Plant Physiol.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online January 30, 2008; 10.1104/pp.107.110189

Plant Physiology 146:1941-1951 (2008)
© 2008 American Society of Plant Biologists

OPEN ACCESS ARTICLE
This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrowOA All Versions of this Article:
146/4/1941    most recent
pp.107.110189v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Teranishi, M.
Right arrow Articles by Hidema, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Teranishi, M.
Right arrow Articles by Hidema, J.
Agricola
Right arrow Articles by Teranishi, M.
Right arrow Articles by Hidema, J.
ENVIRONMENTAL STRESS AND ADAPTATION TO STRESS

The Native Cyclobutane Pyrimidine Dimer Photolyase of Rice Is Phosphorylated1,[C],[OA]

Mika Teranishi*, Kentaro Nakamura, Hiroshi Morioka, Kazuo Yamamoto and Jun Hidema

Department of Environmental Life Sciences (M.T., K.N., J.H.) and Department of Biomolecular Sciences (K.Y.), Graduate School of Life Sciences, Tohoku University, Sendai 980–8577, Japan; and Department of Analytical and Biophysical Chemistry, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862–0973, Japan (H.M.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The cyclobutane pyrimidine dimer (CPD) is a major type of DNA damage induced by ultraviolet B (UVB) radiation. CPD photolyase, which absorbs blue/UVA light as an energy source to monomerize dimers, is a crucial factor for determining the sensitivity of rice (Oryza sativa) to UVB radiation. Here, we purified native class II CPD photolyase from rice leaves. As the final purification step, CPD photolyase was bound to CPD-containing DNA conjugated to magnetic beads and then released by blue-light irradiation. The final purified fraction contained 54- and 56-kD proteins, whereas rice CPD photolyase expressed from Escherichia coli was a single 55-kD protein. Western-blot analysis using anti-rice CPD photolyase antiserum suggested that both the 54- and 56-kD proteins were the CPD photolyase. Treatment with protein phosphatase revealed that the 56-kD native rice CPD photolyase was phosphorylated, whereas the E. coli-expressed rice CPD photolyase was not. The purified native rice CPD photolyase also had significantly higher CPD photorepair activity than the E. coli-expressed CPD photolyase. According to the absorption, emission, and excitation spectra, the purified native rice CPD photolyase possesses both a pterin-like chromophore and an FAD chromophore. The binding activity of the native rice CPD photolyase to thymine dimers was higher than that of the E. coli-expressed CPD photolyase. These results suggest that the structure of the native rice CPD photolyase differs significantly from that of the E. coli-expressed rice CPD photolyase, and the structural modification of the native CPD photolyase leads to higher activity in rice.


UVB radiation (280–320 nm) suppresses photosynthesis and protein biosynthesis, which in turn decreases growth and productivity (Teramura, 1983Go; Bornman and Teramura, 1993Go). UVB radiation also induces photodamage in DNA. The major UVB-induced lesions are cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6–4) photoproducts, which are formed between adjacent pyrimidines on the same strand (Britt, 1996Go). CPDs constitute the majority of these lesions (approximately 75%), and the (6–4) photoproducts account for the remainder. Such damage can be lethal or mutagenic to organisms and can also impede replication and transcription (Hoeijmakers, 2001Go; Sancar et al., 2004Go). Plants possess mechanisms to cope with UVB-induced DNA damage, including photoreactivation (photorepair) and nucleotide excision repair (also referred to as dark repair). In plants, photorepair is mediated by the enzyme photolyase, which absorbs blue/UVA light as an energy source to monomerize dimers and is the major pathway for counteracting UVB-induced DNA damage (Hidema et al., 1997Go; Britt, 1999Go). The sensitivity of rice (Oryza sativa) to UVB radiation varies among cultivars (Dai et al., 1992Go; Kumagai and Sato, 1992Go). We previously found that the CPD photorepair ability in UV-resistant rice is significantly higher than that in UV-sensitive rice and that this is due to an alteration of CPD photolyase activity resulting from spontaneously occurring mutations in the CPD photolyase gene (Teranishi et al., 2004Go; Hidema et al., 2005Go; Yamamoto et al., 2007Go). Furthermore, we recently generated transgenic rice plants bearing the CPD photolyase gene of the UV-resistant rice cultivar ‘Sasanishiki’ in the sense orientation or the antisense orientation (Hidema et al., 2007Go). The plants in which CPD photolyase was overexpressed had higher CPD photolyase activity and showed significantly more resistance to UVB-induced growth damage than wild-type plants. In contrast, plants with the gene transferred in the antisense orientation had significantly lower CPD photolyase activity and showed less resistance to UVB radiation. These results emphasized that CPD photolyase is a crucial factor for determining UVB sensitivity in rice.

CPD photolyases are categorized into two groups, class I in microorganisms and class II in higher organisms, on the basis of their deduced amino acid sequences (Yasui et al., 1994Go). The crystal structures of the class I CPD photolyases of Escherichia coli, Anacystis nidulans, and Thermus thermophilus expressed in E. coli show that they contain an {alpha}/β-domain in the N-terminal region and a helical domain in the C-terminal region (Park et al., 1995Go; Tamada et al., 1997Go; Komori et al., 2001Go). Furthermore, class I CPD photolyases contain FAD and a second, species-dependent chromophore, which is either methenyltetrahydrofolate (MTHF), as seen in E. coli and Saccharomyces cerevisiae (Johnson et al., 1988Go), or 8-hydroxy-7,8-didemethyl-5-deazariboflavin, as seen in Streptomyces griseus (Eker et al., 1981Go) and A. nidulans (Eker et al., 1990Go). Much less is known about class II than class I CPD photolyases. CPD photorepair activity showed broad peaks at wavelengths around 375 to 400 nm in an extract of Arabidopsis (Arabidopsis thaliana) seedlings (Pang and Hays, 1991Go) and around 375 to 425 nm in cucumber (Cucumis sativus) cotyledons (Takeuchi et al., 1998Go), indicating that a pterin-like molecule is involved as a second chromophore. It has also been reported that the Arabidopsis CPD photolyase overexpressed in E. coli contains FAD, but whether a second chromophore is involved has not been clear (Kleiner et al., 1999Go). Hirouchi et al. (2003)Go found a similar result in the rice CPD photolyase expressed in E. coli. On the other hand, a CPD photolyase purified from Arabidopsis seedlings by immunoprecipitation with an anti-Arabidopsis CPD photolyase antiserum (Waterworth et al., 2002Go) consisted of a single 60-kD protein containing an FAD and a pterin.

As described above, several features of class II CPD photolyases have not been fully determined. The aims of this study were to purify CPD photolyase from leaves of rice and to investigate some of the biochemical properties of this native class II CPD photolyase.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Purification of CPD Photolyase from Rice Leaves

We purified CPD photolyase from leaves of rice cultivar ‘Sasanishiki’ using a multistep process (Table I ). The specific enzyme activity of the crude extract prepared from leaves (fraction 1) was 16.7 CPD Mb–1 min–1 mg protein–1. The fold purification reported for this experiment was based on this value. In the second step, the CPD photolyase protein in fraction 1 was salted out with ammonium sulfate between 40% and 75% saturation (fraction 2). The specific enzyme activity of fraction 2 was 1.6-fold higher than that of fraction 1. At the next step, fraction 2 was loaded onto an UNO-Q12 anion-exchange column. The enzyme activity was recovered in the flow-through fraction of the UNO-Q12 column (fraction 3), and the specific enzyme activity was elevated 4-fold. Then, fraction 3 was subjected to heparin affinity column chromatography. The enzyme activity was recovered in the bound fraction of the heparin affinity column (fraction 4), and the specific enzyme activity was elevated 82-fold. Finally, fraction 4 was mixed with UV-irradiated DNA-conjugated magnetic beads. After the unbound protein was removed, the magnetic beads mixture was irradiated with 50 µmol m–2 s–1 blue light for 30 min with gentle stirring. The magnetic beads were then precipitated by magnetic separation. The enzyme activity was recovered in the supernatant (fraction 5). This treatment increased the purity of the enzyme 8,100-fold. The overall yield was 58.2%, and 36 µg CPD photolyase protein was obtained from 20 g fresh leaves.


View this table:
[in this window]
[in a new window]

 
Table I. Purification of rice CPD photolyase

 
We used SDS-PAGE to profile the proteins obtained at each purification step. SDS-PAGE was performed on fractions 2 to 4 using 12.5% polyacrylamide gels, followed by staining with Coomassie Brilliant Blue R-250 (Fig. 1A ), whereas SDS-PAGE was performed on fraction 5 and E. coli-expressed rice CPD photolyase using 7.5% polyacrylamide gels and silver stain (Fig. 1B). Rubisco, the most abundant protein in the leaf, is composed of a large subunit of 53 kD and a small subunit of 12 kD. Rubisco bound to the UNO-Q12 anion-exchange column (Fig. 1A, lane 3), whereas CPD photolyase activity was recovered in the flow-through fraction of the UNO-Q12 column (Fig. 1A, lane 2). Therefore, the UNO-Q12 anion-exchange column is suitable for separating CPD photolyase from fraction 2, which included Rubisco. Fraction 4 contained many kinds of proteins (Fig. 1A, lane 5), but two proteins of 54 and 56 kD were particularly abundant in fraction 5 (Fig. 1B, lane 1). The E. coli-expressed rice CPD photolyase migrated as a single band of about 55 kD (Fig. 1B, lane 2).


Figure 1
View larger version (47K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Profiles of proteins fractionated at each purification step. A, Electrophoresis was performed using a 12.5% SDS-polyacrylamide gel, and the gel was stained with Coomassie Brilliant Blue R-250. Lane 1, Protein precipitated with ammonium sulfate between 40% and 75% saturation (fraction 2); lane 2, flow-through fraction from the UNO-Q12 anion-exchange column (fraction 3); lane 3, protein bound to the UNO-Q12 anion-exchange column; lane 4, flow-through fraction of the heparin affinity column; lane 5, protein bound to the heparin affinity column (fraction 4). Fifty micrograms of protein was loaded onto each lane. Positions of the size markers are indicated at left. Arrows indicate the large and small subunits of Rubisco protein at 53 and 12 kD. B, Electrophoresis was performed using a 7.5% SDS-polyacrylamide gel. The gel was stained with silver stain. Lane 1, Protein purified with UV-irradiated DNA-conjugated magnetic beads (fraction 5); lane 2, E. coli-expressed rice CPD photolyase. One microgram of protein was loaded onto each lane of the gel. Positions of size markers are indicated at left. Arrowheads indicate molecular sizes at 54 and 56 kD and the arrow indicates 55 kD. [See online article for color version of this figure.]

 

Identification of the Two Proteins

To identify the two proteins in fraction 5, we performed a western-blot analysis using an anti-rice CPD photolyase antiserum, which was raised against the E. coli-expressed rice CPD photolyase. Both the 54- and 56-kD proteins reacted with the anti-rice CPD photolyase antiserum (Fig. 2A , lane 1), suggesting that both proteins might be CPD photolyase. To confirm this, the 54- and 56-kD proteins were excised from an SDS-PAGE gel and analyzed by matrix-assisted laser-desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Both 54- and 56-kD proteins matched sequences of the polypeptide deduced from the CPD photolyase gene of the rice cultivar ‘Sasanishiki’ (DNA Data Bank of Japan/EMBL/GenBank databases, accession no. AB096003; Table II ). This confirmed that both the 54- and 56-kD proteins were forms of the CPD photolyase.


Figure 2
View larger version (22K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Western-blot analysis with anti-rice CPD photolyase antiserum. A, Electrophoresis was performed using a 7.5% SDS-polyacrylamide gel and the gel was subjected to western-blot analysis using an anti-rice CPD photolyase antiserum. Lane 1, Protein purified with UV-irradiated DNA-conjugated magnetic beads; lane 2, E. coli-expressed rice CPD photolyase. Positions of size markers are indicated at left. Arrowheads indicate molecular sizes at 54 and 56 kD and the arrow indicates 55 kD. B, Effect of duration of blue irradiation. Fraction 4 was mixed with UV-irradiated DNA-conjugated magnetic beads and then irradiated (top) or not irradiated (bottom) with blue light for the time indicated. Thereafter, the magnetic beads were precipitated by a magnet and the protein remaining in the supernatant was subjected to western-blot analysis. [See online article for color version of this figure.]

 

View this table:
[in this window]
[in a new window]

 
Table II. Summary of matched peaks that were obtained by MALDI-TOF MS analysis of the 54- and 56-kD CPD photolyases, CPD photolyase treatment with {lambda}-PPase, and the E. coli-expressed rice CPD photolyase

 
CPD photolyase is released from DNA containing CPDs after the CPDs are repaired. To test whether the 54- and 56-kD proteins were active CPD photolyases and would be released from CPD-conjugated magnetic beads in a dose-dependent manner by exposure to blue radiation, we exposed the magnetic beads mixture with fraction 4 to various regimens of blue light and then performed a western-blot analysis. The amount of the two proteins released from the magnetic beads increased with the duration of exposure to blue light, up to 30 min (Fig. 2B), but release did not occur in samples kept in the dark for 120 min. The ratio of the band densities of the 54- and 56-kD proteins appeared to remain constant at all time points. Thus, both the 54- and 56-kD CPD photolyases appear to have CPD photorepair activity.


Identification of the Difference between the Two CPD Photolyases

To examine whether the 54- and 56-kD CPD photolyases are present in vivo or were formed during the purification process following the preparation of the crude leaf extract, we performed a western-blot analysis of the crude extract prepared from leaves of rice cultivar ‘Sasanishiki’. Both the 54- and 56-kD CPD photolyases were observed (Fig. 3A , lane 1), but the expression levels were low. Therefore, we tried to analyze the two isoforms by overexpressing CPD photolyase transgenic in ‘Sasanishiki’ rice plants (S-C plants). The transgenic plants were constructed by transferring an additional copy of the CPD photolyase gene of the rice cultivar ‘Sasanishiki’ in the sense orientation to the ‘Sasanishiki’ plant (Hidema et al., 2007Go). Both the 54- and 56-kD CPD photolyase were also observed in the crude extract prepared from the transgenic plants (Fig. 3A, lane 2). The addition of protease or phosphatase inhibitors to the homogenate buffer used for the preparation of crude extract did not affect the band intensities of the crude extract on a western blot (data not shown). These results indicated that both the 54- and 56-kD CPD photolyases were present in the crude extract and therefore were not an artifact of purification.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. A, Western-blot analysis of CPD photolyase contained in each crude extract prepared from leaves of wild-type and transgenic rice plants. The crude extract was subjected to SDS-PAGE using a 7.5% SDS-polyacrylamide gel and detected by western-blot analysis using anti-rice CPD photolyase antiserum as a probe. Lane 1, Wild-type ‘Sasanishiki’; lane 2, transgenic rice plant. B, Detection of phosphorylated protein by Pro-Q Diamond phosphoprotein gel stain. Electrophoresis was performed using a 7.5% SDS-polyacrylamide gel. The gel was stained with Pro-Q Diamond phosphoprotein gel stain, which stains phosphorylated proteins (top). After detection of the phosphorylated proteins, the gel was stained with SYPRO Ruby protein gel stain, which stains all proteins (bottom). Lane 1, Purified native rice CPD photolyase; lane 2, E. coli-expressed rice CPD photolyase. Positions indicate molecular sizes at 54 and 56 kD. C, SDS-PAGE analysis of CPD photolyase treatment with {lambda}-PPase. The purified native rice CPD photolyase (lanes 1–3) and the E. coli-expressed CPD photolyase (lanes 4–6) were incubated with (lanes 2, 3, 5, and 6) or without (lanes 1 and 4) {lambda}-PPase as described in "Materials and Methods." EDTA (50 mM) was added to inhibit the activity of {lambda}-PPase (lanes 3 and 6). The reaction mixture was subjected to SDS-PAGE using a 7.5% SDS-polyacrylamide gel and stained with silver stain. [See online article for color version of this figure.]

 
The S-C plant was constructed by transferring the cDNA sequence of CPD photolyase (Hidema et al., 2007Go). The presence of the 54- and 56-kD CPD photolyase western blot using the transgenic plant therefore suggested that the difference between the two forms was not due to alternative splicing, but rather might be due to posttranslational modifications, such as phosphorylation. The phosphorylation of proteins is a well-known posttranslational modification that can sometimes cause a slower migrating band on SDS-PAGE. To determine whether the native rice CPD photolyase was phosphorylated, SDS-PAGE was performed on the native rice CPD photolyase, following by staining with Pro-Q Diamond phosphoprotein gel stain, which stains specifically phosphorylated protein. The 56-kD CPD photolyase was stained specifically (Fig. 3B, lane 1). Furthermore, to obtain further evidence, we used {lambda}-protein phosphatase ({lambda}-PPase), an enzyme that removes a phosphate from phosphorylated Ser, Thr, and Tyr residues in substrate proteins. When we treated native rice CPD photolyase with {lambda}-PPase and performed SDS-PAGE, the 56-kD band disappeared and the intensity of the 54-kD band increased (Fig. 3C, lane 2). In contrast, the band pattern of the E. coli-expressed rice CPD photolyase did not change after treatment with {lambda}-PPase (Fig. 3C, lane 5). The disappearance of the 56-kD band of the native rice CPD photolyase was inhibited about 95% by 50 mM EDTA, which inhibits the activity of {lambda}-PPase (Fig. 3C, lane 3). These results strongly indicate that the native rice CPD photolyase is phosphorylated, whereas the E. coli-expressed rice CPD photolyase is not.


CPD Photorepair Activity of the Native Rice CPD Photolyase

To investigate whether phosphorylation affects the CPD photolyase activity, we measured the activity of the purified native rice CPD photolyase and the E. coli-expressed rice CPD photolyase. We first obtained dose-response curves for CPD photorepair after exposure to varying amounts of monochromatic 400-nm light. The initial CPD level was adjusted to 150 CPD Mb–1 for each measurement and each reaction mixture contained 1 ng µL–1 enzyme protein. The repair of CPDs increased linearly with increases in the fluence of the 400-nm light (Fig. 4A ). The CPD photorepair activity of the native rice CPD photolyase was significantly higher than that of the E. coli-expressed rice CPD photolyase: The level of CPD repair with exposure to 600 J m–2 in the native rice CPD photolyase was about 121 ± 8 CPD Mb–1 and that in the E. coli-expressed rice CPD photolyase was about 32 ± 8 CPD Mb–1. Next, we examined the wavelength dependence of CPD photorepair by varying wavelength at 10-nm intervals from 360 to 500 nm while holding the fluence constant at 600 J m–2. In this experiment, the extent of CPD repair following exposure to each wavelength increased linearly with an increase in fluence (data not shown). At every wavelength examined, the CPD photorepair activity of the native rice CPD photolyase was higher than that of the E. coli-expressed rice CPD photolyase (Fig. 4B). The maximal effectiveness of photorepair activity in both the purified native rice CPD photolyase and the E. coli-expressed CPD photolyase occurred at wavelengths between 390 and 400 nm.


Figure 4
View larger version (13K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. The CPD photorepair activity of the purified native rice CPD photolyase and the E. coli-expressed rice CPD photolyase. A, Dose-response curves for CPD photorepair by irradiation with monochromatic light at 400 nm. The purified native rice CPD photolyase (black circles) or the E. coli-expressed rice CPD photolyase (white circles) was mixed with UV-irradiated {lambda}DNA, incubated in the dark for 15 min at 25°C, and then irradiated with various doses of monochromatic light at 400 nm. Initial CPD levels were 150 CPD Mb–1. B, Dependence on wavelength for CPD photorepair ability. The purified native rice CPD photolyase (black circles) or the E. coli-expressed rice CPD photolyase (white circles) was mixed with UV-irradiated {lambda}DNA, incubated in the dark for 15 min at 25°C, and then irradiated with 600 J m–2 monochromatic light varying in wavelength from 360 to 500 nm in 10-nm steps. Initial CPD levels were 150 CPD Mb–1. Points represent the mean ± SD of at least three samples.

 

Chromophore Component of the Native Rice CPD Photolyases

To determine whether the higher CPD photorepair activity of the native rice CPD photolyase was due to different chromophore components, we measured the absorption, emission, and excitation spectra of the purified native rice CPD photolyase and the E. coli-expressed rice CPD photolyase. The absorption spectra of the E. coli-expressed rice CPD photolyase contained peaks around 375 and 450 nm, as did the spectra of its denatured protein supernatant (Fig. 5A ). Reduction of the denatured protein supernatant of the E. coli-expressed rice CPD photolyase with hydrosulfite abolished the absorption peaks around 450 nm. The excitation spectra of the E. coli-expressed rice CPD photolyase and its denatured protein supernatant showed peaks around 375 and 450 nm when the emission was held constant at 530 nm (Fig. 5C), and their emission spectra showed a peak around 525 nm when the excitation was held constant at 370 nm (Fig. 5E). This confirmed that the E. coli-expressed rice CPD photolyase contained an FAD chromophore, as has been reported elsewhere (Hirouchi et al., 2003Go). In contrast, the absorption spectrum of the native rice CPD photolyase showed a main peak at around 400 nm, with a shoulder between 440 and 500 nm (Fig. 5B), whereas that of the denatured protein supernatant showed peaks around 375 and 450 nm; the 450-nm peak disappeared after reduction with hydrosulfite. The excitation spectrum of the denatured protein supernatant of the native rice CPD photolyase showed peaks around 375 and 450 nm when emission was at 530 nm (Fig. 5D), and the emission spectrum showed a peak around 525 nm when excitation was at 370 nm (Fig. 5F). These results indicate that the native rice CPD photolyase also contained an FAD chromophore. The excitation spectrum of the native rice CPD photolyase contained a peak around 395 nm when the emission was at 530 (Fig. 5D) or 455 nm (data not shown). The emission spectrum of the native rice CPD photolyase showed a peak at 455 nm when excitation was at 370 (Fig. 5F) or 395 nm (data not shown), but no peak was observed beyond 500 nm. This suggests that, in addition to the FAD chromophore, the native rice CPD photolyase also contains a pterin-like chromophore with an excitation peak around 395 nm, but the E. coli-expressed rice CPD photolyase does not.


Figure 5
View larger version (26K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Absorption (A and B), excitation (C and D), and emission (E and F) spectra of the E. coli-expressed rice CPD photolyase (A, C, and E) and the purified native rice CPD photolyase (B, D, and F). Each type of CPD photolyase was boiled for 5 min and centrifuged at 20,000g for 5 min. The denatured protein supernatant was used for measurement. The excitation spectrum was measured with the emission held constant at 530 nm. The emission spectrum was obtained with excitation held constant at 370 nm. Solid line, Undenatured protein; dotted line, denatured protein supernatant; broken line, denatured protein supernatant reduced by hydrosulfite.

 

Binding Activity of the Native Rice CPD Photolyase to a CPD

To determine whether the native rice CPD photolyase and the E. coli-expressed rice CPD photolyase have different activity for binding to CPDs, we performed an electrophoretic mobility shift assay. A constant amount of oligonucleotide containing or not containing a thymine dimer was incubated with increasing amounts of CPD photolyase. When the oligonucleotide containing the thymine dimer was used, the shifted band increased with increasing amounts of both the purified native rice CPD photolyase (Fig. 6 , lanes 1–3) and the E. coli-expressed rice CPD photolyase (Fig. 6, lanes 4–6). However, the intensity of the shifted band was stronger with the native rice CPD photolyase (80% and 95% shifted for 100 and 150 ng protein, respectively; Fig. 6, lanes 1–3) than with the E. coli-expressed rice CPD photolyase (27% and 51% shifted for 100 and 150 ng protein, respectively; Fig. 6, lanes 4–6). No band shift was detected when the oligonucleotide not containing a thymine dimer was used (Fig. 6, lanes 7–12), indicating that both CPD photolyases bound specifically to the thymine dimer.


Figure 6
View larger version (89K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. Electrophoretic mobility shift assay for detecting binding activity of the CPD photolyase to a thymine dimer. Duplex DNA containing (lanes 1–6) or not containing (lanes 7–12) a thymine dimer was incubated with increasing amounts of the purified native rice CPD photolyase (lanes 1–3 and 7–9) and the E. coli-expressed CPD photolyase (lanes 4–6 and 10–12). Electrophoresis was performed using a 10% nondenatured polyacrylamide gel.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The CPD photolyase binds to CPD and forms a CPD-enzyme complex. Following absorption of a photon of blue/UVA light, the dimer is converted to two monomer pyrimidines and the enzyme is released (Rupert, 1962Go). We exploited this reaction mechanism in the final purification step to purify CPD photolyase. Active CPD photolyase was bound to CPDs in DNA conjugated to magnetic beads, the CPD photolyase was released from the DNA by irradiation with blue light, and the beads were then removed with a magnet. The remaining supernatant showed significantly higher CPD photorepair activity and the purity was increased about 100-fold relative to the fraction obtained with the previous purification step (heparin affinity chromatography), and was increased 8,100-fold relative to the crude extract (Table I). We therefore believe that this method is highly suitable for the purification of CPD photolyase.

Western-blot analysis using anti-rice CPD photolyase antiserum (Fig. 2A) and MALDI-TOF MS analysis (Table II) suggested that both the 54- and 56-kD proteins found in the final purified fraction were CPD photolyase. Both 54- and 56-kD CPD photolyases were confirmed to be involved in the crude extracts prepared from leaves of wild-type ‘Sasanishiki’ plants and transgenic ‘Sasanishiki’ plants overexpressing CPD photolyase (S-C plants; Fig. 3A). In addition, both bands were present in the crude extracts and the band intensities were constant, regardless of the presence of protease inhibitors in the homogenate buffer used for the preparation of crude extract (data not shown). Furthermore, Pro-Q Diamond phosphoprotein gel staining analysis (Fig. 3B) and a phosphatase treatment experiment (Fig. 3C) indicated that the 56-kD native rice CPD photolyase was phosphorylated, but the addition of phosphatase inhibitors to the homogenate buffer did not change the band intensities of the 54- and 56-kD CPD photolyases in the crude extract (data not shown). These results suggest that the 54-kD CPD photolyase is not a degraded and dephosphorylated product artificially during the purification process because both 54- and 56-kD CPD photolyase exist in vivo. Furthermore, according to the MALDI-TOF MS analysis, two tryptic peptides were hypothesized to be modified with one molecule of phosphate (peak nos. 6 and 15; Table II). To investigate whether each peptide is phosphorylated, we tried to recover the phosphorylated peptides from tryptic peptide mixtures of the 56-kD CPD photolyase using a titanium dioxide microcolumn (Glygen), which has a high affinity to phosphate (Larsen et al., 2005Go), and then the recovered peptides were analyzed by MALDI-TOF MS. As a result, the relative abundance of one peptide that corresponds to peak 6 (SVDAFLEELVVR; at position 312–323) was dramatically increased (data not shown). The Ser residue at position 312 thus might be phosphorylated. This possibility and the biochemical and physiological functions of phosphorylated CPD photolyase will be solved in the near future.

The purified native rice CPD photolyase had significantly higher CPD photorepair activity than the E. coli-expressed rice CPD photolyase (Fig. 4A). According to the absorption, emission, and excitation spectra, the purified native rice CPD photolyase possesses both pterin-like and FAD chromophores, whereas the E. coli-expressed rice CPD photolyase does not have the pterin-like chromophore (Fig. 5). Reconstituted E. coli CPD photolyase with two chromophores, MTHF and FAD, has higher activity than another reconstituted E. coli CPD photolyase with one chromophore, FAD (Jorns et al., 1990Go). Thus, the presence of two chromophores, a pterin-like and an FAD, in the native rice CPD photolyase could be one cause of the higher activity of the native rice CPD photolyase. Furthermore, the native rice CPD photolyase bound to thymine dimers with higher activity than the E. coli-expressed rice CPD photolyase (Fig. 6). We demonstrated previously that the CPD photolyase of rice cultivar ‘Norin 1’, which is not resistant to UV exposure, is less active than the CPD photolyase from the UV-resistant rice cultivar ‘Sasanishiki’; the ‘Norin 1’ CPD photolyase binds to CPD more slowly and thus forms an enzyme substrate complex more slowly (Hidema et al., 2000Go). Because the activity of CPD photolyase is affected by its activity for binding to CPD, the higher binding activity of the native rice CPD photolyase to thymine dimers could be another cause of the higher activity of the native rice CPD photolyase.

What caused these differences in chromophore content and binding activity between the CPD photolyases? One possibility is the heterologous expression of the rice CPD photolyase in E. coli. The E. coli CPD photolyase overexpressed in E. coli contains MTHF and FAD chromophores (Johnson et al., 1988Go), but the Arabidopsis and rice CPD photolyases overexpressed in E. coli contain only an FAD chromophore (Kleiner et al., 1999Go; Hirouchi et al., 2003Go; this article). The process of protein synthesis is different between prokaryotes and eukaryotes, and the CPD photolyase of rice may therefore not be constructed completely in E. coli. Supporting this, the E. coli-expressed CPD photolyase migrated at 55 kD, whereas the unphosphorylated native rice CPD photolyase migrated at 54 kD on SDS-PAGE and western-blot analysis (Figs. 1B and 2A). Thus, in addition to phosphorylation, there may be another modification in the native rice CPD photolyase that does not occur when it is expressed in E. coli.

Another possibility is that the higher order structure of the proteins differs. The E. coli-expressed rice CPD photolyase was recognized by an antibody raised against a peptide (PNPVVKLSKSQH) of the carboxy terminus of the rice CPD photolyase, but the purified native rice CPD photolyase protein was not (data not shown), supporting the idea that the higher order structures differ. However, it is uncertain whether such modification of the protein structure of CPD photolyase is caused by its phosphorylation. We are currently investigating this question.

Chlamydomonas has CPD photorepair activity in both the chloroplast and nucleus (Small and Greimann, 1977Go), and its class II CPD photolyase is encoded by a single gene, PHR2 (Petersen et al., 1999Go). However, mutation of the PHR1 gene, which was discovered in mutagenesis experiments and has not been isolated yet, causes deficiencies in photorepair of both chloroplast and nuclear genes (Petersen and Small, 2001Go), suggesting that PHR1 acts through some unknown mechanism to regulate CPD photolyase. The functions of many proteins are controlled by phosphorylation and many signaling cascades are mediated through protein phosphorylation, but it had not been previously reported that class I or class II CPD photolyases are phosphorylated. Our current finding in rice is thus an interesting demonstration that a class II CPD photolyase is phosphorylated, suggesting a mechanism for its regulation. The CPD photolyase is a crucial factor for determining UVB sensitivity in plants. Therefore, knowing how phosphorylation regulates CPD photolyase should be helpful for generating UV-tolerant plants.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Materials and Growth Conditions

Rice (Oryza sativa ‘Sasanishiki’) and transgenic ‘Sasanishiki’ into which a cDNA of ‘Sasanishiki’ CPD photolyase was transferred in the sense orientation (Hidema et al., 2007Go) were used in these experiments. Plants were grown in pots (23 cm x 32 cm, 5 cm high) containing fertilized soil in a large growth cabinet (Espec) with a 12-h photoperiod and day/night temperatures of 27°C/20°C for 3 weeks until the fourth leaves were fully expanded. Visible light in the growth cabinet was supplied by a combination of metal halide lamps (MT 400 L/BUD; Iwasaki Electric) and higher pressure sodium lamps (NH360DL; Iwasaki Electric). There was also a heat-absorbing filter that eliminated radiation below 350 nm (Kang et al., 1998Go). Photosynthetically active radiation (PAR) was measured using a data logger (Li-1000; LI-COR) and an L1-190SA sensor (LI-COR). The PAR was adjusted at about 350 µmol m–2 s–1 at the top of the plants.


Purification of CPD Photolyase from Rice Leaves

All steps were carried out at 0°C to 4°C under dim red light. The protein concentration was determined by the method of Bradford (1976)Go using bovine serum albumin as a standard, or estimated from the intensity of bands on SDS-polyacrylamide gels stained with SYPRO Ruby protein gel stain (Bio-Rad). The intensity was quantified with a fluoro-image analyzer (FLA-2000; Fuji Photo Film) using Escherichia coli-expressed rice CPD photolyase as a standard.

Step 1. Preparation of Crude Extract
About 20 g of the fourth leaves was homogenized with 100 mL buffer A (160 mM potassium phosphate [pH 7.2], 5 mM EDTA, 2 mM dithiothreitol [DTT], and 10% [v/v] glycerol) in a chilled mortar and pestle. The homogenate was centrifuged at 27,000g for 30 min at 4°C and the supernatant was used as a crude extract (fraction 1).

Step 2. Ammonium Sulfate Precipitation
Ammonium sulfate solution (43.4 mL, 100% saturated) was added to 100 mL of fraction 1 with magnetic stirring to a final concentration of ammonium sulfate of about 40% saturation. The mixture was subjected to centrifugation at 27,000g for 30 min at 4°C and the precipitate was removed. Ammonium sulfate (38.4 g) was added to 140 mL of the supernatant with gentle magnetic stirring to a final concentration of ammonium sulfate of about 75% saturation, and the mixture was centrifuged at 27,000g for 30 min at 4°C. The protein precipitate was dissolved in 30 mL buffer A and dialyzed overnight against buffer B (40 mM potassium phosphate [pH 7.2], 5 mM EDTA, 2 mM DTT, 10% [v/v] glycerol, and 80 mM NaCl) to create fraction 2.

Step 3. Anion Exchange Chromatography
Fraction 2 (35 mL) was loaded onto an UNO-Q12 anion-exchange column (1.5 x 6.8 cm; Bio-Rad) and eluted with buffer B at a flow rate of 2 mL min–1. CPD photolyase was recovered in the flow-through fraction (fraction 3). Proteins bound to the UNO-Q12 anion-exchange column were eluted with buffer C (40 mM potassium phosphate [pH 7.2], 5 mM EDTA, 2 mM DTT, 10% [v/v] glycerol, and 1 M NaCl) at a flow rate of 2 mL min–1. The eluted proteins were dialyzed overnight against buffer B.

Step 4. Heparin Affinity Chromatography
Fraction 3 (60 mL) was applied to a heparin affinity column (1.2 x 10 cm; GE Healthcare UK) and eluted with buffer B at a flow rate of 1 mL min–1. Protein bound to the column was eluted with buffer C at a flow rate of 1 mL min–1. The eluted protein was dialyzed overnight against buffer B. CPD photolyase was recovered in this fraction (fraction 4).

Step 5. Purification by UV-Irradiated DNA-Conjugated Magnetic Beads
A 5'-biotinylated 42-mer (GATCATGCACGCGTGTATACACATTAGTACGTCTGGCGCCAT) and a complementary unmodified 42-mer (ATGGCGCCAGACGTACTAATGTGTATACACGCGTGCATGATC) were synthesized by Kurabo Industries. The 5'-biotinylated oligonucleotide (50 nmol mL–1 in 1x Tris-EDTA [TE] buffer [10 mM Tris-HCl, pH 8.0, and 1 mM EDTA]) was irradiated with 10 W m–2 s–1 of 254-nm radiation (germicidal lamp; Toshiba) for 3 h. After the UV irradiation, the CPD-containing DNA was mixed with the same amount of complementary oligonucleotide. The DNA mixture was boiled for 5 min and allowed to anneal by cooling slowly to room temperature. Annealed double-stranded DNA (600 pmol) was conjugated to 1 mg streptavidin-coated magnetic beads (MAGNOTEX-SA; TaKaRa). Fraction 4 (5 mL) was mixed with 1 mL of 20 mg mL–1 UV-irradiated DNA conjugated to magnetic beads at 4°C for 1 h. The beads were collected with a magnet, washed five times with 1 mL of buffer B, and suspended in 0.5 mL of buffer B. The suspension was dispensed into a 24-well plate (BD Biosciences) and exposed to 50 µmol m–2 s–1 blue light (blue fluorescent tube, 20B-F; Toshiba) for 30 min at 25°C with gentle shaking. The beads were then collected with a magnet. CPD photolyase was recovered in the remaining supernatant (fraction 5).


Purification of the E. coli-Expressed Rice CPD Photolyase

The plasmid pGEXOsCPD was constructed as previously described (Hirouchi et al., 2003Go). This plasmid encodes an N-terminal fusion of glutathione S-transferase containing a thrombin protease recognition site to CPD photolyase derived from a cDNA sequence from rice cultivar ‘Sasanishiki’. The E. coli strain KY20 (JM107 + phr20::Kan) was transformed with pGEXOsCPD and grown as previously described (Hirouchi et al., 2003Go). All subsequent steps were carried out at 0°C to 4°C under dim red light. Cells were harvested and resuspended in buffer B and disrupted by sonication for 30 min. The cell sonicates were centrifuged at 27,000g for 30 min at 4°C, and the supernatant was collected and loaded onto a Glutathione-Sepharose 4B column (1 x 5 cm, containing 5 mL resin; GE Healthcare UK). The column was washed with buffer B. The outlet of the column was then closed and buffer B containing 10 units mL–1 thrombin protease was added. The column was closed at the top and incubated at 25°C for 12 h. After protease digestion, the solution, including CPD photolyase, was eluted from the column, loaded onto a heparin affinity column (GE Healthcare UK), and washed with buffer B. Proteins bound to this resin were eluted with buffer C. The eluted proteins were dialyzed overnight against buffer B. The dialyzed protein (20 µg of protein in a total volume of 5 mL of buffer B) was purified with UV-irradiated DNA-conjugated beads as described above.


SDS-PAGE and Western-Blot Analysis of CPD Photolyase

SDS-PAGE was performed using 7.5% or 12.5% (w/v) SDS-polyacrylamide gels. The proteins separated on the gels were stained with Coomassie Brilliant Blue R-250 silver stain (Daiichi Pure Chemicals), SYPRO Ruby protein gel stain (Bio-Rad), or Pro-Q Diamond phosphoprotein gel stain (Molecular Probes). The intensity of the band stained with SYPRO Ruby protein gel stain was quantified with a fluoro-image analyzer (FLA-2000; Fuji Photo Film).

Western-blot analysis was performed as follows. Proteins were separated with SDS-PAGE, transferred to a polyvinylidene difluoride membrane (Bio-Rad), and probed with an anti-rice CPD photolyase antiserum raised using purified E. coli-expressed rice CPD photolyase (Sigma-Aldrich Japan) as an antigen. The immune complex was detected by an alkaline phosphatase-conjugated anti-rabbit IgG (Sigma-Aldrich) and developed using premixed 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium solution (Bio-Rad). Primary and secondary antisera were used at 1:5,000 and 1:10,000 dilutions, respectively. The band density on the membrane was measured with a densitometer (model GS-700; Bio-Rad).


MALDI-TOF MS

The protein bands were excised from SDS-PAGE gel and dehydrated with 0.1 mL acetonitrile (ACN) by vortexing for 15 min at room temperature. ACN was discarded and the gel slices were dried with a vacuum pump and reduced with 0.1 mL reduction solution (10 mM DTT and 25 mM ammonium bicarbonate [NH4HCO3]) for 1 h at 56°C. The reduction solution was discarded. The gel slices were rinsed with 0.1 mL 25 mM NH4HCO3 solution by vortexing for 15 min at room temperature and alkylated with 0.1 mL alkylation solution (55 mM iodoacetamide and 25 mM NH4HCO3) for 45 min at room temperature. The alkylation solution was discarded. The gel slices were rinsed with 0.1 mL 25 mM NH4HCO3 solution by vortexing for 15 min at room temperature. The gel slices were then dehydrated again with 0.1 mL ACN by vortexing for 15 min at room temperature. ACN was discarded and the gel fragments were dried with a vacuum pump. The protein in the gel slices was digested with 20 µL of 25 ng µL–1 trypsin in 50 mM NH4HCO3 solution for 12 h at 37°C, and 2 µL of 1% (v/v) trifluoroacetic acid was added. The mixture was treated with a reversed-phase Zip-Tip pipette tip (Millipore) to desalt the mixture. The purified tryptic peptide mixture was mixed with {alpha}-cyano-4-hydroxycinnamic acid solution (1 mg mL–1 in 50% [v/v] ACN and 0.1% [v/v] trifluoroacetic acid), and analyzed with a MALDI-TOF Voyager mass spectrometer (Applied Biosystems). Protein identification was performed using ProteinProspector software (http://prospector.ucsf.edu) to search the National Center for Biotechnology Information nonredundant database. The following parameters were used for database searching: (1) the maximal number of missed cleavages was one; (2) Cys was treated with iodoacetamide to form carbamidomethyl-Cys; (3) Met was oxidized to Met sulfoxide; and (4) the displayed peptides were larger than 800 D. A match was considered positive when the difference in peptide mass error (delta mass) was < ±25 ppm.


Treatment with {lambda}-PPase

One hundred nanograms of the purified rice CPD photolyase or the E. coli-expressed rice CPD photolyase was reacted with 400 units of {lambda}-PPase (New England Biolabs) according to the instruction manual for 30 min at 30°C. EDTA was added to a final concentration of 50 mM to inhibit {lambda}-PPase, if needed.


Assay of CPD Photolyase Activity

The method for measuring CPD photolyase activity using UV endonuclease and alkaline agarose gel electrophoresis has been described in detail elsewhere (Hidema et al., 2000Go). Briefly, {lambda}DNA (100 mg L–1 in 0.1x TE buffer) was irradiated at 10 J m–2 of 254-nm radiation (germicidal lamp; Toshiba), resulting in 150 CPD Mb–1, which was used as the substrate. The CPD frequencies were determined using a DNA damage analysis system constructed by Tohoku Electric Industries as previously described in detail (Hidema et al., 1996Go). CPD frequencies were calculated using a molecular length standard curve and the quantity of DNA at each migration position was measured using quantitative image data (Freeman et al., 1986Go; Quaite et al., 1992Go).


Measurement of Light Quality Effective for CPD Photolyase Activity

The purified native rice CPD photolyase protein or the E. coli-expressed rice CPD photolyase protein (1 ng µL–1) were mixed with {lambda}DNA containing 150 CPD Mb–1 in a quartz cuvette (1.4 mL, light path 10 mm) and incubated in the dark for 15 min at 25°C. The mixture was then irradiated with 600 J m–2 monochromatic light at wavelengths ranging from 360 to 500 nm at 10-nm intervals, and CPD levels were measured by the method described above. A dose (I x t) was produced by using light intensities (I) of 1, 1.4, and 2 W m–2 and durations of irradiation (t) of 150, 214, 300, 429, and 600 s. The reciprocity law between I and t was valid at least up to 600 J m–2. Monochromatic light was provided by a grating monochrometer (1,200 lines mm–1 grating, CT-10; JASCO) with a 500-W xenon lamp (Ushio). The energy was measured by a vacuum thermopile (RMA-8; JASCO). When necessary, the fluence rate was adjusted with neutral density filters (Hoya Glass).


Measurement of Absorption and Fluorescence Spectra

Absorption spectra of the purified native rice CPD photolyase and the E. coli-expressed rice CPD photolyase were obtained with a spectrophotometer (JASCO V-550) and fluorescence spectra were obtained with a fluorescence spectrophotometer (JASCO FP-6500). To release the chromophores from CPD photolyase, CPD photolyase was boiled for 5 min and centrifuged at 20,000g for 5 min, and the supernatant was used for analyses.


Isotopic Labeling of DNA and Electrophoretic Mobility Shift Assay

A 30-mer oligonucleotide (CACGTACGCATCTTCTACGTACCGACAGTC) containing a centrally located thymine dimer (Iwai et al., 1994Go) was used in this experiment. Sixty picomoles of oligonucleotide containing or not containing a thymine dimer were reacted with [{gamma}-32P]ATP using T4 polynucleotide kinase (TaKaRa) for 30 min at 37°C. Unincorporated [{gamma}-32P]ATP was removed using a Sephadex G-25 column (GE Healthcare UK). The oligonucleotide was then annealed with the complementary oligonucleotide (GACTGTCGGTACGTAGAAGATGCGTACGTG) in annealing buffer (10 mM Tris-HCl [pH 8.3] and 10 mM MgCl2) by heating at 95°C for 5 min and cooling to 30°C over a 30-min period. The duplex DNA was precipitated with ethanol and resuspended in 1x TE buffer. Zero to 150 ng of the purified native rice CPD photolyase and the E. coli-expressed rice CPD photolyase was added to 0.3 pmol of the 32P-labeled DNA substrates in the binding buffer (40 mM potassium phosphate buffer, pH 7.2, 5 mM EDTA, 2 mM DTT, and 80 mM NaCl) in the dark at 25°C for 15 min. Then electrophoresis was performed in a 10% (w/v) nondenatured polyacrylamide gel. After electrophoresis, the band intensity of the radiolabeled oligonucleotides on the gel was measured with a fluoro-image analyzer (FLA-2000; Fuji Photo Film).

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number AB096003.


    ACKNOWLEDGMENTS
 
We thank Dr. Tadashi Kumagai (Graduate School of Life Sciences, Tohoku University, Japan) for valuable discussion of the manuscript and technical support for measurement of light quality effective and spectral analyses, and Dr. Atsushi Higashitani (Graduate School of Life Sciences, Tohoku University, Japan) for his helpful discussion and technical support for mass spectrometry analysis.

Received October 4, 2007; accepted January 19, 2008; published January 30, 2008.


    FOOTNOTES
 
1 This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (grant no. 16710028 to M.T. and grant nos. 19651019 and 17510037 to J.H.). Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Mika Teranishi (tera{at}ige.tohoku.ac.jp).

[C] Some figures in this article are displayed in color online but in black and white in the print edition. Back

[OA] Open Access articles can be viewed online without a subscription. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.107.110189

* Corresponding author; e-mail tera{at}ige.tohoku.ac.jp.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Bornman JF, Teramura AH (1993) Effects of ultraviolet-B radiation on terrestrial plants. In AR Young, LO Bjorn, J Moan, W Nultsch, eds, Environmental UV Photobiology. Plenum Press, New York, pp 427–471

Bradford M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72: 248–254[CrossRef][Web of Science][Medline]

Britt AB (1996) DNA damage and repair in plants. Annu Rev Plant Physiol Plant Mol Biol 47: 75–100[CrossRef][Web of Science]

Britt AB (1999) Molecular genetics of DNA repair in higher plants. Trends Plant Sci 4: 20–25[CrossRef][Web of Science][Medline]

Dai Q, Coronel VP, Vergara BS, Barnes PW, Quintos AT (1992) Ultraviolet-B radiation effects on growth and physiology of four rice cultivars. Crop Sci 32: 1269–1274[Abstract/Free Full Text]

Eker AP, Dekker RH, Berends W (1981) Photoreactivating enzyme from Streptomyces griseus-IV. On the nature of the chromophoric cofactor in Streptomyces griseus photoreactivating enzyme. Photochem Photobiol 33: 65–72[Web of Science][Medline]

Eker AP, Kooiman P, Hessels JK, Yasui A (1990) DNA photoreactivating enzyme from the cyanobacterium Anacystis nidulans. J Biol Chem 265: 8009–8015[Abstract/Free Full Text]

Freeman SE, Blackett AD, Monteleone DC, Setlow RB, Surtherland BM, Surtherland JC (1986) Quantitation of radiation-, chemical-, or enzyme-induced single strand breaks in nonradioactive DNA by alkaline gel electrophoresis: application to pyrimidine dimers. Anal Biochem 158: 119–129[CrossRef][Web of Science][Medline]

Hidema J, Kang HS, Kumagai T (1996) Differences in the sensitivity to UVB radiation of two cultivars of rice (Oryza sativa L.). Plant Cell Physiol 37: 742–747[Abstract/Free Full Text]

Hidema J, Kumagai T, Sutherland BM (2000) UV radiation-sensitive Norin 1 rice contains defective cyclobutane pyrimidine dimer photolyase. Plant Cell 12: 1569–1578[Abstract/Free Full Text]

Hidema J, Kumagai T, Sutherland JC, Sutherland BM (1997) Ultraviolet B-sensitive rice cultivar deficient in cyclobutyl pyrimidine dimer repair. Plant Physiol 113: 39–44[Abstract]

Hidema J, Taguchi T, Ono T, Teranishi M, Yamamoto K, Kumagai T (2007) Increase in CPD photolyase activity functions effectively to prevent growth inhibition caused by UVB radiation. Plant J 50: 70–79[CrossRef][Web of Science][Medline]

Hidema J, Teranishi M, Iwamatsu Y, Hirouchi T, Ueda T, Sato T, Burr B, Sutherland BM, Yamamoto K, Kumagai T (2005) Spontaneously occurring mutations in the cyclobutane pyrimidine dimer photolyase gene cause different sensitivities to ultraviolet-B in rice. Plant J 43: 57–67[CrossRef][Web of Science][Medline]

Hirouchi T, Nakajima S, Najrana T, Tanaka M, Matsunaga T, Hidema J, Teranishi M, Fujino T, Kumagai T, Yamamoto K (2003) A gene for a class II DNA photolyase from Oryza sativa: cloning of the cDNA by dilution-amplification. Mol Genet Genomics 269: 508–516[CrossRef][Web of Science][Medline]

Hoeijmakers JH (2001) Genome maintenance mechanisms for preventing cancer. Nature 411: 366–374[CrossRef][Medline]

Iwai S, Maeda M, Shimada Y, Hori N, Murata T, Morioka H, Ohtsuka E (1994) Endonuclease V from bacteriophage T4 interacts with its substrate in the minor groove. Biochemistry 33: 5581–5588[CrossRef][Web of Science][Medline]

Johnson JL, Hamm-Alvarez S, Payne G, Sancar GB, Rajagopalan KV, Sancar A (1988) Identification of the second chromophore of Escherichia coli and yeast DNA photolyases as 5,10-methenyltetrahydrofolate. Proc Natl Acad Sci USA 85: 2046–2050[Abstract/Free Full Text]

Jorns MS, Wang B, Jordan SP, Chanderkar LP (1990) Chromophore function and interaction in Escherichia coli DNA photolyase: reconstitution of the apoenzyme with pterin and/or flavin derivatives. Biochemistry 29: 552–561[CrossRef][Web of Science][Medline]

Kang HS, Hidema J, Kumagai T (1998) Effects of light environment during culture on UV-induced cyclobutyl pyrimidine dimers and their photorepair in rice (Oryza sativa L.). Photochem Photobiol 68: 71–77[Web of Science]

Kleiner O, Butenandt J, Carell T, Batschauer A (1999) Class II DNA photolyase from Arabidopsis thaliana contains FAD as a cofactor. Eur J Biochem 264: 161–167[Web of Science][Medline]

Komori H, Masui R, Kuramitsu S, Yokoyama S, Shibata T, Inoue Y, Miki K (2001) Crystal structure of thermostable DNA photolyase: pyrimidine-dimer recognition mechanism. Proc Natl Acad Sci USA 98: 13560–13565[Abstract/Free Full Text]

Kumagai T, Sato T (1992) Inhibitory effects of increase in near-UV radiation on the growth of Japanese rice cultivars (Oryza sativa L.) in a phytotron and recovery by exposure to visible radiation. Jpn J Breed 42: 545–552

Larsen MR, Thingholm TE, Jensen ON, Roepstorff P, Jorgensen TJ (2005) Highly selective enrichment of phosphorylated peptides from peptide mixtures using titanium dioxide microcolumns. Mol Cell Proteomics 4: 873–886[Abstract/Free Full Text]

Pang Q, Hays JB (1991) UV-B-inducible and temperature-sensitive photoreactivation of cyclobutane pyrimidine dimers in Arabidopsis thaliana. Plant Physiol 95: 536–543[Abstract/Free Full Text]

Park HW, Kim ST, Sancar A, Deisenhofer J (1995) Crystal structure of DNA photolyase from Escherichia coli. Science 268: 1866–1872[Abstract/Free Full Text]

Petersen JL, Lang DW, Small GD (1999) Cloning and characterization of a class II DNA photolyase from Chlamydomonas. Plant Mol Biol 40: 1063–1071[CrossRef][Web of Science][Medline]

Petersen JL, Small GD (2001) A gene required for the novel activation of class II DNA photolyase in Chlamydomonas. Nucleic Acids Res 29: 4472–4481[Abstract/Free Full Text]

Quaite FE, Sutherland BM, Sutherland JC (1992) Quantitation of pyrimidine dimers in DNA from UVB-irradiated alfalfa (Medicago sativa L.) seedlings. Appl Theor Electrophor 2: 171–175[Medline]

Rupert CS (1962) Photoenzymatic repair of ultraviolet damage in DNA. II. Formation of an enzyme-substrate complex. J Gen Physiol 45: 725–741[Abstract/Free Full Text]

Sancar A, Lindsey-Boltz LA, Unsal-Kacmaz K, Linn S (2004) Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu Rev Biochem 73: 39–85[CrossRef][Web of Science][Medline]

Small GD, Greimann CS (1977) Photoreactivation and dark repair of ultraviolet light-induced pyrimidine dimers in chloroplast DNA. Nucleic Acids Res 4: 2893–2902[Abstract/Free Full Text]

Takeuchi Y, Murakami M, Nakajima N, Kondo N, Nikaido O (1998) The photorepair and photoisomerization of DNA lesions in etiolated cucumber cotyledons after irradiation by UV-B depends on wavelength. Plant Cell Physiol 39: 745–750[Abstract/Free Full Text]

Tamada T, Kitadokoro K, Higuchi Y, Inaka K, Yasui A, de Ruiter PE, Eker AP, Miki K (1997) Crystal structure of DNA photolyase from Anacystis nidulans. Nat Struct Biol 4: 887–891[CrossRef][Web of Science][Medline]

Teramura A (1983) Effects of ultraviolet-B radiation on the growth and yield of crop plants. Physiol Plant 58: 415–427[CrossRef]

Teranishi M, Iwamatsu Y, Hidema J, Kumagai T (2004) Ultraviolet-B sensitivities in Japanese lowland rice cultivars: cyclobutane pyrimidine dimer photolyase activity and gene mutation. Plant Cell Physiol 45: 1848–1856[Abstract/Free Full Text]

Waterworth WM, Jiang Q, West CE, Nikaido M, Bray CM (2002) Characterization of Arabidopsis photolyase enzymes and analysis of their role in protection from ultraviolet-B radiation. J Exp Bot 53: 1005–1015[Abstract/Free Full Text]

Yamamoto A, Hirouchi T, Mori T, Teranishi M, Hidema J, Morioka H, Kumagai T, Yamamoto K (2007) Biochemical and biological properties of DNA photolyases derived from ultraviolet-sensitive rice cultivars. Genes Genet Syst 82: 311–319[CrossRef][Web of Science][Medline]

Yasui A, Eker AP, Yasuhira S, Yajima H, Kobayashi T, Takao M, Oikawa A (1994) A new class of DNA photolyases present in various organisms including aplacental mammals. EMBO J 13: 6143–6151[Web of Science][Medline]




This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Hitomi, L. DiTacchio, A. S. Arvai, J. Yamamoto, S.-T. Kim, T. Todo, J. A. Tainer, S. Iwai, S. Panda, and E. D. Getzoff
Functional motifs in the (6-4) photolyase crystal structure make a comparative framework for DNA repair photolyases and clock cryptochromes
PNAS, April 28, 2009; 106(17): 6962 - 6967.
[Abstract] [Full Text] [PDF]


This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrowOA All Versions of this Article:
146/4/1941    most recent
pp.107.110189v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Teranishi, M.
Right arrow Articles by Hidema, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Teranishi, M.
Right arrow Articles by Hidema, J.
Agricola
Right arrow Articles by Teranishi, M.
Right arrow Articles by Hidema, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2008 by the American Society of Plant Biologists