|
|
||||||||
|
First published online January 9, 2008; 10.1104/pp.107.109371 Plant Physiology 146:1128-1141 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Functional Characterization of PaLAX1, a Putative Auxin Permease, in Heterologous Plant Systems1,[W],[OA] ková Kocábek es ímalová
Institute of Experimental Botany (K.H., L.P., M.L., J.K., E.Z.) and Institute of Molecular Genetics (J.P.), Academy of Sciences of the Czech Republic, CZ–142 20 Prague 4, Czech Republic; HRI/University of Warwick, Wellesbourne, Warwick CV35 9EF, United Kingdom (P.H., S.M., R.N.); Biological Centre of the Academy of Sciences of the Czech Republic, v.v.i., Institute of Plant Molecular Biology, CZ–370 05
We have isolated the cDNA of the gene PaLAX1 from a wild cherry tree (Prunus avium). The gene and its product are highly similar in sequences to both the cDNAs and the corresponding protein products of AUX/LAX-type genes, coding for putative auxin influx carriers. We have prepared and characterized transformed Nicotiana tabacum and Arabidopsis thaliana plants carrying the gene PaLAX1. We have proved that constitutive overexpression of PaLAX1 is accompanied by changes in the content and distribution of free indole-3-acetic acid, the major endogenous auxin. The increase in free indole-3-acetic acid content in transgenic plants resulted in various phenotype changes, typical for the auxin-overproducing plants. The uptake of synthetic auxin, 2,4-dichlorophenoxyacetic acid, was 3 times higher in transgenic lines compared to the wild-type lines and the treatment with the auxin uptake inhibitor 1-naphthoxyacetic acid reverted the changes caused by the expression of PaLAX1. Moreover, the agravitropic response could be restored by expression of PaLAX1 in the mutant aux1 plants, which are deficient in auxin influx carrier activity. Based on our data, we have concluded that the product of the gene PaLAX1 promotes the uptake of auxin into cells, and, as a putative auxin influx carrier, it affects the content and distribution of free endogenous auxin in transgenic plants.
Auxins, in coaction with cytokinins, play a crucial role in the regulation of plant growth and development. They are required for cell division, cell enlargement, and differentiation, and they function as internal endogenous signals between cells, tissues, and organs. Together with auxin metabolism, transport of auxins within a plant is involved in the regulation of intracellular auxin levels and in formation of auxin gradients. Typically, the cell-to-cell auxin transport is polar. Auxin influx and efflux carriers appear to be the central effectors of the polar auxin transport machinery; their activity and subcellular localization direct the auxin flow and underlie formation of auxin gradients (for review, see Morris et al., 2004
The auxin influx into cells in Arabidopsis (Arabidopsis thaliana) seems to be driven by proteins from the AUX/LAX family of plasma membrane permeases, products of AUX/LAX genes (for review, see Parry et al., 2001b
When considering the mechanism of auxin flow through cells, so far the only mutant extensively characterized and shown to be closely related to the auxin influx was the root agravitropic and 2,4-D-resistant mutant aux1 of Arabidopsis, which is lacking the functional gene AUX1 (Marchant et al., 1999
Other data confirming the action of AUX1 have been reported on the level of protein: Its localization was explored by immunostaining, using a known epitope, the coding sequence of which was fused to both terminal regions of the AUX1 gene. In Arabidopsis, the epitope of the fusion protein was localized in the root tips, in a subset of protophloem, columella, epidermal cells, and lateral root cap (Swarup et al., 2001
The AUX1 physiological function was studied in context with root gravitropic curvature (Swarup et al., 2001
It is known that the AUX/LAX sequences are highly similar among plant species (for review, see Parry et al., 2001b
In this article, we describe the cloning of the PaLAX1 gene from the cDNA library of wild cherry tree (Prunus avium), a commercially and ecologically important perennial woody plant, clonal propagation of which is complicated by poor rooting of the cuttings (Durkovic, 2006
Isolation of PaLAX1 cDNA, Phylogenetic Analysis of the Predicted Protein, the Endogene, and Transgene Expression
We isolated cDNA of an AUX/LAX-like putative auxin influx carrier protein from wild cherry tree, PaLAX1. Several independent clones containing the complete amino acid sequences of AUX/LAX-like proteins were obtained. The coding sequences of the clones were identical, giving a protein of 483 amino acid residues. The majority of clones contained a cDNA of 2,004 bp, although one clone contained an additional 142 bp at the 5' end, upstream of the translation start codon, and another clone contained two small 5' deletions of 9 and 44 bp. It was not clear whether these represented cloning artifacts or the evidence of regulation of mRNA translation as suggested by de Billy et al. (2001)
A probe from the 5' untranslated region of PaLAX1, hybridizing solely with the unique wild cherry tree sequence when used for Southern blot, was used for northern-blot analysis against total RNA extracted from different wild cherry tree tissues. PaLAX1 was expressed in roots, root tips, shoot apices, stems, and leaves (data not shown). To confirm similar functions of products of genes PaLAX1 and AUX1, we constructed plant transformation vectors that were further used for tobacco and Arabidopsis transformation. We designed a set of primers that specifically amplified only the transgene and not a putative endogene of AUX/LAX family; this set of primers gave a clear single product corresponding to PaLAX1 transgene/mRNA in both Arabidopsis and tobacco, whereas no amplification product was detected in either PCR or reverse transcription (RT)-PCR reactions performed on wild-type control plants. In all transgenic lines obtained, we confirmed the stable presence of the transgene as well as its expression on the mRNA level.
We obtained six independent transgenic tobacco lines that carried the PaLAX1 cDNA under transcriptional control of the rolC promoter (Schmülling et al., 1989 Compared to the wild-type control plants, the transgenic plants were generally smaller, and in both transgenic lines the root gravitropism and/or their ability to penetrate growth medium was significantly affected. Internodes of both transgenic lines were reduced in lengths and the leaves formed rosettes. Mature leaves were chlorotic and showed accelerated senescence. Also, the progression of leaf senescence was different in the leaves of transgenic plants, where the intercostal regions were chlorotic and the regions along the main veins retained chlorophyll. In the control wild-type plants, the pigmentation within the leaf area was not affected (Fig. 2A ).
The most noticeable differences between the transgenic and wild-type plants were the petiole length, the stem length, and the leaf surface area. Petioles and stems of transgenic plants were shorter than those of control wild-type plants. Even though the length and width of the leaf (leaf surface area) were reduced in transgenic plants, the calculated factors of circularity and elongation (see "Materials and Methods") were not affected, which means that the leaf shape remained almost unchanged (Table I ).
Stem internodal segments of transgenic lines NtPaLAX1-5 and NtPaLAX1-8 regenerated rapidly on standard Murashige and Skoog medium compared with controls (Fig. 2B). Moreover, after 3 weeks of cultivation on regeneration medium (containing 2,4-D, the auxin that is a good substrate for an active auxin uptake; Delbarre et al., 1996
Regeneration of wild-type explants (Fig. 2B) was completely inhibited by 1-NOA, which also remarkably suppressed regeneration of transgenic explants. We also tested the effect of a higher concentration of 1-NOA (10 µM) and, in this case, the regeneration of both wild-type and transgenic explants was inhibited completely (data not shown). Addition of 1-NAA (the auxin entering the plant cell without the need for auxin transporter; Delbarre et al., 1996
After transformation, 17 independent homozygous transgenic lines carrying the PaLAX1 cDNA under the strong constitutive cauliflower mosaic virus (CaMV) 35S promoter were obtained, 12 of them exhibiting the auxin phenotype (as previously described by Romano et al. [1995]
To prove the functional similarity of AUX1 and PaLAX1, we transformed aux1 mutant plants with a vector carrying PaLAX1 under control of the strong CaMV 35S promoter. The expression of the PaLAX1 transgene was confirmed by RT-PCR. In the T1 population of homozygotes and heterozygotes, the root gravitropism was completely restored only in some plants (Fig. 4D), which are statistically likely to represent homozygotes. In the stable homozygous lines, the gravitropic phenotype was completely restored (Fig. 4E). When the transgenic plants were placed on medium with addition of 1-NOA, complementation of the aux1 phenotype was not achieved (data not shown).
In tobacco plants, the content of free IAA was measured in mature leaves (leaves 3–6, leaf 6 being the oldest) of NtPaLAX1-5 and NtPaLAX1-8 and wild-type control plants regenerated from apical cuts (3 weeks after the transfer of the apical cuts to fresh medium). The amount of IAA in NtPaLAX1-5 and NtPaLAX1-8 lines was almost 4 times higher than that in control leaves of wild-type plants (Fig. 5A ).
In 8-d-old Arabidopsis plants, the auxin content was measured separately in both leaves and whole roots. In the leaves of transgenic plants, the content of IAA was generally higher in comparison with wild-type plants and, moreover, the distribution pattern of IAA between leaves and roots was pronouncedly different from the control (Fig. 5B). The distribution of auxin was also monitored in 8-d-old Arabidopsis plants by reporter gene GUS placed under control of the auxin-inducible promoter IAA2. Generally, the higher auxin levels were noted in leaf bud primordia, primary leaf veins, and future leaf-tip hydathodes in both wild-type and transgenic plants. The major difference in auxin distribution was noted at the root tips of transgenics, which were stained in a manner different from wild-type control root tips. The reporter gene expression noted in stele, columella, and lateral root cap of wild-type plants extended to all cell layers of the root tips of transgenic plants (Fig. 6 ).
Net 2,4-D Uptake in Midribs of Tobacco Leaves and in Inflorescence Stems of Arabidopsis
The synthetic auxin 2,4-D was previously reported to be a good substrate for the active auxin uptake in plant cells (Delbarre et al., 1996 The very short internodes of the transgenic tobacco plants did not enable us to measure the net auxin uptake in the stem tissue. The accumulation of radiolabeled 2,4-D was, therefore, measured in segments of tobacco leaf midribs. The accumulation of radiolabeled 2,4-D was 2 to 3 times higher in transgenic lines than in a control wild-type line (Fig. 7A ). We have also proved the effect of the auxin influx inhibitor, 10 µM 1-NOA, on the accumulation of 2,4-D. In both wild-type and transgenic lines, the accumulation was reduced after 1-NOA pretreatment to approximately one-half compared to the controls without 1-NOA pretreatment (Fig. 7B). The accumulation of permeable auxin 1-NAA remained unchanged in transgenic lines compared to the wild-type line (Fig. 7C).
When segments of Arabidopsis inflorescence stems were used for the net 2,4-D uptake assay, transformed lines accumulated, similarly to tobacco plants, approximately 2.5 times more radiolabeled 2,4-D than the control line after 30 min of the treatment (Fig. 7D). The effect of 1-NOA application was also similar to that in tobacco and both the wild-type line and the transformants accumulated 1.5 to 2 times less 2,4-D when pretreated with 10 µM 1-NOA in comparison with nontreated controls (Fig. 7E). 1-NAA accumulation was not different in transgenic lines when compared to wild type (Fig. 7F).
The Evolution of AUX/LAX Protein Family Based on Analysis of the Predicted Protein Sequences and Placement of PaLAX1 Permease into Subfamily AUX
Based on expected nucleotide sequence similarity to the previously isolated and cloned gene AUX1 from Arabidopsis (Maher and Martindale, 1980 Representatives of both protein subfamilies are present in Arabidopsis, Medicago truncatula, and hybrid aspen. In other plants, at present we were able to identify members of only one of the respective subfamilies. However, complete genome sequences are not available for those plant species and thus we cannot state conclusively whether members of the other subfamily are present in the respective genomes or not.
Subfamily-specific amino acid differences occur only in the intracellular hydrophilic loops, as described previously in a structure model (Swarup et al., 2004
We have observed marked changes in phenotypes of plants carrying the PaLAX1 gene under the control of strong constitutive promoters. Whereas the viral promoter CaMV 35S promotes strong gene expression in all cell types, bacterial promoter rolC has been reported to direct the expression preferentially to vascular tissues (Schmülling et al., 1989 Not surprisingly, higher levels of auxin were measured in both tobacco and Arabidopsis plants expressing PaLAX1. Interestingly, the distribution of free IAA between leaves and whole roots is remarkably changed in transgenic Arabidopsis plants, which contain a much higher proportion of free IAA in leaves than in roots (Fig. 5, A and B).
Ljung et al. (2001)
Changes in the overall free auxin content and the free auxin distribution are difficult to explain without further data. The increased content of free auxin in some organs of transgenics can be attributed to metabolic changes and/or just to the auxin distribution being different from control plants. These metabolic changes, generally, may include (1) higher rate of IAA biosynthesis and/or release from conjugates; and (2) lower rate of IAA degradation and/or conjugation. The total pool of IAA in Arabidopsis seedlings consists of as little as 1% of free IAA and the 99% of its conjugated forms (Tam et al., 2000 Below, we discuss the higher auxin uptake by cells of transgenic PaLAX plants, but it should be noted here that the free IAA measurements cannot confirm the direct and exclusive relation between changes in auxin uptake and its endogenous content. The higher auxin content, presumably responsible for the changes of the phenotypes, might have arisen in response to the overall changes in hormonal homeostasis related also to a stress reaction resulting from the overexpression of the PaLAX1 transgene.
The increased ability of transgenic tobacco stem segments to regenerate into whole plants (Fig. 2) corresponded to expected high levels/activity of auxin transporters. The intensified development might well result from the abundance of the presumptive influx carrier PaLAX1 in outer layers of stems, which would allow more pronounced auxin gradient formation. Cooperation of auxin influx and efflux carriers in leaf primordia initiation and formation has been reported (Stieger et al., 2002
The differential sensitivity of regeneration of control and transgenic plants to auxin influx inhibitor also points to the changes in auxin uptake. The transgenic and wild-type control stem segments placed on auxin uptake inhibitor 1-NOA did not regenerate into shoots. Placed on medium containing both 1-NOA and 1-NAA, the auxin entering the cell readily even in the absence of an auxin transporter in both the control and transgenic samples showed an improved regeneration capacity, even if it was not as prominent as that on standard regeneration medium. Remarkable difference was achieved when the stem segments were placed on medium with the uptake inhibitor and 2,4-D, the auxin preferentially delivered into cells by a carrier (Delbarre et al., 1996
Reporter assays in PaLAX1 transgenic plants revealed higher levels of auxin signal in all cell layers of the root tip. This is in contrast to the wild-type roots, where the auxin signal was limited to the vasculature, columella, and root cap (in concert with data published previously by Casimiro et al. [2001] Our results revealed that, under some circumstances, PaLAX1 expression (see below) could also complement the agravitropic phenotype of the Arabidopsis loss-of-function aux1 mutant. Moreover, this phenotypical complementation of AUX1 function could be reverted back to agravitropic phenotype by the auxin uptake inhibitor 1-NOA. Interestingly, only transgenic lines homozygous in PaLAX1 showed fully restored gravitropism (in all lines). Whether (and why) the gravitropism restoration relates strictly to homologous phenotype and what could be the possible causes of this phenomenon has yet to be explored (e.g. stronger expression from more copies of the gene is needed for the phenotype restoration, some other phenomena related to tissue-specific expression, or development-specific expression are involved, etc.).
In addition to the above-mentioned phenotypical changes, which point to the role of PaLAX1 as an auxin influx carrier, we have proved that strong expression of PaLAX1 is accompanied by an increase in the net auxin uptake in both tobacco and Arabidopsis plants. For comparisons of auxin uptake in transgenic and wild-type plants, radiolabeled 2,4-D was used. This synthetic auxin was reported to be a good substrate for auxin influx carriers, but not for efflux carriers and, probably due to the polarity of its molecule, it is not taken up into cells, at significant rate, by passive diffusion (Delbarre et al., 1996
The transformed tobacco plants had very short stems; thus, in this case, we could not use tobacco stem segments for a standard auxin uptake assay. Instead, we designed a method using tobacco leaf midribs for comparison of capacity for the net auxin accumulation between transformed and control tobacco plants. In Arabidopsis, the inflorescence stems were used for the standard labeled 2,4-D uptake assay (Parry et al., 2001a In all experiments performed, the transgenic explants accumulated about 3 times more radiolabeled 2,4-D compared to the control wild-type explants. The accumulation rate of transformed segments, when pretreated with the auxin uptake inhibitor, 1-NOA, corresponded to that of wild type. As expected, the untreated wild-type control showed a higher rate of auxin accumulation compared to wild-type samples treated with 1-NOA. The comparative accumulation of 1-NAA, the membrane-permeable auxin, remained unaffected (Fig. 7). Thus, the significantly higher ability of transgenic plants to accumulate 2,4-D, the auxin transported preferentially via active uptake, strongly supported the direct involvement of PaLAX1 in the uptake of auxin molecules into cells, probably as the auxin influx carrier itself.
Even though it is very difficult to prove the molecular function of PaLAX1 by means of the biochemical methods available, our 2,4-D accumulation results, showing increased auxin uptake in PaLAX1 transgenic plants (which can be specifically inhibited by the specific auxin uptake inhibitor), together with the phenotypical characterization of transgenic plants and the protein sequence similarity of PaLAX1 to the single-component amino acid permeases (Young et al., 1999
Chemicals Unless stated otherwise, all the commonly used chemicals were supplied by Sigma-Aldrich and the kits for gene cloning and detection of expression were obtained from Qiagen. [3H]IAA and [3H]2,4-D (both of specific radioactivity 20 Ci mmol–1) were produced by American Radiolabeled Chemicals, Inc.
Identification of AtAUX1 homologs was carried out by a BLAST search at the National Center for Biotechnology Information (Altschul et al., 1990
For the isolation of AUX1-related clones from wild cherry tree (Prunus avium), the cDNA library was prepared from shoot tips collected from mature trees in the spring. Tips consisted of vegetative shoot apices and surrounding leaf primordial and expanding leaves. The library was constructed in the lambda Zap II vector (Stratagene). An aliquot of the library was first screened by PCR using primers for conserved regions of the Arabidopsis (Arabidopsis thaliana) AUX1 gene (the gene was kindly provided by Prof. M. Bennett, University of Nottingham, UK). The sequence of AUX1-like amplification products was used to design wild cherry tree-specific primers. A combination of a 5' SK vector sequence primer (CGCTCTAGAACTAGTGGATC) and a 3' PauxR3 wild cherry tree-specific primer (GTTGAGAAGCTCATCACCAAA) was found to amplify approximately 1 kb of the 5' region of AUX1-like cDNA. This primer pair was used to screen row and column pools of aliquots of the cDNA library arrayed into 96-well plates. Positive aliquots were diluted and rearrayed and further rounds of screening were carried out. Finally, aliquots were plated in agar at low density, plaque purified, and then positive single plaques were converted to plasmid clones in the vector pBluescript SK– using the manufacturer's protocol. Clones were classified by restriction digestion and those containing the longest inserts were sequenced on both strands with an ABI 373A automated sequencer (Applied Biosystems). Sequence data were analyzed using Genetics Computer Group software. Nucleotide and protein alignments were made using ClustalW software (Thompson et al., 1994
A full-length PaLAX1 cDNA clone was used for the construction of transformation vectors pROKPaLAX1 and pCPaLAX1 (Fig. 1C). Both these vectors are derivatives of pBIN19 (Bevan, 1984
Detection of transgene and its expression was performed by PCR and RT-PCR, respectively (CHAXf, 5'-TACACAGCCTGGTACTTG-3'; CHAXr, 5'-ATCACAACTGGAAGCCTA-3' PaLAX1-specific primers; Ta = 52°C). Amplification from specific primers did not result in visible product when performed on control nontransgenic material. The DNA techniques were performed according to the usual laboratory protocols described in Ausubel et al. (1995)
Tobacco Maryland Mammoth plants were used for the leaf disc transformation via Agrobacterium tumefaciens as described by Clark (1997)
For regeneration experiments, the stems of 6-week-old transformed and control plants (i.e. 6 weeks after the transfer of the apical cuts to the fresh medium) were cut into 5-mm internodal segments. The segments were placed on regeneration Murashige and Skoog medium (six segments per Magenta box): 4.3 g L–1 Murashige and Skoog basal salt mixture, 104 mg L–1 Murashige and Skoog vitamins, 5% Glc, 100 mg L–1 inositol, 0.8% agar-agar, 0.2 mg L–1 IAA, 0.2 mg L–1 kinetin, pH 5.6, supplemented with 100 mg L–1 kanamycin (kanamycin sulfate; Sigma), and cultivated for 3 weeks. In inhibition experiments, 5 µM 1-NOA, 5 µM 1-NOA together with 0.1 µM 2,4-D, or 5 µM 1-NOA together with 1 µM 1-NAA were added to regeneration medium, respectively. For the leaf shape description, the circularity (4
Arabidopsis L. Heynh., ecotype Columbia, plants were grown in a greenhouse for 4 to 5 weeks. All cultivations were performed at 20°C/23°C, 16-h-light/8-h-dark photoperiod cycles. The terminal stem was cut off to induce formation of secondary stems. Well-developed plants with plenty of buds were transformed via Agrobacterium tumefaciens by the floral-dip method (Clough and Bent, 1998 Collected T1 seeds were surface sterilized using 70% ethanol for 2 min. Selection of transformed plants was performed on modified solid Murashige and Skoog medium (Murashige and Skoog half dose, 1% Suc) supplemented with 100 µg mL–1 kanamycin (kanamycin sulfate; Sigma) and 1 mg mL–1 cefotaxim (Claforan). Selected plants were transferred to nonsterile conditions. The segregation ratio of kanamycin-resistant and kanamycin-sensitive plants was scored on 3-week-old T2 and T3 seedlings. Lines homozygous for a T-DNA insert were grown in soil and further cultivated in a controlled climate cultivation chamber for 5 to 6 weeks to obtain well-grown stems for further analyses.
For genetic crossing, auxin-inducible reporter IAA2::GUS lines (Swarup et al., 2001
For studies of net auxin uptake (auxin accumulation), 3-mm segments were cut from isolated tobacco leaf midribs (taken from 8-week-old plants) or from Arabidopsis inflorescence stems (taken from 5-week-old plants). For measurements, segments of approximately equal weight, length, and diameter were used for both the transgenic and the wild-type control plants. Because the stems of transgenic tobacco were too short to provide suitable material for the measurements of net auxin uptake (auxin accumulation), we have developed an adequate method of measuring the auxin uptake in leaf midribs. This method has proved to be statistically plausible for the detection of differences in the auxin uptake between the transgenic plants and the wild-type controls. For accumulation assays in Arabidopsis, standard material (inflorescence stem segments) was used (Parry et al., 2001a The segments were placed into the ice-cold uptake buffer (1.5% Suc, 23 mM MES, pH 5.5, KOH) for 15 min and washed two times in the fresh uptake buffer for 15 min. Segments were surface dried on filter paper. Dry segments were weighed.
One hundred milligrams of segments were dropped into 5 mL of 2 nM [3H]2,4-D or 2 nM [3H]1-NAA for 0, 5, 10, and 15 min, respectively, in three repeats per each sample. Accumulation of the labeled 2,4-D was terminated by rapid filtration under reduced pressure on 22-mm-diameter cellulose filters. The label was extracted in 1 mL of 96% ethanol for 30 min, and afterward 5 mL of scintillation solution (EcoLite) were added and the sample was incubated overnight (Morris and Robinson, 1998
Free IAA was extracted by methanol:formic acid:water (15:1:4 [v/v/v]) from mature leaves 3 to 6 (leaf 6 being the oldest one; tobacco) or the whole rosettes (Arabidopsis) homogenized in liquid nitrogen. The extract was purified using a dual-mode solid-phase extraction method as described by Dobrev and Kamínek (2002)
Each experiment was done three times, if not stated otherwise. Free IAA content was measured in three samples per plant in three plants of each, control or transgenic, line. In auxin accumulation assay, the number of repeats in one experiment was three using either stem segments or main veins per one plant, and three plants of each, control and transgenic, line were used for one experiment. Measured data were analyzed simultaneously by calculating arithmetical means of repeats, and their SDs and variations. Image analysis software LUCIA G, version 4.71 (Laboratory Imaging), was used for phenotype data evaluation. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number AJ862887.
The following materials are available in the online version of this article.
For technical help, assistance, and useful comments, we thank, in alphabetical order, Petre Dobrev, Neil Grant, Jana Látalová, Ji í Malbeck, Jana Opatrná, and Zuzana Vondráková, and Prof. Malcolm Bennett for kindly providing the AUX1-related DNA material and seeds of the IAA2::GUS line. Received September 18, 2007; accepted December 21, 2007; published January 9, 2008.
1 This work was supported by the Grant Agency of the Czech Republic (project nos. 206/02/P106 and 206/02/0967), the Grant Agency of the Academy of Sciences of the Czech Republic (project nos. B6038203, A6038303, and KJB600380702), the Ministry of Education, Youth and Sports (project nos. LN06034 and 1M0520), institutional supports (AV0Z50380511 and AV0Z50510513), and the Biotechnology and Biological Sciences Research Council.
2 These authors contributed equally to the article.
3 Present address: Nottingham Arabidopsis Stock Centre, School of Biosciences, University of Nottingham, Sutton Bonington Campus, Loughborough, Leicestershire LE12 5RD, UK. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Lucie Perry (perry{at}ueb.cas.cz).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.109371 * Corresponding author; e-mail perry{at}ueb.cas.cz.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410[CrossRef][Web of Science][Medline] Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1995) Current Protocols in Molecular Biology. John Wiley and Sons, New York Baulcombe DC, Saunders GR, Bevan MW, Mayo MA, Harrison BD (1986) Expression of biologically-active viral satellite RNA from the nuclear genome of transformed plants. Nature 321: 446–449[CrossRef] Benjamins R, Malenica N, Luschnig C (2005) Regulating the regulator: the control of auxin transport. Bioessays 27: 1246–1255[CrossRef][Web of Science][Medline] Benková E, Michniewicz M, Sauer M, Teichmann T, Seifertová D, Jürgens G, Friml J (2003) Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell 115: 591–602[CrossRef][Web of Science][Medline] Bennett MJ, Marchant A, Green HG, May ST, Ward SP, Millner PA, Walker AR, Schultz B, Feldmann KA (1996) Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273: 948–950[Abstract] Bevan MW (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res 12: 8711–8721 Blakeslee J, Peer WA, Murphy AS (2005) Auxin transport. Curr Opin Plant Biol 8: 494–500[CrossRef][Web of Science][Medline] Buchanan BB, Gruissem W, Jones RL (2000) Biochemistry and Molecular Biology of Plants. American Society of Plant Physiologists, Rockville, MD Casimiro I, Marchant A, Bhalerao RP, Beeckman T, Dhooge S, Swarup R, Graham N, Inze D, Sandberg G, Casero PJ, et al (2001) Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell 13: 843–852 Chen L, Ortiz-Lopez A, Jung A, Bush DR (2001) ANT1, an aromatic and neutral amino acid transporter in Arabidopsis. Plant Physiol 125: 1813–1820 Clark MS (1997) Plant Molecular Biology. A Laboratory Manual. Springer-Verlag, Berlin Clough SJ, Bent AF (1998) Floral dip: simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline] de Billy F, Grosjean C, May S, Bennett M, Cullimore JV (2001) Expression studies on AUX1-like genes in Medicago truncatula suggest that auxin is required at two steps in early nodule development. Mol Plant Microbe Interact 14: 267–277[Web of Science][Medline] Delbarre A, Muller P, Imhoff V, Guern J (1996) Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta 198: 532–541[Web of Science] Dharmasiri S, Swarup R, Mockaitis K, Dharmasiri N, Singh SK, Kowalchyk M, Marchant A, Mills S, Sandberg G, Bennett MJ, et al (2006) AXR4 is required for localization of the auxin influx facilitator AUX1. Science 312: 1218–1220 Dobrev P, Havlí Dobrev P, Kamínek M (2002) Fast and efficient separation of cytokinins from auxin and abscisic acid and their purification using mixed-mode solid-phase extraction. J Chromatogr A 950: 21–29[CrossRef][Web of Science][Medline] Durkovic J (2006) Rapid micropropagation of mature wild cherry. Biol Plant 50: 733–736[CrossRef] Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792–1797 Felsenstein J (1989) PHYLIP-Phylogeny Inference Package (Version 3.2). Cladistics 5: 164–166 Fischer U, Ikeda Y, Ljung K, Serralbo O, Singh M, Heidstra R, Palme K, Scheres B, Grebe M (2006) Vectorial information for Arabidopsis planar polarity is mediated by combined AUX1, EIN2, and GNOM activity. Curr Biol 16: 2143–2149[CrossRef][Medline] Geisler M, Murphy AS (2006) The ABC of auxin transport: the role of p-glycoproteins in plant development. FEBS Lett 580: 1094–1102[CrossRef][Web of Science][Medline] Gray WM, Ostin A, Sandberg G, Romano CP, Estelle M (1998) High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis. Proc Natl Acad Sci USA 95: 7197–7202 Grebe M, Friml J, Swarup R, Ljung K, Sandberg G, Terlou M, Palme K, Bennett MJ, Scheres B (2002) Cell polarity signaling in Arabidopsis involves a BFA-sensitive auxin influx pathway. Curr Biol 12: 329–334[CrossRef][Web of Science][Medline] Heisler MG, Jönsson H (2006) Modeling auxin transport and plant development. J Plant Growth Regul 25: 302–312 Hochholdinger F, Wulff D, Reuter K, Park WJ, Feix G (2000) Tissue-specific expression of AUX1 in maize roots. J Plant Physiol 157: 315–319[Web of Science] Hoshino T, Hitotsubashi R, Miyamoto K, Tanimoto E, Ueda J (2005) Isolation of PsPIN2 and PsAUX1 from etiolated pea epicotyls and their expression on a three-dimensional clinostat. Adv Space Res 36: 1284–1291[CrossRef][Web of Science] Imhoff V, Muller P, Guern J, Delbarre A (2000) Inhibitors of the carrier-mediated influx of auxin in suspension-cultured tobacco cells. Planta 210: 580–588[CrossRef][Web of Science][Medline] Jones SE, Demeo JS, Davies NW, Noonan SE, Ross JJ (2005) Stems of the Arabidopsis pin1-1 mutant are not deficient in free indole-3-acetic acid. Planta 222: 530–534[CrossRef][Web of Science][Medline] Kamada M, Yamasaki S, Fujii N, Higashitani A, Takahashi H (2003) Gravity-induced modification of auxin transport and distribution for peg formation in cucumber seedlings: possible roles for CS-AUX1 and CS-PIN1. Planta 218: 15–26[CrossRef][Web of Science][Medline] Kerr ID, Bennett MJ (2007) New insight into the biochemical mechanisms regulating auxin transport in plants. Biochem J 401: 613–622[CrossRef][Web of Science][Medline] Kleine-Vehn J, Dhonukshe P, Swarup R, Bennett M, Friml J (2006) Subcellular trafficking of the Arabidopsis auxin influx carrier AUX1 uses a novel pathway distinct from PIN1. Plant Cell 18: 3171–3181 Kramer EM, Bennett MJ (2006) Auxin transport: a field in flux. Trends Plant Sci 11: 382–386[CrossRef][Web of Science][Medline] Kramer ER (2004) PIN and AUX/LAX proteins: their role in auxin accumulation. Trends Plant Sci 9: 579–582 Krizkova L, Hrouda M (1998) Direct repeats of T-DNA integrated in tobacco chromosomes: characterization of junction regions. Plant J 16: 673–680[CrossRef][Web of Science][Medline] Ljung K, Bhalerao RP, Sandberg G (2001) Sites and homeostatic control of auxin biosynthesis in Arabidopsis during vegetative growth. Plant J 28: 465–474[CrossRef][Web of Science][Medline] Maher EP, Martindale SJ (1980) Mutants of Arabidopsis thaliana with altered responses to auxins and gravity. Biochem Genet 18: 1041–1053[CrossRef][Web of Science][Medline] Marchant A, Bhalerao R, Casimiro I, Eklöf J, Casero PJ, Bennett MJ, Sandberg G (2002) AUX1 promotes lateral root formation by facilitating indole-3-acetic acid distribution between sink and source tissues in the Arabidopsis seedling. Plant Cell 14: 589–597 Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C, Bennett MJ (1999) AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. EMBO J 18: 2066–2074[CrossRef][Web of Science][Medline] Morris DA, Robinson JS (1998) Targeting of auxin carriers to the plasma membrane: differential effects of brefeldin A on the traffic of auxin uptake and efflux carriers. Planta 205: 606–612[CrossRef][Web of Science] Morris DA, Friml J, Za Nordström A, Tarkowski P, Tarkowska D, Norbaek R, Astot C, Dolezal K, Sandberg G (2004) Auxin regulation of cytokinin biosynthesis in Arabidopsis thaliana: a factor of potential importance for auxin-cytokinin-regulated development. Proc Natl Acad Sci USA 101: 8039–8044 Paponov IA, Teale WD, Trebar M, Blilou K, Palme K (2005) The PIN auxin efflux facilitators: evolutionary and functional perspectives. Trends Plant Sci 10: 170–177[CrossRef][Web of Science][Medline] Parry G, Delbarre A, Marchant A, Swarup R, Napier R, Perrot-Rechenmann C, Bennett MJ (2001a) Novel auxin transport inhibitors phenocopy the auxin influx carrier mutation aux1. Plant J 25: 399–406[CrossRef][Web of Science][Medline] Parry G, Marchant A, May S, Swarup R, Swarup K, James N, Graham N, Allen T, Martucci T, Yemm A, et al (2001b) Quick on the uptake: characterization of a family of plant auxin influx carriers. J Plant Growth Regul 20: 217–225 Péret B, Swarup R, Jansen L, Devos G, Auguy F, Collin M, Santi C, Hocher V, Franche C, Bogusz D, et al (2007) Auxin influx activity is associated with Frankia infection during actinorhizal nodule formation in Casuarina glauca. Plant Physiol 144: 1852–1862 Reinhardt D, Pescue ER, Stieger P, Mandel T, Baltensperger K, Bennett M, Traas J, Friml J, Kuhlemeier C (2003) Regulation of phyllotaxis by polar auxin transport. Nature 426: 255–260[CrossRef][Medline] Romano CP, Robson PR, Smith H, Estelle M, Klee H (1995) Transgene-mediated auxin overproduction in Arabidopsis—hypocotyl elongation phenotype and interactions with the hy6-1 hypocotyl elongation and axr1 auxin-resistant mutants. Plant Mol Biol 27: 1071–1083[CrossRef][Web of Science][Medline] Santelia D, Vincenzetti V, Azzarello E, Bovet L, Fukao Y, Duchtig P, Mancuso S, Martinoia E, Geisler M (2005) MDR-like ABC transporter AtPGP4 is involved in auxin-mediated lateral root and root hair development. FEBS Lett 579: 5399–5406[CrossRef][Web of Science][Medline] Schmülling T, Schell J, Spena A (1989) Promoters of the rolA, B, and C genes of Agrobacterium rhizogenes are differentially regulated in transgenic plants. Plant Cell 1: 665–670 Schrader J, Baba K, May ST, Palme K, Bennett M, Bhalerao RP, Sandberg G (2003) Polar auxin transport in the wood-forming tissues of hybrid aspen is under simultaneous control of developmental and environmental signals. Proc Natl Acad Sci USA 100: 10096–10101 Stieger PA, Reinhardt D, Kuhlemeier C (2002) The auxin influx carrier is essential for correct leaf positioning. Plant J 32: 509–517[CrossRef][Web of Science][Medline] Swarup R, Friml J, Marchant A, Ljung K, Sandberg G, Palme K, Bennett M (2001) Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex. Genes Dev 15: 2648–2653 Swarup R, Kargul J, Marchant A, Zadik D, Rahman A, Mills R, Yemm A, May S, Williams L, Millner P, et al (2004) Structure-function analysis of the presumptive Arabidopsis auxin permease AUX1. Plant Cell 16: 3069–3083 Swarup R, Kramer EM, Perry P, Knox K, Leyser HMO, Haseloff J, Beemster GTS, Bhalerao R, Bennett MJ (2005) Root gravitropism requires lateral root cap and epidermal cells for transport and response to a mobile auxin signal. Nat Cell Biol 7: 1057–1065[CrossRef][Web of Science][Medline] Tam YY, Epstein E, Normanly J (2000) Characterization of auxin conjugates in Arabidopsis. Low steady-state levels of indole-9-acetyl-aspartate indole-3-acetyl-glutamate, and indole-3-acetyl-glucose. Plant Physiol 123: 589–595 Tanaka H, Dhonukshe P, Brewer PB, Friml J (2006) Spatiotemporal asymmetric auxin distribution: a means to coordinate plant development. Cell Mol Life Sci 63: 2738–2754[CrossRef][Web of Science][Medline] Terasaka K, Blakeslee JJ, Titapiwatanakun B, Peer WA, Bandyopadhyay A, Makam SN, Lee OR, Richards EL, Murphy AS, Sato F, et al (2005) PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in Arabidopsis thaliana roots. Plant Cell 17: 2922–2939 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680 van der Graaff E, Boot K, Granbom R, Sandberg G, Hooykaas PJJ (2003) Increased endogenous auxin production in Arabidopsis thaliana causes both earlier described and novel auxin-related phenotypes. J Plant Growth Regul 22: 240–252 Vicente-Agullo F, Rigas S, Desbrosses G, Dolan L, Hatzopoulos P, Grabov A (2004) Potassium carrier THR1 is required for auxin transport in Arabidopsis roots. Plant J 40: 523–535[CrossRef][Web of Science][Medline] Vieten A, Vanneste S, Wisniewska J, Benkova E, Benjamins R, Beeckman T, Luschnig C, Friml J (2005) Functional redundancy of PIN proteins is accompanied by auxin dependent cross-regulation of PIN expression. Development 132: 4521–4531 Yamamoto M, Yamamoto KT (1998) Differential effects of 1-naphthalene acetic acid, indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid on the gravitropic response of roots in an auxin resistant mutant of Arabidopsis, Aux1. Plant Cell Physiol 39: 660–664 Yang YD, Hammes UZ, Taylor CG, Schachtman DP, Nielsen E (2006) High-affinity auxin transport by the AUX1 influx carrier protein. Curr Biol 16: 1123–1127[CrossRef][Web of Science][Medline] Young GB, Jack DL, Smith DW, Saier MH (1999) The amino acid/auxin: proton symport permease family. Biochim Biophys Acta 1415: 306–322[Medline] Za Zhao Y, Christensen SK, Frankhauser C, Cashman JR, Cohen JD, Weigel D, Chory J (2001) A role for flavin monooxygenase-like enzymes in auxin biosynthesis. Science 291: 306–309 Zhuang XL, Jiang JF, Li JH, Ma QB, Xu YY, Xue YB, Xu ZH, Chong K (2006) Over-expression of OsAGAP, an ARF-GAP, interferes with auxin influx, vesicle trafficking and root development. Plant J 48: 581–591[CrossRef][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|