|
|
||||||||
|
First published online January 30, 2008; 10.1104/pp.107.110189 Plant Physiology 146:1941-1951 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
The Native Cyclobutane Pyrimidine Dimer Photolyase of Rice Is Phosphorylated1,[C],[OA]Department of Environmental Life Sciences (M.T., K.N., J.H.) and Department of Biomolecular Sciences (K.Y.), Graduate School of Life Sciences, Tohoku University, Sendai 980–8577, Japan; and Department of Analytical and Biophysical Chemistry, Faculty of Medical and Pharmaceutical Sciences, Kumamoto University, Kumamoto 862–0973, Japan (H.M.)
The cyclobutane pyrimidine dimer (CPD) is a major type of DNA damage induced by ultraviolet B (UVB) radiation. CPD photolyase, which absorbs blue/UVA light as an energy source to monomerize dimers, is a crucial factor for determining the sensitivity of rice (Oryza sativa) to UVB radiation. Here, we purified native class II CPD photolyase from rice leaves. As the final purification step, CPD photolyase was bound to CPD-containing DNA conjugated to magnetic beads and then released by blue-light irradiation. The final purified fraction contained 54- and 56-kD proteins, whereas rice CPD photolyase expressed from Escherichia coli was a single 55-kD protein. Western-blot analysis using anti-rice CPD photolyase antiserum suggested that both the 54- and 56-kD proteins were the CPD photolyase. Treatment with protein phosphatase revealed that the 56-kD native rice CPD photolyase was phosphorylated, whereas the E. coli-expressed rice CPD photolyase was not. The purified native rice CPD photolyase also had significantly higher CPD photorepair activity than the E. coli-expressed CPD photolyase. According to the absorption, emission, and excitation spectra, the purified native rice CPD photolyase possesses both a pterin-like chromophore and an FAD chromophore. The binding activity of the native rice CPD photolyase to thymine dimers was higher than that of the E. coli-expressed CPD photolyase. These results suggest that the structure of the native rice CPD photolyase differs significantly from that of the E. coli-expressed rice CPD photolyase, and the structural modification of the native CPD photolyase leads to higher activity in rice.
UVB radiation (280–320 nm) suppresses photosynthesis and protein biosynthesis, which in turn decreases growth and productivity (Teramura, 1983
CPD photolyases are categorized into two groups, class I in microorganisms and class II in higher organisms, on the basis of their deduced amino acid sequences (Yasui et al., 1994 As described above, several features of class II CPD photolyases have not been fully determined. The aims of this study were to purify CPD photolyase from leaves of rice and to investigate some of the biochemical properties of this native class II CPD photolyase.
Purification of CPD Photolyase from Rice Leaves We purified CPD photolyase from leaves of rice cultivar Sasanishiki using a multistep process (Table I ). The specific enzyme activity of the crude extract prepared from leaves (fraction 1) was 16.7 CPD Mb–1 min–1 mg protein–1. The fold purification reported for this experiment was based on this value. In the second step, the CPD photolyase protein in fraction 1 was salted out with ammonium sulfate between 40% and 75% saturation (fraction 2). The specific enzyme activity of fraction 2 was 1.6-fold higher than that of fraction 1. At the next step, fraction 2 was loaded onto an UNO-Q12 anion-exchange column. The enzyme activity was recovered in the flow-through fraction of the UNO-Q12 column (fraction 3), and the specific enzyme activity was elevated 4-fold. Then, fraction 3 was subjected to heparin affinity column chromatography. The enzyme activity was recovered in the bound fraction of the heparin affinity column (fraction 4), and the specific enzyme activity was elevated 82-fold. Finally, fraction 4 was mixed with UV-irradiated DNA-conjugated magnetic beads. After the unbound protein was removed, the magnetic beads mixture was irradiated with 50 µmol m–2 s–1 blue light for 30 min with gentle stirring. The magnetic beads were then precipitated by magnetic separation. The enzyme activity was recovered in the supernatant (fraction 5). This treatment increased the purity of the enzyme 8,100-fold. The overall yield was 58.2%, and 36 µg CPD photolyase protein was obtained from 20 g fresh leaves.
We used SDS-PAGE to profile the proteins obtained at each purification step. SDS-PAGE was performed on fractions 2 to 4 using 12.5% polyacrylamide gels, followed by staining with Coomassie Brilliant Blue R-250 (Fig. 1A ), whereas SDS-PAGE was performed on fraction 5 and E. coli-expressed rice CPD photolyase using 7.5% polyacrylamide gels and silver stain (Fig. 1B). Rubisco, the most abundant protein in the leaf, is composed of a large subunit of 53 kD and a small subunit of 12 kD. Rubisco bound to the UNO-Q12 anion-exchange column (Fig. 1A, lane 3), whereas CPD photolyase activity was recovered in the flow-through fraction of the UNO-Q12 column (Fig. 1A, lane 2). Therefore, the UNO-Q12 anion-exchange column is suitable for separating CPD photolyase from fraction 2, which included Rubisco. Fraction 4 contained many kinds of proteins (Fig. 1A, lane 5), but two proteins of 54 and 56 kD were particularly abundant in fraction 5 (Fig. 1B, lane 1). The E. coli-expressed rice CPD photolyase migrated as a single band of about 55 kD (Fig. 1B, lane 2).
Identification of the Two Proteins To identify the two proteins in fraction 5, we performed a western-blot analysis using an anti-rice CPD photolyase antiserum, which was raised against the E. coli-expressed rice CPD photolyase. Both the 54- and 56-kD proteins reacted with the anti-rice CPD photolyase antiserum (Fig. 2A , lane 1), suggesting that both proteins might be CPD photolyase. To confirm this, the 54- and 56-kD proteins were excised from an SDS-PAGE gel and analyzed by matrix-assisted laser-desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS). Both 54- and 56-kD proteins matched sequences of the polypeptide deduced from the CPD photolyase gene of the rice cultivar Sasanishiki (DNA Data Bank of Japan/EMBL/GenBank databases, accession no. AB096003; Table II ). This confirmed that both the 54- and 56-kD proteins were forms of the CPD photolyase.
CPD photolyase is released from DNA containing CPDs after the CPDs are repaired. To test whether the 54- and 56-kD proteins were active CPD photolyases and would be released from CPD-conjugated magnetic beads in a dose-dependent manner by exposure to blue radiation, we exposed the magnetic beads mixture with fraction 4 to various regimens of blue light and then performed a western-blot analysis. The amount of the two proteins released from the magnetic beads increased with the duration of exposure to blue light, up to 30 min (Fig. 2B), but release did not occur in samples kept in the dark for 120 min. The ratio of the band densities of the 54- and 56-kD proteins appeared to remain constant at all time points. Thus, both the 54- and 56-kD CPD photolyases appear to have CPD photorepair activity.
To examine whether the 54- and 56-kD CPD photolyases are present in vivo or were formed during the purification process following the preparation of the crude leaf extract, we performed a western-blot analysis of the crude extract prepared from leaves of rice cultivar Sasanishiki. Both the 54- and 56-kD CPD photolyases were observed (Fig. 3A
, lane 1), but the expression levels were low. Therefore, we tried to analyze the two isoforms by overexpressing CPD photolyase transgenic in Sasanishiki rice plants (S-C plants). The transgenic plants were constructed by transferring an additional copy of the CPD photolyase gene of the rice cultivar Sasanishiki in the sense orientation to the Sasanishiki plant (Hidema et al., 2007
The S-C plant was constructed by transferring the cDNA sequence of CPD photolyase (Hidema et al., 2007 -protein phosphatase ( -PPase), an enzyme that removes a phosphate from phosphorylated Ser, Thr, and Tyr residues in substrate proteins. When we treated native rice CPD photolyase with -PPase and performed SDS-PAGE, the 56-kD band disappeared and the intensity of the 54-kD band increased (Fig. 3C, lane 2). In contrast, the band pattern of the E. coli-expressed rice CPD photolyase did not change after treatment with -PPase (Fig. 3C, lane 5). The disappearance of the 56-kD band of the native rice CPD photolyase was inhibited about 95% by 50 mM EDTA, which inhibits the activity of -PPase (Fig. 3C, lane 3). These results strongly indicate that the native rice CPD photolyase is phosphorylated, whereas the E. coli-expressed rice CPD photolyase is not.
To investigate whether phosphorylation affects the CPD photolyase activity, we measured the activity of the purified native rice CPD photolyase and the E. coli-expressed rice CPD photolyase. We first obtained dose-response curves for CPD photorepair after exposure to varying amounts of monochromatic 400-nm light. The initial CPD level was adjusted to 150 CPD Mb–1 for each measurement and each reaction mixture contained 1 ng µL–1 enzyme protein. The repair of CPDs increased linearly with increases in the fluence of the 400-nm light (Fig. 4A ). The CPD photorepair activity of the native rice CPD photolyase was significantly higher than that of the E. coli-expressed rice CPD photolyase: The level of CPD repair with exposure to 600 J m–2 in the native rice CPD photolyase was about 121 ± 8 CPD Mb–1 and that in the E. coli-expressed rice CPD photolyase was about 32 ± 8 CPD Mb–1. Next, we examined the wavelength dependence of CPD photorepair by varying wavelength at 10-nm intervals from 360 to 500 nm while holding the fluence constant at 600 J m–2. In this experiment, the extent of CPD repair following exposure to each wavelength increased linearly with an increase in fluence (data not shown). At every wavelength examined, the CPD photorepair activity of the native rice CPD photolyase was higher than that of the E. coli-expressed rice CPD photolyase (Fig. 4B). The maximal effectiveness of photorepair activity in both the purified native rice CPD photolyase and the E. coli-expressed CPD photolyase occurred at wavelengths between 390 and 400 nm.
Chromophore Component of the Native Rice CPD Photolyases
To determine whether the higher CPD photorepair activity of the native rice CPD photolyase was due to different chromophore components, we measured the absorption, emission, and excitation spectra of the purified native rice CPD photolyase and the E. coli-expressed rice CPD photolyase. The absorption spectra of the E. coli-expressed rice CPD photolyase contained peaks around 375 and 450 nm, as did the spectra of its denatured protein supernatant (Fig. 5A
). Reduction of the denatured protein supernatant of the E. coli-expressed rice CPD photolyase with hydrosulfite abolished the absorption peaks around 450 nm. The excitation spectra of the E. coli-expressed rice CPD photolyase and its denatured protein supernatant showed peaks around 375 and 450 nm when the emission was held constant at 530 nm (Fig. 5C), and their emission spectra showed a peak around 525 nm when the excitation was held constant at 370 nm (Fig. 5E). This confirmed that the E. coli-expressed rice CPD photolyase contained an FAD chromophore, as has been reported elsewhere (Hirouchi et al., 2003
Binding Activity of the Native Rice CPD Photolyase to a CPD To determine whether the native rice CPD photolyase and the E. coli-expressed rice CPD photolyase have different activity for binding to CPDs, we performed an electrophoretic mobility shift assay. A constant amount of oligonucleotide containing or not containing a thymine dimer was incubated with increasing amounts of CPD photolyase. When the oligonucleotide containing the thymine dimer was used, the shifted band increased with increasing amounts of both the purified native rice CPD photolyase (Fig. 6 , lanes 1–3) and the E. coli-expressed rice CPD photolyase (Fig. 6, lanes 4–6). However, the intensity of the shifted band was stronger with the native rice CPD photolyase (80% and 95% shifted for 100 and 150 ng protein, respectively; Fig. 6, lanes 1–3) than with the E. coli-expressed rice CPD photolyase (27% and 51% shifted for 100 and 150 ng protein, respectively; Fig. 6, lanes 4–6). No band shift was detected when the oligonucleotide not containing a thymine dimer was used (Fig. 6, lanes 7–12), indicating that both CPD photolyases bound specifically to the thymine dimer.
The CPD photolyase binds to CPD and forms a CPD-enzyme complex. Following absorption of a photon of blue/UVA light, the dimer is converted to two monomer pyrimidines and the enzyme is released (Rupert, 1962
Western-blot analysis using anti-rice CPD photolyase antiserum (Fig. 2A) and MALDI-TOF MS analysis (Table II) suggested that both the 54- and 56-kD proteins found in the final purified fraction were CPD photolyase. Both 54- and 56-kD CPD photolyases were confirmed to be involved in the crude extracts prepared from leaves of wild-type Sasanishiki plants and transgenic Sasanishiki plants overexpressing CPD photolyase (S-C plants; Fig. 3A). In addition, both bands were present in the crude extracts and the band intensities were constant, regardless of the presence of protease inhibitors in the homogenate buffer used for the preparation of crude extract (data not shown). Furthermore, Pro-Q Diamond phosphoprotein gel staining analysis (Fig. 3B) and a phosphatase treatment experiment (Fig. 3C) indicated that the 56-kD native rice CPD photolyase was phosphorylated, but the addition of phosphatase inhibitors to the homogenate buffer did not change the band intensities of the 54- and 56-kD CPD photolyases in the crude extract (data not shown). These results suggest that the 54-kD CPD photolyase is not a degraded and dephosphorylated product artificially during the purification process because both 54- and 56-kD CPD photolyase exist in vivo. Furthermore, according to the MALDI-TOF MS analysis, two tryptic peptides were hypothesized to be modified with one molecule of phosphate (peak nos. 6 and 15; Table II). To investigate whether each peptide is phosphorylated, we tried to recover the phosphorylated peptides from tryptic peptide mixtures of the 56-kD CPD photolyase using a titanium dioxide microcolumn (Glygen), which has a high affinity to phosphate (Larsen et al., 2005
The purified native rice CPD photolyase had significantly higher CPD photorepair activity than the E. coli-expressed rice CPD photolyase (Fig. 4A). According to the absorption, emission, and excitation spectra, the purified native rice CPD photolyase possesses both pterin-like and FAD chromophores, whereas the E. coli-expressed rice CPD photolyase does not have the pterin-like chromophore (Fig. 5). Reconstituted E. coli CPD photolyase with two chromophores, MTHF and FAD, has higher activity than another reconstituted E. coli CPD photolyase with one chromophore, FAD (Jorns et al., 1990
What caused these differences in chromophore content and binding activity between the CPD photolyases? One possibility is the heterologous expression of the rice CPD photolyase in E. coli. The E. coli CPD photolyase overexpressed in E. coli contains MTHF and FAD chromophores (Johnson et al., 1988 Another possibility is that the higher order structure of the proteins differs. The E. coli-expressed rice CPD photolyase was recognized by an antibody raised against a peptide (PNPVVKLSKSQH) of the carboxy terminus of the rice CPD photolyase, but the purified native rice CPD photolyase protein was not (data not shown), supporting the idea that the higher order structures differ. However, it is uncertain whether such modification of the protein structure of CPD photolyase is caused by its phosphorylation. We are currently investigating this question.
Chlamydomonas has CPD photorepair activity in both the chloroplast and nucleus (Small and Greimann, 1977
Plant Materials and Growth Conditions
Rice (Oryza sativa Sasanishiki) and transgenic Sasanishiki into which a cDNA of Sasanishiki CPD photolyase was transferred in the sense orientation (Hidema et al., 2007
All steps were carried out at 0°C to 4°C under dim red light. The protein concentration was determined by the method of Bradford (1976)
Step 1. Preparation of Crude Extract
Step 2. Ammonium Sulfate Precipitation
Step 3. Anion Exchange Chromatography
Step 4. Heparin Affinity Chromatography
Step 5. Purification by UV-Irradiated DNA-Conjugated Magnetic Beads
The plasmid pGEXOsCPD was constructed as previously described (Hirouchi et al., 2003
SDS-PAGE was performed using 7.5% or 12.5% (w/v) SDS-polyacrylamide gels. The proteins separated on the gels were stained with Coomassie Brilliant Blue R-250 silver stain (Daiichi Pure Chemicals), SYPRO Ruby protein gel stain (Bio-Rad), or Pro-Q Diamond phosphoprotein gel stain (Molecular Probes). The intensity of the band stained with SYPRO Ruby protein gel stain was quantified with a fluoro-image analyzer (FLA-2000; Fuji Photo Film). Western-blot analysis was performed as follows. Proteins were separated with SDS-PAGE, transferred to a polyvinylidene difluoride membrane (Bio-Rad), and probed with an anti-rice CPD photolyase antiserum raised using purified E. coli-expressed rice CPD photolyase (Sigma-Aldrich Japan) as an antigen. The immune complex was detected by an alkaline phosphatase-conjugated anti-rabbit IgG (Sigma-Aldrich) and developed using premixed 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium solution (Bio-Rad). Primary and secondary antisera were used at 1:5,000 and 1:10,000 dilutions, respectively. The band density on the membrane was measured with a densitometer (model GS-700; Bio-Rad).
The protein bands were excised from SDS-PAGE gel and dehydrated with 0.1 mL acetonitrile (ACN) by vortexing for 15 min at room temperature. ACN was discarded and the gel slices were dried with a vacuum pump and reduced with 0.1 mL reduction solution (10 mM DTT and 25 mM ammonium bicarbonate [NH4HCO3]) for 1 h at 56°C. The reduction solution was discarded. The gel slices were rinsed with 0.1 mL 25 mM NH4HCO3 solution by vortexing for 15 min at room temperature and alkylated with 0.1 mL alkylation solution (55 mM iodoacetamide and 25 mM NH4HCO3) for 45 min at room temperature. The alkylation solution was discarded. The gel slices were rinsed with 0.1 mL 25 mM NH4HCO3 solution by vortexing for 15 min at room temperature. The gel slices were then dehydrated again with 0.1 mL ACN by vortexing for 15 min at room temperature. ACN was discarded and the gel fragments were dried with a vacuum pump. The protein in the gel slices was digested with 20 µL of 25 ng µL–1 trypsin in 50 mM NH4HCO3 solution for 12 h at 37°C, and 2 µL of 1% (v/v) trifluoroacetic acid was added. The mixture was treated with a reversed-phase Zip-Tip pipette tip (Millipore) to desalt the mixture. The purified tryptic peptide mixture was mixed with
One hundred nanograms of the purified rice CPD photolyase or the E. coli-expressed rice CPD photolyase was reacted with 400 units of
The method for measuring CPD photolyase activity using UV endonuclease and alkaline agarose gel electrophoresis has been described in detail elsewhere (Hidema et al., 2000
The purified native rice CPD photolyase protein or the E. coli-expressed rice CPD photolyase protein (1 ng µL–1) were mixed with
Absorption spectra of the purified native rice CPD photolyase and the E. coli-expressed rice CPD photolyase were obtained with a spectrophotometer (JASCO V-550) and fluorescence spectra were obtained with a fluorescence spectrophotometer (JASCO FP-6500). To release the chromophores from CPD photolyase, CPD photolyase was boiled for 5 min and centrifuged at 20,000g for 5 min, and the supernatant was used for analyses.
A 30-mer oligonucleotide (CACGTACGCATCTTCTACGTACCGACAGTC) containing a centrally located thymine dimer (Iwai et al., 1994 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number AB096003.
We thank Dr. Tadashi Kumagai (Graduate School of Life Sciences, Tohoku University, Japan) for valuable discussion of the manuscript and technical support for measurement of light quality effective and spectral analyses, and Dr. Atsushi Higashitani (Graduate School of Life Sciences, Tohoku University, Japan) for his helpful discussion and technical support for mass spectrometry analysis. Received October 4, 2007; accepted January 19, 2008; published January 30, 2008.
1 This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (grant no. 16710028 to M.T. and grant nos. 19651019 and 17510037 to J.H.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Mika Teranishi (tera{at}ige.tohoku.ac.jp).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.110189 * Corresponding author; e-mail tera{at}ige.tohoku.ac.jp.
Bornman JF, Teramura AH (1993) Effects of ultraviolet-B radiation on terrestrial plants. In AR Young, LO Bjorn, J Moan, W Nultsch, eds, Environmental UV Photobiology. Plenum Press, New York, pp 427–471 Bradford M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72: 248–254[CrossRef][Web of Science][Medline] Britt AB (1996) DNA damage and repair in plants. Annu Rev Plant Physiol Plant Mol Biol 47: 75–100[CrossRef][Web of Science] Britt AB (1999) Molecular genetics of DNA repair in higher plants. Trends Plant Sci 4: 20–25[CrossRef][Web of Science][Medline] Dai Q, Coronel VP, Vergara BS, Barnes PW, Quintos AT (1992) Ultraviolet-B radiation effects on growth and physiology of four rice cultivars. Crop Sci 32: 1269–1274 Eker AP, Dekker RH, Berends W (1981) Photoreactivating enzyme from Streptomyces griseus-IV. On the nature of the chromophoric cofactor in Streptomyces griseus photoreactivating enzyme. Photochem Photobiol 33: 65–72[Web of Science][Medline] Eker AP, Kooiman P, Hessels JK, Yasui A (1990) DNA photoreactivating enzyme from the cyanobacterium Anacystis nidulans. J Biol Chem 265: 8009–8015 Freeman SE, Blackett AD, Monteleone DC, Setlow RB, Surtherland BM, Surtherland JC (1986) Quantitation of radiation-, chemical-, or enzyme-induced single strand breaks in nonradioactive DNA by alkaline gel electrophoresis: application to pyrimidine dimers. Anal Biochem 158: 119–129[CrossRef][Web of Science][Medline] Hidema J, Kang HS, Kumagai T (1996) Differences in the sensitivity to UVB radiation of two cultivars of rice (Oryza sativa L.). Plant Cell Physiol 37: 742–747 Hidema J, Kumagai T, Sutherland BM (2000) UV radiation-sensitive Norin 1 rice contains defective cyclobutane pyrimidine dimer photolyase. Plant Cell 12: 1569–1578 Hidema J, Kumagai T, Sutherland JC, Sutherland BM (1997) Ultraviolet B-sensitive rice cultivar deficient in cyclobutyl pyrimidine dimer repair. Plant Physiol 113: 39–44[Abstract] Hidema J, Taguchi T, Ono T, Teranishi M, Yamamoto K, Kumagai T (2007) Increase in CPD photolyase activity functions effectively to prevent growth inhibition caused by UVB radiation. Plant J 50: 70–79[CrossRef][Web of Science][Medline] Hidema J, Teranishi M, Iwamatsu Y, Hirouchi T, Ueda T, Sato T, Burr B, Sutherland BM, Yamamoto K, Kumagai T (2005) Spontaneously occurring mutations in the cyclobutane pyrimidine dimer photolyase gene cause different sensitivities to ultraviolet-B in rice. Plant J 43: 57–67[CrossRef][Web of Science][Medline] Hirouchi T, Nakajima S, Najrana T, Tanaka M, Matsunaga T, Hidema J, Teranishi M, Fujino T, Kumagai T, Yamamoto K (2003) A gene for a class II DNA photolyase from Oryza sativa: cloning of the cDNA by dilution-amplification. Mol Genet Genomics 269: 508–516[CrossRef][Web of Science][Medline] Hoeijmakers JH (2001) Genome maintenance mechanisms for preventing cancer. Nature 411: 366–374[CrossRef][Medline] Iwai S, Maeda M, Shimada Y, Hori N, Murata T, Morioka H, Ohtsuka E (1994) Endonuclease V from bacteriophage T4 interacts with its substrate in the minor groove. Biochemistry 33: 5581–5588[CrossRef][Web of Science][Medline] Johnson JL, Hamm-Alvarez S, Payne G, Sancar GB, Rajagopalan KV, Sancar A (1988) Identification of the second chromophore of Escherichia coli and yeast DNA photolyases as 5,10-methenyltetrahydrofolate. Proc Natl Acad Sci USA 85: 2046–2050 Jorns MS, Wang B, Jordan SP, Chanderkar LP (1990) Chromophore function and interaction in Escherichia coli DNA photolyase: reconstitution of the apoenzyme with pterin and/or flavin derivatives. Biochemistry 29: 552–561[CrossRef][Web of Science][Medline] Kang HS, Hidema J, Kumagai T (1998) Effects of light environment during culture on UV-induced cyclobutyl pyrimidine dimers and their photorepair in rice (Oryza sativa L.). Photochem Photobiol 68: 71–77[Web of Science] Kleiner O, Butenandt J, Carell T, Batschauer A (1999) Class II DNA photolyase from Arabidopsis thaliana contains FAD as a cofactor. Eur J Biochem 264: 161–167[Web of Science][Medline] Komori H, Masui R, Kuramitsu S, Yokoyama S, Shibata T, Inoue Y, Miki K (2001) Crystal structure of thermostable DNA photolyase: pyrimidine-dimer recognition mechanism. Proc Natl Acad Sci USA 98: 13560–13565 Kumagai T, Sato T (1992) Inhibitory effects of increase in near-UV radiation on the growth of Japanese rice cultivars (Oryza sativa L.) in a phytotron and recovery by exposure to visible radiation. Jpn J Breed 42: 545–552 Larsen MR, Thingholm TE, Jensen ON, Roepstorff P, Jorgensen TJ (2005) Highly selective enrichment of phosphorylated peptides from peptide mixtures using titanium dioxide microcolumns. Mol Cell Proteomics 4: 873–886 Pang Q, Hays JB (1991) UV-B-inducible and temperature-sensitive photoreactivation of cyclobutane pyrimidine dimers in Arabidopsis thaliana. Plant Physiol 95: 536–543 Park HW, Kim ST, Sancar A, Deisenhofer J (1995) Crystal structure of DNA photolyase from Escherichia coli. Science 268: 1866–1872 Petersen JL, Lang DW, Small GD (1999) Cloning and characterization of a class II DNA photolyase from Chlamydomonas. Plant Mol Biol 40: 1063–1071[CrossRef][Web of Science][Medline] Petersen JL, Small GD (2001) A gene required for the novel activation of class II DNA photolyase in Chlamydomonas. Nucleic Acids Res 29: 4472–4481 Quaite FE, Sutherland BM, Sutherland JC (1992) Quantitation of pyrimidine dimers in DNA from UVB-irradiated alfalfa (Medicago sativa L.) seedlings. Appl Theor Electrophor 2: 171–175[Medline] Rupert CS (1962) Photoenzymatic repair of ultraviolet damage in DNA. II. Formation of an enzyme-substrate complex. J Gen Physiol 45: 725–741 Sancar A, Lindsey-Boltz LA, Unsal-Kacmaz K, Linn S (2004) Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu Rev Biochem 73: 39–85[CrossRef][Web of Science][Medline] Small GD, Greimann CS (1977) Photoreactivation and dark repair of ultraviolet light-induced pyrimidine dimers in chloroplast DNA. Nucleic Acids Res 4: 2893–2902 Takeuchi Y, Murakami M, Nakajima N, Kondo N, Nikaido O (1998) The photorepair and photoisomerization of DNA lesions in etiolated cucumber cotyledons after irradiation by UV-B depends on wavelength. Plant Cell Physiol 39: 745–750 Tamada T, Kitadokoro K, Higuchi Y, Inaka K, Yasui A, de Ruiter PE, Eker AP, Miki K (1997) Crystal structure of DNA photolyase from Anacystis nidulans. Nat Struct Biol 4: 887–891[CrossRef][Web of Science][Medline] Teramura A (1983) Effects of ultraviolet-B radiation on the growth and yield of crop plants. Physiol Plant 58: 415–427[CrossRef] Teranishi M, Iwamatsu Y, Hidema J, Kumagai T (2004) Ultraviolet-B sensitivities in Japanese lowland rice cultivars: cyclobutane pyrimidine dimer photolyase activity and gene mutation. Plant Cell Physiol 45: 1848–1856 Waterworth WM, Jiang Q, West CE, Nikaido M, Bray CM (2002) Characterization of Arabidopsis photolyase enzymes and analysis of their role in protection from ultraviolet-B radiation. J Exp Bot 53: 1005–1015 Yamamoto A, Hirouchi T, Mori T, Teranishi M, Hidema J, Morioka H, Kumagai T, Yamamoto K (2007) Biochemical and biological properties of DNA photolyases derived from ultraviolet-sensitive rice cultivars. Genes Genet Syst 82: 311–319[CrossRef][Web of Science][Medline] Yasui A, Eker AP, Yasuhira S, Yajima H, Kobayashi T, Takao M, Oikawa A (1994) A new class of DNA photolyases present in various organisms including aplacental mammals. EMBO J 13: 6143–6151[Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|