CrossRef][Web of Science] Thomas B (2006) Light signals and flowering. J Exp Bot 57: 3387–3393 Töpfer R, Matzeit V, Gronenborn B, Schell J, Steinbiss HH (1987) A set of plant expression vectors for transcriptional and translational fusions. Nucleic Acids Res 15: 5890 Valverde F, Mouradov A, Soppe W, Ravenscroft D, Samach A, Coupland G (2004) Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 303: 1003–1006 Vandenbussche F, Pierik R, Millenaar FF, Voesenek LA, Van Der Straeten D (2005) Reaching out of the shade. Curr Opin Plant Biol 8: 462–468[CrossRef][Web of Science][Medline] Weise A, Barker L, Kühn C, Lalonde S, Buschmann H, Frommer WB, Ward JM (2000) A new subfamily of sucrose transporters, SUT4, with low affinity/high capacity localized in enucleate sieve elements of plants. Plant Cell 12: 1345–1355 Weschke W, Panitz R, Sauer N, Wang Q, Neubohn B, Weber H, Wobus U (2000) Sucrose transport into barley seeds: molecular characterization of two transporters and implications for seed development and starch accumulation. Plant J 21: 455–467[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
