| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online February 7, 2008; 10.1104/pp.107.110304 Plant Physiology 146:1637-1650 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Characteristic and Expression Analysis of a Metallothionein Gene, OsMT2b, Down-Regulated by Cytokinin Suggests Functions in Root Development and Seed Embryo Germination of Rice1,[OA]College of Life Sciences, Wuhan University, Wuhan 430072, China
Metallothioneins (MTs) are low molecular mass and cysteine-rich metal-binding proteins known to be mainly involved in maintaining metal homeostasis and stress responses. But, their functions in higher plant development are scarcely studied. Here, we characterized rice (Oryza sativa) METALLOTHIONEIN2b (OsMT2b) molecularly and found that its expression was down-regulated by cytokinins. OsMT2b was preferentially expressed in rice immature panicles, scutellum of germinating embryos, and primordium of lateral roots. In contrast with wild-type plants, OsMT2b-RNA interference (RNAi) transgenic plants had serious handicap in plant growth and root formation, whereas OsMT2b-overexpressing transformants were dwarfed and presented more adventitious roots and big lateral roots. The increased cytokinin levels in RNAi plants and decreased cytokinin levels in overexpressing plants were confirmed by high-performance liquid chromatography quantitative analysis in the roots of wild-type and transgenic plants. In RNAi plants, localization of isopentenyladenosine, a kind of endogenous cytokinin, in roots and germinating embryos expanded to the whole tissues, whereas in overexpressing plants, the isopentenyladenosine signals were very faint in the vascular tissues of roots and scutellum cells of germinating embryos. In vitro culture of embryos could largely resume the reduced germination frequency in RNAi plants but had no obvious change in overexpressing plants. Taken together, these results indicate a possible feedback regulation mechanism of OsMT2b to the level of endogenous cytokinins that is involved in root development and seed embryo germination of rice.
Metallothioneins (MTs) were discovered in 1957 by Margoshes and Vallee and identified as low molecular mass (4–8 kD) proteins that contain Cys-rich N and C termini (Vallee, 1991  ). MT genes have been widely found in animals, plants, and prokaryotes. Not like the primary mammalian MTs that contain 20 highly conserved Cys residues (Klassen et al., 1999), most plant MTs have distinct arrangements of Cys residues (Robinson et al., 1993), which suggests that they may be different not only in sequences but also in functions. According to the arrangement of Cys residues, the MTs of higher plant are further classified into four types that have diverse patterns of expression (Cobbett and Goldsbrough, 2002).
Recently, the studies of MTs in animals and plants were mainly focused on the roles in maintaining homeostasis of essential metals and metal detoxification. For plant, MTs can efficiently bind metals (Murphy et al., 1997
In many species of higher plants, MTs were reported to express specifically in organs. For example, the rice (Oryza sativa) ricMT gene was highly expressed in stem nodes (Yu et al., 1998
Cytokinin is a vital phytohormone controlling various events of plant growth and development such as cell division, seed germination, root elongation, leaf senescence, and the transition from vegetative growth to reproductive development. But compared with research on other plant hormones, such as ethylene and abscisic acid (ABA), the studies on cytokinin were delayed (Eckardt, 2003
As the most important agronomical plant, rice is recognized as a useful experimental model of monocot to study the mechanism of gene expression (Kurata et al., 2005 Here, we reported the characterization of a type-2 MT, OsMT2b, and its expression patterns and functions in rice. The results showed that OsMT2b transcript levels were regulated by cytokinin, and abnormal expression of OsMT2b affected the endogenous cytokinin levels in organs and tissues by the analysis of OsMT2b-RNAi and OsMT2b-overexpressing transgenic plants of rice. Considering the interrelation of OsMT2b and cytokinin as well as the phenotypes of roots and germinating embryos in transgenic plants, it indicates that OsMT2b plays important roles in initiation of lateral root and seed embryo germination.
Analysis of OsMT2b in the MT Gene Family of Higher Plants To study the molecular events of rice early embryo development, suppression subtractive hybridization was performed by using complementary DNA (cDNA) of rice embryos (indica ‘Jiayu 948’) at 5 to 7 d after pollination (DAP) as tester and cDNA of the embryos at 15 to 17 DAP as driver (J. Yuan, Y. Ren, and J. Zhao, unpublished data). One clone of the subtracted cDNA library showed high similarities to the cDNA of OsMT2b (U77294), and the full cDNA clone was denominated to OsMT2bL (O. sativa METALLOTHIONEIN2b LIKE) and submitted to GenBank with accession number EF584509. The only difference of amino acid sequence between OsMT2bL and OsMT2b is Ser in OsMT2b and Gly in OsMT2bL at the position of the 21st amino acid. We chose OsMT2b for further study. Multiple sequence alignment was conducted among OsMT2b, OsMT2bL, and other proteins, including AtMT2b (NP195858) from Arabidopsis (Arabidopsis thaliana), AbMT2b (CAC40742) from Atropa belladonna, HvMTL (BAA23628) from Hordeum vulgare and ZeaMTL (CAA57676) from maize (Zea mays; Fig. 1A ). Type-2 MTs contain two Cys-rich domains separated by a space of approximately 40 amino acid residues. The sequences of the N-terminal domain of this type of MT are highly conserved (MSCCGGNCGCGS), and the C-terminal domain contains three Cys-Xaa-Cys motifs (Fig. 1A). The analysis shows that homologous genes of OsMT2b exist ubiquitously in monocotyledon and dicotyledon. It suggests that this gene family may play important roles in higher plants.
There are seven members of this protein family in Arabidopsis and 15 members in rice. By phylogenetic analysis, the protein members are divided into several small subgroups (Fig. 1B). Some subgroups contain both rice and Arabidopsis representatives. For instance, OsMT3a, OsMT3b, and OsMT3c are clustered with AtMT3. Similarly, OsMT4a is clustered with AtMT4a and AtMT4b.
The 5'-flanking region of OsMT2b, including a region of about 961 bp upstream of the translation initiation codon ATG, is derived from the National Center for Biotechnology Information database and analyzed as a promoter (Fig. 1C). There are five ARABIDOPSIS RESPONSE REGULATOR1 (ARR1)-binding elements (ARR1AT) with core sequence 5'-AGATT-3' in the promoter region. One ARR1AT element was found in the promoter of the O. sativa NONSYMBIOTIC HAEMOGLOBIN2 (OsNSHB2) gene, and the mutation of this element abolished promoter activation in response to cytokinin (Ross et al., 2004
The expression levels of OsMT2b were analyzed using the Massively Parallel Signature Sequencing (MPSS) database that was constructed by Nakano et al., 2006
To further study the spatial expression pattern of OsMT2b, we performed GUS staining in a T-DNA insert mutant 03Z11AN35 that has a GAL4-UAS enhancer trap system located between the promoter and the CDS of OsMT2b (Fig. 3A ). In this system, the GAL4-UAS is made up of GAL4/VP16, a fusion gene of yeast transcriptional activator GAL4 DNA-binding domain with the herpes simplex virus VP16 activation domain, and the upstream activator sequence with six repeats of UAS (6 x UAS). The following part of GAL4-UAS is GUS, a β-glucuronidase gene. The enhancer trap system has a higher probability of detecting the expression of gene whose promoter locates near the trap system, and hence is possibly more effective for identifying gene functions in reverse genetic studies (Greco et al., 2001 ; Wu et al., 2003; Zhang et al., 2006).
The histochemical staining of GUS in different developmental stages of rice embryos showed that the activity of GUS enhanced by the promoter of OsMT2b was strong in the top of the scutellum at 7 DAP (Fig. 3C), but almost not detected in the embryos at 5 and 10 DAP (Fig. 3, B and D). In the germinating embryos, GUS staining signal was intense in the scutellum (arrow) and the cap of the radicle at 2 DAG (arrowhead; Fig. 3, E and F), which accorded with the result of MPSS that the OsMT2b transcript level was high in seeds at 3 DAG. In the embryos at 4 DAG, with shoots and roots emerging out, the GUS signal still concentrated in rice scutellum, and also appeared in the vascular bundle of shoot (arrowhead; Fig. 3G), which suggests that OsMT2b may play a role in the development of rice embryo scutellum. The GUS signal in immature panicles verified the second expression peak of OsMT2b in MPSS analysis. In florets of a 1-cm-long panicle, the GUS staining located in the pedicel and the basement of glumes (Fig. 3H). In florets of an 8-cm-long panicle, besides the positions described above, GUS expressions were also detected in the anthers and pistils (Fig. 3I). The signal was intense in the basal parts of ovaries before pollination (Fig. 3J), and in the basal parts of stigmas and ovaries after pollination (Fig. 3K). To locate OsMT2b precisely at rice roots as described in MPSS results, GUS staining was performed. The strong signals were detected predominantly in the basal parts of lateral roots and nearby vascular cylinders of roots (Fig. 3, L and M). In the part of the root with lateral root primordium, the GUS staining mainly focused in root primordium, the passage cell of endodermis, and cells of pericycle and phloem, but not in the cells of epidermis, cortex, endodermis, and vessels (Fig. 3, N and O).
To investigate whether metal ions, hormones, and stress-related factors are involved in the regulation of OsMT2b, we harvested rice seedlings treated with various factors and detected the transcriptional level of OsMT2b by real-time quantitative reverse transcription (RT)-PCR. The expression levels of OsMT2b were markedly increased in the roots treated with iron (Fe), zinc (Zn), and indole-3-acetic acid (IAA), but observably decreased in the treatments of copper (Cu), 6-bezyladenine (6-BA), kinetin (KT), and NaCl (Fig. 4A ). In shoots, its expression was elevated in the treatments of manganese (Mn), but remarkably decreased in the treatment of 6-BA and KT (Fig. 4B). Besides that, 4°C cold treatment also obviously reduced the transcript level of OsMT2b in roots and shoots, which is consistent with the results of MPSS.
In view of the intensive response of OsMT2b transcripts to the treatment of cytokinin, we chose zeatin, a kind of monocotyledonous endogenous cytokinin, to treat rice seedlings and assayed its effect on rice roots by real-time quantitative RT-PCR. The result showed that the OsMT2b expression level started to distinctly decrease by the treatment of zeatin from 1 to 20 µM and reached the lowest value in 10 µM (Fig. 4C). To further confirm the down-regulation of OsMT2b transcripts by zeatin, we performed GUS activity assay in the roots of GAL4-UAS rice seedlings treated with zeatin. Quantitative analysis showed the alteration of GUS translation levels enhanced by the promoter of OsMT2b was dependent on the change of zeatin concentration. GUS activities decreased in the treatments of 1 to 20 µM zeatin, and yet reached the lowest value in 10 µM zeatin (Fig. 4D), which was accorded with the alteration of OsMT2b transcript levels. Based on the analysis of real-time quantitative RT-PCR in wild-type rice and the assay of GUS activity in GAL4-UAS rice, the results indicate that the expression of OsMT2b is down-regulated by cytokinin.
To examine whether the expression change of OsMT2b has an effect on the development of rice plants, we analyzed mature transgenic plants of OsMT2b-RNAi and OsMT2b-overexpressing (Fig. 5A ). The RNAi construct was made by cloning a DNA fragment containing two full-length OsMT2b cDNAs, in inverse orientation and separated by a GFP sequence linker, into the p2K1+ vector under the control of the maize Ubq1 promoter (Fig. 5B). In the overexpression construct, a full-length cDNA of OsMT2b was subcloned into the p2K1+ vector under the control of the maize Ubq1 promoter (Fig. 5C). Real-time quantitative RT-PCR analysis confirmed the alterations of OsMT2b expression in the leaves and roots of RNAi and overexpressing transgenic plants (Fig. 5D).
As compared with the wild-type plants, the overexpressing plants had more tillers but were a little shorter, whereas the large quantity of RNAi transgenic plants (RL, about 75%) had almost no tillering and were extremely stunted (Fig. 5, A and E). The small quantity of RNAi transformants (RS, about 25%) with slight decline of OsMT2b expression could develop into mature plants but were shorter than mature overexpressing plants. The RL plants with significant reduction of OsMT2b expression suffered severe developmental defect and eventually died. For this reason, materials for assaying of RNAi plants in the following experiments were carried from the RS transformants. The results of real-time quantitative RT-PCR confirmed that OsMT2b transcript levels reduced 67.2% in leaves and 61.9% in roots of the RS plants, and reduced 93.3% in leaves and 93.6% in roots of the RL transformants compared with that of the wild-type plants. On the other hand, the OsMT2b transcript level in overexpressing plants was markedly enhanced up to 12.2 times in leaves and 12.1 times in roots (Fig. 5D).
To analyze the causes for more tillers in OsMT2b overexpressing plants and developmental defects in OsMT2b RNAi transformants, we first observed the root phenotype of the 3-week-old seedlings (Fig. 6A ). Most RNAi transformants (RL) exhibited inhibition of root formation, but the overexpressing plants could form more roots. To describe rice root morphogenesis in detail, we plotted a model of rice seedling with diverse root trait (Fig. 6B). In the RNAi seedlings (RL), the length of the primary root that develops from the radicle of the embryo was dramatically shortened, and the number of adventitious roots and small lateral roots obviously decreased (Fig. 6C). In the overexpressing seedlings, there were many more adventitious roots and big lateral roots (BLR), which initiate from the adventitious roots and have their own lateral roots (Fig. 6C). However, there were very few BLR in wild-type and RNAi transgenic seedlings. The result suggests a possible function of OsMT2b in the development of rice root.
To investigate endogenous cytokinin iPA levels in the roots of wild-type and transgenic plants, we applied HPLC technique to analyze and compare them. The results showed that the retention time of standard iPA was at 7.737 min, and the major peak was clearly detectable when the concentration was 3.2 ng mL–1 (Fig. 6D). At the same retention time, the peak areas of iPA showed differences in the roots of wild-type (Fig. 6E), OsMT2b-RNAi (Fig. 6F), and OsMT2b-overexpressing plants (Fig. 6G). Compared with the roots of wild-type plants (2.29 ng g–1 fresh weight [FW]), iPA levels doubled in the roots of RNAi plants (4.85 ng g–1 FW) and slightly decreased in the roots of overexpressing plants (1.85 ng g–1 FW; Fig. 6H). To detect the spatial change of cytokinin iPA, by using immunohistochemical technique, we localized iPA in the roots of mature wild-type and transgenic plants. In the roots of wild-type plants, iPA signal was mainly in the vascular tissues and epidermis cells, and less in cells of the lateral roots (Fig. 6J). The distribution region of iPA in the roots of RNAi plants was similar to the wild-type plants but its level was higher in the former (Fig. 6L). In the roots of overexpressing plants, the iPA signal was detected only in epidermis cells but not in the vascular tissues (Fig. 6M). There was no signal of iPA in the control root sections (Fig. 6K). To assess whether the synthesis and metabolism of endogenous cytokinin changed in the transgenic plants, we chose and assayed the expressions of two genes correlated with cytokinin, the isopentenyltransferase gene (IPT3, coding a cytokinin synthesis rate-limiting enzyme) and the cytokinin oxidase gene (CKX2, coding an enzyme that catalyzes the irreversible degradation of cytokinin). In the overexpressing plants, OsIPT3 transcript levels decreased 27.7% in leaves and 54.1% in roots compared with wild-type plants, but OsCKX2 expression had no detectable change. In the RNAi plants, the expressions of both OsIPT3 and OsCKX2 in leaves declined 96.6% and 98.1%, respectively, whereas in roots, OsIPT3 transcript levels decreased 82.5% but that of OsCKX2 had no visible change (Fig. 6I). All these results indicate that the endogenous cytokinin level was slightly reduced in roots of the overexpressing plants, whereas distinctly increased in roots of the RNAi plants (Fig. 6H). Therefore, the abnormal expressions of OsMT2b have an effect on the levels of cytokinin in roots of the transgenic plants, which hampers the development of rice plants, especially in root growth.
The analysis of morphology showed that the structures of mature seed embryos were similar in OsMT2b-RNAi, overexpressing transgenic plants and wild-type plants, but the former two were smaller than the latter in size (Fig. 7A ). In addition, in the transgenic plants the scutellum of embryos evidently diminished and its cell thickness lessened 39.2% in RNAi plants and 27.7% in overexpressing plants compared with wild-type plants, but its layers had no obvious change (Fig. 7B). This kind of phenotype was more obvious in seed embryos of RNAi plants than in those of overexpressing plants. In OsMT2b-RNAi and overexpressing plants, the frequency of seed embryo germination declined dramatically (in vivo), but resumed largely in OsMT2b-RNAi plants and a little in OsMT2b-overexpressing plants when the seed embryos were cultured in N6 medium without hormone (in vitro; Fig. 7C).
By fluorescein diacetate (FDA) staining to detect the viability of germinating embryos in vivo, the result showed that the FDA fluorescence of embryos was much stronger in the wild-type plants than in the RNAi and overexpressing plants (pictures not shown). The result confirmed the decline of germination frequencies in the seed embryos of transgenic plants. Furthermore, immunohistochemical localization was used to assay whether the distribution of iPA changed in the seed embryos of transgenic plants. The result showed that iPA signal was mainly located in the coleoptile and scutellum of wild-type plants (Fig. 8A ). The signal in the seed embryos of RNAi plants was obviously stronger than that in wild-type plants, and expanded in the whole embryos (Fig. 8C). However, the iPA signal slightly decreased in the embryos of overexpressing plants and was mainly presented in the coleoptiles (Fig. 8D). There was no detectable signal of iPA in the control embryo sections (Fig. 8B). The results indicate that the alteration of cytokinin distribution in the seed embryos of transgenic plants was similar to that in the roots of transgenic plants, and its change was likely to be one of the reasons for the reduction of the germination frequency in the seed embryos of rice transgenic plants.
There Is Correlation between OsMT2b Gene Expression and Cytokinin Levels
In this article, most OsMT2b-RNAi transformants exhibited serious obstacles to plant growth and root development. It was reported that the same typical phenotype was caused by cytokinin overproduction in rice (Sakamoto et al., 2006 In our studies, the quantitative analysis confirms the alteration of cytokinin levels in the roots of rice transgenic plants. Compared with the roots of wild-type plants, the cytokinin iPA level was much higher in OsMT2b-RNAi plants but a little lower in OsMT2b-overexpressing plants (Fig. 6H). Besides that, the immunohistochemical localization of iPA in rice roots (Fig. 6, J–M) and germinating embryos (Fig. 8, A–D) further validates the abnormal levels of iPA in the transgenic plants. In OsMT2b-RNAi plants, iPA signals were the strongest and expanded to a majority of tissues, but in OsMT2b-overexpressing plants, distinctly weakened in the scutellum of embryos and the vascular tissue of roots. It makes clear that OsMT2b plays an important role in regulating the cytokinin levels of rice plants.
The results of real-time quantitative RT-PCR analysis and GUS activity assay in the treated roots of rice seedlings showed that OsMT2b expression kept declining when the exogenous zeatin level gradually increased. It indicates that OsMT2b is down-regulated by cytokinin and involved in the cytokinin signaling pathway. In the promoter region of OsMT2b, there are five binding motifs (AGATT) for the type-B ARR1, which is involved in early responses to cytokinins (Oka et al., 2002
Cytokinin levels of plant tissues are mainly determined by the rate of biosynthesis and catabolism (Eckardt, 2003
Another possibility is that the activity of CKXs is altered in transgenic plants. It was reported that the addition of Cu ions markedly enhanced cytokinin oxidase activity in Phaseolus vulgaris (Chatfield and Armstrong, 1987
Besides altering the biosynthesis and metabolism of cytokinin by regulating the related genes, OsMT2b may have other pathways to affect endogenous cytokinin levels. We found that the OsMT2b gene predominantly expressed in the scutellum of rice germinating seed embryo and the primordium of lateral root. The expression pattern was similar to that of OsENT2, which was involved in the long-distance transport of nucleoside-type cytokinins by loading and unloading from the phloem, respectively (Hirose et al., 2005
Organ specificity has been reported for MT genes in many species of plants (Zhou et al., 2006
OsMT2b expresses predominantly in the primordium of lateral roots, and alters the cytokinin level in the roots of the transgenic plants, which was confirmed by the HPLC quantitative analysis. In rice, it was reported that both the KT and zeatin impeded lateral root formation by inhibiting the initiation of lateral root primordia (Debi et al., 2005
GUS assay showed that OsMT2b was located in the scutellum top of embryos at 7 DAP but not at 5 and 10 DAP (Fig. 3, B–D). Generally, the scutellum formation of rice is at about 6 to 8 DAP, and the differentiation of scutellum procambium is at 6 DAP. In view of indications that scutellum cell thickness narrowed in the germinating embryos of transgenic plants (Fig. 7, A and B), this suggests that the OsMT2b gene is involved in the development and function of scutellum. In addition, OsMT2b was predominantly expressed in the scutellum of rice germinating embryos (Fig. 3, E and F). It is well known that the epithelium layer in the dorsal portion of the scutellum elongates and acts as an absorptive tissue of storage reserves from endosperm during germination (Hirose et al., 2005
To investigate whether the insufficiency of nourishment is the main reason for germination decline in transgenic embryos, we cultured the embryos in medium with enough nutrition. Due to all of the embryos having contact with the medium and absorbing nutrition, the germination frequency of OsMT2b-RNAi embryos rose and largely resumed. But the situation in OsMT2b-overexpressing plants was not obviously changed, which indicates that there are other factors having effects on embryo germination in the transgenic plants. In the aleuronic layer of wheat dormant seed, GA could not induce In conclusion, the expression of the OsMT2b gene is down-regulated by cytokinin and there is a positive feedback regulation mechanism of OsMT2b to cytokinin levels. Considering the phenotypes of two transgenic plants that have ectopic expression of OsMT2b, we conclude that the OsMT2b gene has a crucial role during the development of roots and the germination of seed embryos in rice by acting as a regulator to control cytokinin at an appropriate level.
Plant Material The wild-type plants and 03Z11AN35 mutant (GAL4-UAS plant) of rice (Oryza sativa japonica ‘Zhonghua 11’), the OsMT2b-overexpressing and OsMT2b-RNAi transgenic plants of rice (japonica ‘Kinmaze’), and the plants of rice (indica ‘Jiayu 948’) were grown in a greenhouse at Wuhan University. There is a GAL4-UAS enhancer trap system that includes GUS as the reporter gene and locates between the promoter and CDS of OsMT2b in the 03Z11AN35 mutant. The temperature for plant growth was 30°C/25°C under a photoperiod of 16-h light and 8-h dark.
As a sequencing-based technology, MPSS is used to quantify gene expression levels by generating millions of short sequence tags per library (Zhang et al., 2005
GUS assay was conducted according to Jefferson et al. (1987) To localize the GUS signal in the primordium of lateral roots in detail, paraffin section analysis was performed after GUS staining. In each type plant, five separate roots (every one was longer than 6 cm) were observed and then cut into 0.3-cm segments for GUS assay as described below.
To characterize the effects of different metal ions, hormones, and abiotic stresses on OsMT2b expression, the 2-week-old seedlings of rice (japonica ‘Zhonghua 11’) were cultured in aqueous solutions containing 0.1 mM CuCl2, 0.2 mM FeCl3, 0.1 mM MnCl2, 0.2 mM ZnCl2, 5 µM GA3, 5 µM IAA, 5 µM 6-BA, 5 µM KT, 25 µM ABA, and 0.4 M NaCl as high salinity treatment, respectively, in 26 °C for 24 h. The treatment of low temperature was at 4 °C; the culture of seedlings with distilled water in 26°C was used as control. All the treatments were repeated three times, and the results represented the means (± SD) of those three independent experiments. After the treatments, the shoots and roots were immediately frozen in liquid nitrogen for RNA extraction and real-time quantitative RT-PCR analysis. To analyze zeatin regulation of OsMT2b transcription, the 2-week-old seedlings of rice (japonica ‘Zhonghua 11’) were also submerged separately in aqueous solutions containing 0, 1, 5, 10, and 20 µM zeatin, respectively, for 24 h. Following that, the roots of treated seedlings were immediately frozen in liquid nitrogen for RNA extraction and real-time quantitative RT-PCR to detect OsMT2b expression. The treatments of zeatin were repeated three times.
The 3-week-old GAL4-UAS seedlings of rice (japonica ‘Zhonghua 11’) were grown in aqueous solutions containing 0, 1, 5, 10, and 20 µM zeatin, respectively, for 24 h to measure GUS activity. The total protein was extracted from the roots of treated seedlings and assayed with 4-methyl umbelliferyl glucuronide substrate using a spectrofluorophotometer (RF-5301PC; Shimadzu) at the excitation/emission wavelengths of 365/455nm, as described by Jefferson et al. (1987)
The real-time quantitative RT-PCR was performed on equal amounts of cDNA prepared from the various materials by SYBR-green fluorescence using a Rotor-Gene 6000 real-time PCR machine (Corbett Research). For assaying the expressions of the OsMT2b, OsIPT3, and OsCKX2 genes in RNAi and overexpressing transgenic and wild-type plants of rice (japonica ‘Kinmaze’), the leaves and roots from 6-week-old plantlets were, respectively, collected and immediately frozen in liquid nitrogen for RNA extraction and real-time quantitative RT-PCR analysis. The expressions of those genes in different tissues were standardized with the gene rac1 as an internal control. The PCR protocol contained an initial 8-min incubation step at 95°C for complete denaturation, followed by 45 cycles consisting of 95°C for 20 s, 56°C for 30 s, and 72°C for 45 s. The specificity of the PCR amplification was checked with a heat dissociation curve (65°C–95°C) following the final cycle of the PCR. Primers of OsMT2b (GenBank accession no. U77294) are 5' AAGAAGCCTGGCACGCATGAG 3' and 5' TGCGTGTGTCGATCAATGTTGGA 3'. Primers for OsIPT3 (GenBank accession no. AB239799) are 5' CGGGAGGTGGGGATGTTTCTGC 3' and 5' CCGCCGTCGTCTCCAGCAACC 3'. Primers for OsCKX2 (GenBank accession no. AB205193) are 5' GCACCCATGGCTGAACCTGTT 3' and 5' GCAGGATCCCCACCGTGTAGAA 3'. Primers of rac1 (the gene of GTP binding protein; GenBank accession no. X16280) are 5' GGAGCGTGGTTACTCATTC 3' and 5' AAAGGCGACGGGACTCCA 3'. The constitutively expressed gene rac1 was used as an internal standard. Data represent the means (± SD) of three independent experiments, each performed in triplicate.
Extraction and HPLC analysis of the N6-iPA, a kind of cytokinin, were performed as reported by Yang et al. (2001) HPLC analysis was done using a computer-assisted HP1100 (Agilent Technologies) and a ZORBAX SB-C18 (Agilent Technologies) column (4.6 x 250 mm; 5 µm). The mobile phase was described above and used in HPLC analysis after filtration through a 0.25-µm filter. Flow rate was 0.5 mL min–1 and the temperature of column was 45°C. Detection wavelength was 270 nm. Peak identification was based on retention time, main absorption maxima, and spectral shape as compared with the corresponding standards under the same separation conditions. The grade concentrations of iPA (Sigma) were used for peak identification and constructing the external standard curve. Three independent HPLC experiments were performed and the samples tested in each experiment were separate.
Paraffin Section of Roots
Semithin Section of Germinating Embryos
To study the effects of nutrition condition on the seed embryo germination, the mature seeds of transgenic and wild-type plants were germinated in water for 2 d. After that, some of the seed embryos were isolated and incubated in a 0.01% FDA solution for 10 min to observe their live status under a DMIRE2 invert microscope (Leica) with UV. The other seed embryos were isolated and cultivated in N6 medium containing 3% Suc and 0.4 g L–1 casein hydrolysate for 3 d at 26°C in the dark. Following that, the germination percentages of the seed embryos were counted. FDA staining was repeated three times. Embryo number of each type was more than 50 and 20 in germination test of in vivo and in vitro, respectively. The germination assay of each type embryo was repeated more than three times.
Using the immunohistochemical technique, iPA was localized in the roots and germinating embryos of transgenic and wild-type rice (japonica ‘Kinmaze’). To strengthen the signals of cytokinin, the samples were treated with the method described by Karkonen and Simola (1999) Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number U77294.
We are grateful to Dr. Hann-Ling Wong and Prof. Ko Shimamoto (Nara Institute of Science and Technology, Japan) for kindly providing the seeds of OsMT2b-overexpressing and OsMT2b-RNAi transgenic plants, Prof. Qifa Zhang (National Key Laboratory of Crop Genetic Improvement, China) for the seeds of rice mutant 03Z11AN35, and the Laboratory of Plant Hormones, Nanjing Agricultural University for the anti-iPA mouse monoclonal antibody. Received October 2, 2007; accepted January 30, 2008; published February 7, 2008.
1 This work was supported by the Major State Basic Research Program of China (2007CB108704) and the National Natural Science Foundation of China (30521004 and 30570103).  The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Jie Zhao (jzhao{at}whu.edu.cn).
[OA] Open Access article can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.110304 * Corresponding author; e-mail jzhao{at}whu.edu.cn.
Akashi K, Nishimura N, Ishida Y, Yokota A (2004) Potent hydroxyl radical-scavenging activity of drought-induced type-2 metallothionein in wild watermelon. Biochem Biophys Res Commun 323: 72–78[CrossRef][ISI][Medline] Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, Nishimura A, Angeles ER, Qian Q, Kitano H, Matsuoka M (2005) Cytokinin oxidase regulates rice grain production. Science 309: 741–745 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254[CrossRef][ISI][Medline] Chatfield JM, Armstrong DJ (1987) Cytokinin oxidase from Phaseolus vulgaris callus tissues: enhanced in vitro activity of the enzyme in the presence of copper-imidazole complexes Plant Physiol 84: 726–731 Cobbett C, Goldsbrough P (2002) Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annu Rev Plant Biol 53: 159–182[CrossRef][Medline] Coyle P, Philcox JC, Carey LC, Rofe AM (2002) Metallothionein: the multipurpose protein. Cell Mol Life Sci 59: 627–647[CrossRef][ISI][Medline] Debi BR, Taketa S, Ichii M (2005) Cytokinin inhibits lateral root initiation but stimulates lateral root elongation in rice (Oryza sativa). J Plant Physiol 162: 507–515[CrossRef][ISI][Medline] Eastwood D, Tavener RJA, Laidman DL (1969) Sequential action of cytokinin and gibberellic acid in wheat aleurone tissue. Nature 221: 1267–1279[Medline] Eckardt NA (2003) A new classic of cytokinin research: cytokinin-deficient Arabidopsis plants provide new insight into cytokinin biology. Plant Cell 15: 2489–2492 Greco R, Ouwerkerk PBF, Sallaud C, Kohli A, Colombo L, Puigdomenech P, Guiderdoni E, Christou P, Hoge JHC, Pereira A (2001) Transposon insertional mutagenesis in rice. Plant Physiol 125: 1175–1177 Hall JL (2002) Cellular mechanisms for heavy metal detoxification and tolerance. J Exp Bot 53: 1–11 Hassinen VH, Tervahauta AI, Halimaa P, Plessl M, Peraniemi S, Schat H, Aarts MG, Servomaa K, Karenlampi SO (2007) Isolation of Zn-responsive genes from two accessions of the hyperaccumulator plant Thaspi caerulescens. Planta 225: 977–989[CrossRef][ISI][Medline] Hirose N, Makita N, Kojima M, Kamada-Nobusada T, Sakakibara H (2007) Overexpression of a type-A response regulator alters rice morphology and cytokinin metabolism. Plant Cell Physiol 48: 523–539 Hirose N, Makita N, Yamaya T, Sakakibara H (2005) Functional characterization and expression analysis of a gene, OsENT2, encoding an equilibrative nucleoside transporter in rice suggest a function in cytokinin transport. Plant Physiol 138: 196–206 Ito Y, Kurata N (2006) Identification and characterization of cytokinin-signaling gene families in rice. Gene 382: 57–65[CrossRef][ISI][Medline] Jain M, Tyagi AK, Khurana JP (2006) Molecular characterization and differential expression of cytokinin-responsive type-A response regulators in rice (Oryza sativa). BMC Plant Biol 6: 1–11[CrossRef][Medline] Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 3901–3907[ISI][Medline] Karkonen A, Simola LK (1999) Localization of cytokinins in somatic and zygotic embryos of Tilia cordata using immunocytochemistry. Physiol Plant 105: 356–366 Klassen C, Liu J, Choudhuri S (1999) Metallothionein: an intracellular protein to protect against cadmium toxicity. Annu Rev Pharmacol Toxicol 39: 267–294[CrossRef][ISI][Medline] Kurata N, Miyoshi K, Nonomura KN, Yamazaki Y, Ito Y (2005) Rice mutants and genes related to organ development, morphogenesis and physiological traits. Plant Cell Physiol 46: 48–62 Leszczyszyn OI, Schmid R, Blindauer CA (2007) Toward a property/function relationship for metallothioneins: histidine coordination and unusual cluster composition in a zinc-metallothionein from plants. Proteins 68: 922–935[CrossRef][ISI][Medline] Moyle R, Fairbairn DJ, Ripi J, Crowe M, Botella JR (2005) Developing pineapple fruit has a small transcriptome dominated by metallothionein. J Exp Bot 56: 101–112 Murphy A, Zhou J, Goldsbrough PB, Taiz L (1997) Purification and immunological identification of metallothioneins 1 and 2 from Arabidopsis thaliana. Plant Physiol 113: 1293–1301[Abstract] Mwange KN, Hou HW, Wang YQ, He XQ, Cui KM (2005) Opposite patterns in the annual distribution and time-course of endogenous abscisic acid and indole-3-acetic acid in relation to the periodicity of cambial activity in Eucommia ulmoides Oliv. J Exp Bot 56: 1017–1028[CrossRef] Nakano M, Nobuta K, Vemaraju K, Tej SS, Skogen JW, Meyers BC (2006) Plant MPSS databases: signature-based transcriptional resources for analyses of mRNA and small RNA. Nucleic Acids Res 34: 731–735[CrossRef] Oka A, Sakai H, Iwakoshi S (2002) His-Asp phosphorelay signal transduction in higher plants: receptors and response regulators for cytokinin signaling in Arabidopsis thaliana. Genes Genet Syst 77: 383–391[CrossRef][ISI][Medline] Qin Y, Chen D, Zhao J (2007) Localization of arabinogalactan proteins in anther, pollen, and pollen tube of Nicotiana tabacum L. Protoplasma 231: 43–53[CrossRef][ISI][Medline] Robinson NJ, Tommey AM, Kuske C, Jackson PJ (1993) Plant metallothioneins. Biochem J 295: 1–10[ISI][Medline] Ross EJ, Stone JM, Elowsky CG, Arredondo-Peter R, Klucas RV, Sarath G (2004) Activation of the Oryza sativa non-symbiotic haemoglobin-2 promoter by the cytokinin-regulated transcription factor, ARR1. J Exp Biol 55: 1721–1731 Sakamoto T, Sakakibara H, Kojima M, Yamamoto Y, Nagasaki H, Inukai Y, Sato Y, Matsuoka M (2006) Ectopic expression of KNOTTED1-like homeobox protein induces expression of cytokinin biosynthesis genes in rice. Plant Physiol 142: 54–62 Thomas JC, Perron M, LaRosa PC, Smigocki AC (2005) Cytokinin and the regulation of a tobacco metallothionein-like gene during copper stress. Physiol Plant 123: 262–271[CrossRef] Vallee BL (1991) Introduction to metallothionein. Methods Enzymol 205: 3–7[CrossRef][ISI][Medline] Woll K, Dressel A, Sakai H, Piepho HP, Hochholdinger F (2006) ZmGrp3: identification of a novel marker for root initiation in maize and development of a robust assay to quantify allele-specific contribution to gene expression in hybrids. Theor Appl Genet 113: 1305–1315[CrossRef][ISI][Medline] Wong HL, Sakamoto T, Kawasaki T, Umemura K, Shimamoto K (2004) Down-regulation of metallothionein, a reactive oxygen scavenger, by the small GTPase OsRac1 in rice. Plant Physiol 135: 1447–1456 Wu C, Li X, Yuan W, Chen G, Kilian A, Li J, Xu C, Li X, Zhou DX, Wang S, et al (2003) Development of enhancer trap lines for functional analysis of the rice genome. Plant J 35: 418–427[CrossRef][ISI][Medline] Yamada H, Suzuki T, Terada K, Takei K, Ishikawa K, Miwa K, Yamashino T, Mizuno T (2001) The Arabidopsis AHK4 histidine kinase is a cytokinin-binding receptor that transduces cytokinin signals across the membrane. Plant Cell Physiol 42: 1017–1023 Yang J, Zhang J, Wang Z, Zhu Q, Wang W (2001) Hormonal changes in the grains of rice subjected to water stress during grain filling. Plant Physiol 127: 315–323 Yu L, Umeda M, Liu J, Zhao N, Uchimiya H (1998) A novel MT gene of rice plants is strongly expressed in the node portion of the stem. Gene 206: 29–35[CrossRef][ISI][Medline] Zhang J, Li C, Wu C, Xiong L, Chen G, Zhang Q, Wang S (2006) RMD: a rice mutant database for functional analysis of the rice genome. Nucleic Acids Res 34: D745–D748 Zhang J, Simmons C, Yalpani N, Crane V, Wikinson H, Kolomiets M (2005) Genomic analysis of the 12-oxo-phytodienoic acid reductase gene family of Zea mays. Plant Mol Biol 59: 323–343[CrossRef][ISI][Medline] Zhou G, Xu Y, Li J, Yang L, Liu JY (2006) Molecular analyses of the metallothionein gene family in rice (Oryza sativa L.). J Biochem Mol Biol 39: 595–606[ISI][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TOP
ABSTRACT
RESULTS
-amylase activity until treated with exogenous cytokinin (Eastwood et al., 1969