|
|
||||||||
|
First published online February 8, 2008; 10.1104/pp.107.112789 Plant Physiology 146:1983-1995 (2008) © 2008 American Society of Plant Biologists A Novel WRKY Transcription Factor Is Required for Induction of PR-1a Gene Expression by Salicylic Acid and Bacterial Elicitors[C],[W]Institute of Biology, Leiden University, Clusius Laboratory, 2333 AL Leiden, The Netherlands
PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions –564 (box WK1) and –859 (box WK2). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK1 box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoter::β-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35S::NtWRKY12 and PR-1a::GUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.
R-gene-mediated recognition of pathogens by plants typically results in a hypersensitive response (HR) mediated by generation of reactive oxygen species and the increased production of salicylic acid (SA). The HR is accompanied by the induction of local and systemic expression of numerous genes involved in defense. The N-gene-mediated resistance of tobacco (Nicotiana tabacum) to infection with Tobacco mosaic virus (TMV) represents a classical model to study expression of pathogenesis-related (PR) proteins and development of systemic acquired resistance (SAR) in plant-pathogen interactions (van Loon and van Strien, 1999
Studies on expression of PR genes in Arabidopsis (Arabidopsis thaliana) and tobacco revealed the central role of protein NONEXPRESSER OF PR GENES1 (NPR1). NPR1 also mediates cross talk between the SA signaling pathway and the jasmonic acid and ethylene signaling pathways, and interacts with members of the TGA family of transcription factors that bind to activator sequence-1 (as-1) or as-1-like elements that have been identified in promoters of PR-1 genes (Durrant and Dong, 2004
Accumulating evidence indicates that WRKY proteins are involved in differential responses to biotic stresses, either as transcriptional activators or as repressors in Arabidopsis (Asai et al., 2002
We have shown that a fragment of 902 bp upstream of the transcription start site of the tobacco PR-1a gene confers inducibility to the GUS reporter gene by TMV infection and SA treatment. This inducibility involved multiple elements in the promoter fragment (van de Rhee and Bol, 1993
A Novel WRKY Factor Binds to the PR-1a Promoter
Previous studies have indicated that elements in the 902-bp tobacco PR-1a promoter are important for SA and TMV-induced expression (van de Rhee et al., 1990
Sequencing of the cDNA insert of pACT/IV-80 revealed that it corresponded to the 610 3'-terminal nucleotides of a mRNA, excluding a poly(A) track of 54 residues probably representing the 3'-terminal poly(A) tail. The cDNA corresponding to the missing 5'-part of the mRNA was obtained using RACE on total RNA from TMV-infected tobacco plants. This resulted in a stretch of 415 additional nucleotides at the 5'-end of the mRNA. The combined 5'- and 3'-sequences revealed an open reading frame for a protein of 220 amino acid residues. The insert in pACT/IV-80 encoded the C-terminal 107 amino acids of this protein. The presence of WRKY and zinc (Zn)-finger domains in the C-terminal half indicates that the protein is a member of the large group of DNA-binding WRKY proteins. Upstream of the WRKY domain, the amino acid sequence contains a stretch of basic residues, reminiscent of nuclear targeting signals. The N-terminal region is relatively rich in acidic residues and has low similarity to WRKY51 from Arabidopsis. Based on the criteria described by Eulgem et al. (2000)
Expression of the full-length NtWRKY12 protein in yeast strain Y187-IV rendered the strain independent of exogenous His (data not shown). This indicates that NtWRKY12 contains an activation domain that is able to replace the GAL4 activation domain fused to the DNA binding region of NtWRKY12 in pACT/IV-80 and to activate transcription of the His reporter gene in yeast. This strongly supports a role for NtWRKY12 as a transcription factor in tobacco. Expression of an NtWRKY12/GFP fusion construct using an alfalfa mosaic virus-based expression system (Sánchez-Navarro et al., 2001
The reverse transcription (RT)-PCR results shown in Figure 1
indicate that, like PR-1a, expression of the NtWRKY12 gene was induced in tobacco leaves by salicylate treatment and by infiltration of leaf tissue with A. tumefaciens strain LBA4404. The last type of induction probably corresponds to a PAMP-type response, similar to responses triggered by peptide patterns of conserved elicitors like bacterial flagellins or elongation factor (EF)-Tu (Felix et al., 1999
The time course of expression of the NtWRKY12 gene was studied in TMV-infected Samsun NN tobacco plants. Figure 2 shows northern blots with RNA isolated at various time points after inoculation. It is evident that in noninfected plants the gene was expressed at relatively low levels (top, lane 0). After infection with TMV, expression increased in the inoculated leaves (local) and reached a transient maximum after 1 h. At 2 h postinoculation (hpi), expression was back to the low basal level and remained low until 8 hpi. Subsequently, NtWRKY12 mRNA accumulation was slightly increased at 12 and 24 hpi and became very high at 48 h and later. The strong increase in NtWRKY12 expression coincided with the development of local lesions that first appeared at 36 hpi. Also, in the noninoculated leaves, expression increased, although with some delay and to lower levels. We have not investigated mRNA accumulation in the systemic tissues at later time points. The second image shows the TMV-induced expression pattern of the gene encoding transcription factor Myb1 (Yang and Klessig, 1996
Characterization of NtWRKY12 Binding Sites in the PR-1a Promoter The results of the yeast one-hybrid screening indicated that NtWRKY12 specifically bound to a PR-1a promoter sequence ranging from positions –605 to –513 upstream of the transcription start site. To delineate the binding site in the DNA, this region was further divided into four overlapping subfragments A to D (Fig. 3 ). With a similar approach as was used above, tetramerized versions of subfragments B and C were able to confer His independence in the yeast one-hybrid system, whereas fragments A and D were not (data not shown). This suggested that the overlap region of fragments B and C contains the NtWRKY12 binding site. This was confirmed in the one-hybrid system with mutants of subfragments B and C of which either the left halves (mutants Blm and Clm) or the right halves (mutants Brm and Crm) were mutated by changing each G to A, A to G, C to T, and T to C (e.g. compare the sequences of B and Blm in Fig. 3).
The results of the yeast one-hybrid assays were confirmed in vitro using electrophoretic mobility shift assays (EMSAs) with complementary oligonucleotides corresponding to regions C and B and a glutathione S-transferase (GST)/NtWRKY12-binding domain (BD) fusion protein expressed in E. coli. This fusion protein contained the C-terminal 111 amino acids of NtWRKY12 and was purified by glutathione-Sepharose 4B column chromatography. In the EMSA, the complementary oligonucleotides could anneal to double-stranded structures. Figure 4A , lane 1, shows a band corresponding to the labeled fragment C probe. After incubation with the GST/NtWRKY12-BD protein, part of the probe is shifted to a higher position in the gel (Fig. 4A, lane 2). When only GST protein is used, no band shift is observed (Fig. 4A, lane 3). This indicates that the NtWRKY12-BD is able to form a protein-DNA complex with fragment C. Similarly, lane 5 shows the formation of a complex of GST/NtWRKY12-BD with fragment Blm, but not with Brm (Fig. 4A, lane 7). To determine the exact location of the NtWRKY12 binding site in subfragment Blm, a scanning analysis was performed with a series of complementary oligonucleotides based on Blm, in which two adjacent base pair were changed (Fig. 3; Blm-m1–Blm-m9). The results of EMSAs with these fragments are shown in Figure 4A, lanes 8 to 27. It is evident that the lanes with mutants Blm-m3 to Blm-m6 lack a band shift and neither did the single mutants Blm-m3' and Blm-m6' (Figs. 3 and 4, lanes 29–33). This suggests that the corresponding sequence TTTTCCAC is essential for binding to the NtWRKY12-BD. Complementary oligonucleotides corresponding to fragment Blm-m1, but with the central TTTCCA sequence of the binding site changed into the consensus WRKY box TTGACC (Fig. 3; Blm-m10), were not able to compete with fragment Blm-m1 for binding of GST/NtWRKY12-BD in EMSAs (Fig. 4B, lanes 5 and 6), whereas fragment Blm-m10 alone showed no binding to GST/NtWRKY12-BD (Fig. 4B, lane 8). This indicates that NtWRKY12 does not bind to the consensus WRKY binding site. As discussed in more detail below (see "Discussion"), in NtWRKY12 the WRKY sequence is followed by the sequence GKK rather than by the sequence GQK found in WRKY factors that have been shown to bind to the consensus W box. We have expressed GST/NtWRKY12-BD with the GKK sequence mutated into GQK or GEK in E. coli (Fig. 4F), but the purified mutant proteins showed no binding in band shift assays to either the WK box in the PR-1a promoter or the consensus W box sequence (Fig. 4, C and D). Apparently, the central Lys in the GKK sequence is essential for binding of NtWRKY12 to the WK box sequence.
We have investigated whether binding to the WK box is a general feature of WRKY proteins with a GKK sequence. Therefore, the full-length GKK-containing AtWRKY51 coding sequence was expressed as a GST fusion protein in E. coli (Fig. 4G). However, this Arabidopsis WRKY was not able to bind to either the WK or the W box sequence (Fig. 4E). The faint bands visible at higher positions in the gel (Fig. 4E, lanes 2–6 and 8–12) are the result of aspecific binding because they cannot be competed by an excess of either unlabeled WK or W box. The same results were obtained with a full-length GST/AtWRKY59 fusion protein (data not shown). These results suggest that the WK box is not a general consensus binding site for GKK WRKYs. The synthetic oligonucleotides that were used for the above band shift assays contained nonpaired GTAC extensions at the 5' termini. These sticky ends allowed transient base pairing and formation of multimerized fragments, which greatly facilitated DNA-protein interaction during incubation. Annealed oligonucleotides that did not contain sticky ends at best showed only weak band shifts. Apparently, the multimers remained at least partly intact during electrophoresis and are visible as faint bands above the positions of the monomeric free probes. In several lanes, these oligomers were apparently stable enough to produce stable multiple free probe bands (Fig. 4A, lanes 14/15, 26) and even double band shifts (Fig. 4A, lane 27). The sequence TTTTCCAC also occurs at the far upstream position –859 in the PR-1a promoter (Fig. 5 ). EMSAs with annealed oligonucleotides corresponding to the region –871 to –839 confirmed also that this region of the promoter is able to bind NtWRKY12 (data not shown). The two TTTTCCAC sequences in the PR-1a promoter were named box WK1 (–564) and box WK2 (–859).
Role of NtWRKY12 and TGA1a in SA-Induced PR-1a Expression
To determine whether the NtWRKY12 binding site has functional significance for SA-induced expression of PR-1a, stably transformed transgenic tobacco plants were made containing a series of mutant PR-1a promoter::GUS constructs. In close proximity to the WK1 box (–564 to –558), the PR-1a promoter contains binding sites for transcription factors TGA1a (box as-1, –592 to –577) and Myb1 (box MBSII, –520 to –514; Fig. 5; Yang and Klessig, 1996
The number of independent, phenotypically normal transformants obtained with wild-type and mutant PR-1a promoter::GUS constructs ranged between 2 and 16. Primary transformants were analyzed at the six- to eight-leaf stage for noninduced GUS expression and for GUS activity after floating leaf discs on water and SA. The results are presented in Figure 6
. As expected, the reporter gene was constitutively expressed in 35S::GUS plants, whereas the wild-type PR-1a promoter conferred strong SA inducibility to the GUS gene. In agreement with the results of Strompen et al., (1998)
Role of NtWRKY12, TGA1a, and Myb1 Factors in Elicitor-Induced PR-1a Expression As shown in Figure 1, infiltration of tobacco leaves with A. tumefaciens results in induction of NtWRKY12 and PR-1a gene expression. Probably this expression is induced by bacterial elicitors (see "Discussion"). To study a possible role of NtWRKY12 in elicitor-induced expression of the PR-1a gene, tobacco leaves were agroinfiltrated with A. tumefaciens suspensions harboring PR-1a promoter::GUS fusions in the T-DNA vector. For these experiments, the collection of promoter mutants used in the plant transformation experiments was extended with a mutant containing an altered Myb1 binding site (mutant MBSII; see Fig. 5) and a series of double and triple mutants. In double mutants as-1/WK1, as-1/MBSII, and WK1/MBSII, two of the boxes as-1, WK1, and MBSII contain the point mutations specified in Figure 5. In the triple mutant as-1/WK1/MBSII, all three boxes are mutated.
The results are shown in Figure 7, A and B
. The relatively low GUS expression of the 35S::GUS constructs can be ascribed to the much lower density of the 35S::GUS Agrobacterium inoculum obtained in comparison to that of the PR-1a::GUS strains (approximately A600 = 0.2 versus A600 = 1, respectively). To enable a comparison of different experiments, GUS activity in leaves expressing the wild-type PR-1a::GUS construct was taken as 100%. The effects of mutations WK2, WK1, WK2/WK1,
In mutant 85, the as-1, WK1, and MBSII boxes are deleted. To analyze the role of these boxes in the 85 phenotype, we made mutants with two or all three boxes mutated. Figure 7B shows that elicitor-mediated expression of the double mutant as-1/WK1 is as low as that of the 85 mutant. The effect of the double mutation in mutant as-1/WK1 (<5% of wild-type induction) is much stronger than the combined effects of the two single mutations as-1 (no significant reduction of wild-type induction; Fig. 7A) and WK1 (40%–60% of wild-type induction; Fig. 7, A and B). This demonstrates that a synergistic action of factors binding to the as-1 and WK1 boxes is essential for elicitor-induced PR-1a promoter activity. The additional mutation of the MBSII box in triple mutant as-1/WK1/MBSII did not alter the phenotype of the as-1/WK1 mutant. Elicitor-mediated induction of the double mutants as-1/MBSII and WK1/MBSII is about 40% of the induction driven by the wild-type PR-1a promoter (Fig. 7B). The observation that expression by these double mutants is modestly reduced when compared to the single mutants as-1, WK1, and MBSII indicates that MBSII contributes to some extent to the expression driven jointly by the as-1 and WK1 boxes.
The above results indicate that NtWRKY12 plays a role in inducible PR-1a gene expression. To more directly demonstrate that NtWRKY12 functions as a positive transcriptional activator of PR-1a gene expression, Arabidopsis protoplasts were cotransfected with a plasmid containing the NtWRKY12 coding region under the control of the cauliflower mosaic virus (CaMV) 35S promoter together with a plasmid containing the GUS reporter gene cloned either behind the full-length (902 bp) wild-type PR-1a promoter or behind PR-1a promoters with mutations in the WK1 box or in both the WK1 and WK2 boxes. Similar cotransfections with a plasmid lacking the NtWRKY12 coding sequence were performed as controls. The results of these transactivation assays are shown in Figure 8 . In the presence of the NtWRKY12 plasmid, PR-1a promoter-directed GUS expression was increased approximately 4-fold in comparison to the basal level obtained in protoplasts cotransfected with the empty vector. Apparently, NtWRKY12 produced in the protoplasts activates transcription of the GUS reporter gene by the Arabidopsis transcriptional machinery. Obviously, NtWRKY12 does so, at least partly, by binding to the WK1 box because mutation of the WK1 box resulted in a reduction of GUS activity to approximately 45% of that directed by the wild-type promoter. Upon mutation of both the WK1 and the WK2 box, NtWRKY12 no longer activated reporter gene expression.
DNA Binding Site of NtWRKY12
Among the first WRKY-type DNA binding proteins that were identified was a parsley (Petroselinum crispum) transcription factor involved in expression of the Phytophthora megasperma-induced gene encoding protein PR1 (Rushton et al., 1996
A number of recent studies have suggested the involvement of Arabidopsis WRKY transcription factors in induced PR gene expression, although no direct evidence has been presented for specific WRKY-PR promoter interactions (Chen and Chen, 2002
In this article, we have identified NtWRKY12 as a WRKY-type DNA binding protein that specifically recognizes the sequence TTTTCCAC. This DNA element is located at two positions in the upstream region of the tobacco PR-1a promoter that was previously found to be important for inducible gene expression (van de Rhee et al., 1990
NtWRKY12 is the first WRKY protein to be identified that interacts with a DNA binding site different from the consensus WRKY binding site TTGAC(C/T). As far as the sequence of the conserved WRKY domain is concerned, NtWRKY12 is different from most other WRKY proteins in that it contains a Lys (K) residue instead of a Gln (Q) in the conserved domain (WRKYG[Q/K]K). This variation of the WRKY domain is conserved among other plant species. A BLASTP (http://www.ncbi.nlm.nih.gov/BLAST) search of all 796 eukaryote proteins containing one or two WRKY domains of which sequence data were present in the National Center for Biotechnology Information databases resulted in 131 sequences with high protein-protein similarity to NtWRKY12. Of these, the 28 proteins with highest similarity to NtWRKY12 all contained the WRKYGKK variant domain. The 10 most similar WRKYGKK proteins (61%–86% similarity) were from both dicotyledonous (Vitis vinifera, Brassica rapa, Glycine max) and monocotyledonous (rice [Oryza sativa]) plants. All WRKY factors shown to bind the W box element contain the GQK sequence.
Of all 72 Arabidopsis WRKY genes, the three closest homologs of NtWRKY12 are AtWRKY50, AtWRKY51, and AtWRKY59 (68%, 64%, and 59% similarity, respectively; Supplemental Fig. S3). Although the similarity between NtWRKY12 and these Arabidopsis WRKYs is mainly limited to the C-terminal halves of the proteins, they share the variant WRKYGKK domain, have approximately similar sizes, and are all induced by SA and pathogenesis (Dong et al., 2003
PAMPs are universally conserved in a class of microbes. As in animals, plants recognize elicitors derived from pathogens, such as viruses, bacteria, fungi, or oomycetes. Well-characterized elicitors that induce defense responses in plants are represented by bacterial flagellin and EF-Tu or peptides from these proteins. In Arabidopsis, the flagellin-derived peptide flg22 binds to a Leu-rich repeat-type receptor-like kinase (FLS2), which activates a mitogen-activated protein kinase (MAPK) pathway and expression of WRKY transcription factors (Gómez-Gómez, 2004
SA plays an essential role in the expression of extracellular acidic PR proteins and development of SAR after TMV infection of NN tobacco. To analyze the role of the NtWRKY12 binding sites in SA- or PAMP-mediated expression, we investigated PR-1a::GUS expression in stably or transiently transformed tobacco plants. Although mutation of the upstream WK box (WK2) had little effect on SA- or PAMP-induced GUS expression, mutation or deletion of the downstream WK box (WK1) reduced GUS expression by 50% to 60% (Figs. 6 and 7). This clearly demonstrates the important role of the NtWRKY12 binding site in SA- and PAMP-mediated PR-1a expression. The consensus WRKY binding site TTGAC(C/T) has been found in promoters of genes encoding basic vacuolar PR proteins from classes PR-1, PR-2, PR-3, and PR-5 of tobacco, but has not been identified in the PR-1a promoter. Overexpression of the tobacco MAPK kinase NtMEK2 resulted in the expression of WRKY factors binding to the consensus WRKY binding site and expression of defense genes, including those encoding basic PR proteins (Kim and Zhang, 2004
PR-1a promoter fragment IV, which was used to select NtWRKY12 in the one-hybrid screen, also contains binding sites for TGA1a and Myb1 factors (Yang and Klessig, 1996
The finding that point mutations in the as-1 and WK1 boxes in double mutant as-1/WK1 fully knocked out elicitor-mediated expression (Fig. 7B) demonstrates that TGA1a and NtWRKY12 are the major players in the regulation of PR-1a promoter activity. A comparison of the activity of this double mutant with the single mutants as-1 and WK1 revealed that TGA1a and NtWRKY12-like factors act synergistically in PR-1a gene expression. In contrast to mutant as-1/WK1, the double mutants as-1/MBSII and WK1/MBSII showed significant levels of elicitor-mediated PR-1a promoter activity (Fig. 7B). A comparison of this activity with that of the single mutants as-1, WK1, and MBSII indicates that, in addition to the major effectors TGA1a and NtWRKY12, Myb1 plays a modest role in expression of the PR-1a gene. Recently, it was shown that several structurally related WRKY proteins are able to physically interact to form homologous and heterologous complexes (Xu et al., 2006
The effect of NtWRKY12 overexpression on PR-1a promoter activity was studied by transactivation experiments in Arabidopsis protoplasts. These clearly demonstrated that NtWRKY12 acts as a transcriptional activator of PR-1a gene expression in vivo. GUS activity resulting from the expression of the wild-type PR-1a promoter::GUS gene was greatly enhanced in the presence of NtWRKY12 (Fig. 8). When the WK1 box in the promoter was mutated, GUS expression was reduced, albeit still higher than in the absence of NtWRKY12. The results presented in Figures 6 and 7 indicated that the WK2 box was less important for induction of the PR-1a promoter than the WK1 box. However, in the transactivation assay (Fig. 8), the difference in GUS expression obtained with the WK1 and WK2/WK1 mutants clearly points to a role of WK2 in NtWRKY12-mediated expression. In nonstressed tobacco, the PR-1a gene is not expressed (Figs. 1 and 2). The basal level of GUS expressed in the absence of NtWRKY12 in transfected Arabidopsis protoplasts (Fig. 8) indicates that the tobacco PR-1a promoter is recognized by the Arabidopsis transcriptional machinery. It is arguable that protoplast preparation and transfection result in a stress response that triggers a certain level of expression of stress-inducible genes, including the transfected tobacco PR-1a::GUS gene. The observation that mutation of the WK1 box results in reduced GUS expression in the absence of NtWRKY12 (Fig. 8) suggests that the WK1 box is also involved in stress-induced expression by Arabidopsis transcription factors. Whether in Arabidopsis protoplasts NtWRKY12 activates expression of the tobacco PR-1a gene alone or in combination with Arabidopsis TGA, Myb, or other transcription factors is presently unknown. Experiments are under way to further investigate this.
The NtWRKY12 binding site TTTTCCAC is remarkably similar to that of the E. coli protein DnaA (TTTTCCACA; Weigel et al., 1997
In tobacco, a TTTTCCAC box is also found 249 bp upstream of the transcription start site in the SA-inducible PR-2d gene (EMBL/GenBank accession no. X69794) and 1,012 bp upstream of the initiation codon in Sar8.2b (U64816). We have checked the occurrence of the WK box in the Arabidopsis genome. Whereas Maleck et al. (2000)
Recently, Sun et al. (2003)
In WRKY transcription factors, the WRKY consensus sequence is followed by the amino acid sequences GQK, GKK, or GEK. Factors of the GQK type have been shown to bind to the W box element (TTGAC[C/T]). We identified a tobacco WRKY factor (NtWRKY12) of the GKK type, which specifically recognized two WK boxes (WK1 and WK2; TTTTCCAC) in the promoter of the SA-inducible tobacco PR-1a gene, but failed to bind to the W box element. The central K residue in the GKK sequence was crucial for binding of NtWRKY12 to the WK box. Overexpression of NtWRKY12 in protoplasts strongly stimulated PR-1a promoter activity via functional WK1 and WK2 boxes. Synergistic interactions between NtWRKY12 and other transcription factors, particularly TGA1a, appeared to be required for maximal induction of the PR-1a promoter in planta by SA or bacterial elicitors.
Plants and Plant Treatments Tobacco (Nicotiana tabacum Samsun NN) plants were grown in growth chambers at 25°C, 60% relative humidity, with a 16/8-h photoperiod. For cDNA library cloning, 8-week-old plants were inoculated with 0.1 mL per leaf of an inoculum of 18 ng TMV/mL by rubbing the inoculum on three lightly carborundum-dusted leaves per plant after which the plants were immediately placed in a growth room at 33°C with a 16-h day/8-h night regime. After 2 d, the plants were returned to the 25°C growth room and inoculated leaves were collected after 5 h. For gene expression studies, three leaves of 8-week-old tobacco plants were inoculated with 3 ng TMV/mL and kept at 25°C. Inoculated and noninoculated leaves were sampled at different time points and immediately frozen in liquid nitrogen and stored at –80°C. Discs of 24 mm were punched out of new, fully expanded leaves of wild-type and transgenic plants and floated on water or on 1 mM sodium salicylate, pH 6.8. After 2 d, the discs were blotted dry and four 12-mm discs were punched out, transferred to Eppendorf tubes, frozen in liquid nitrogen, and stored at –80°C.
Transgenic tobacco plants containing 35S::GUS and PR-1a::GUS reporter genes were obtained through Agrobacterium tumefaciens-mediated leaf disc transformation with transgene constructs cloned into the pMOG800 transformation vector and regeneration of kanamycin-resistant shoots (Linthorst et al., 1989 Tiny punctures were made with a scalpel in the bottom epidermis of new, fully expanded leaves of 8-week-old tobacco plants, through which Agrobacterium infiltration mixtures (A600 = 1 for the PR-1a::GUS strains and A600 = 0.2 for the 35S::GUS strain) were supplied to the intercellular spaces by gentle pressure using a syringe without needle. After 2 d, 12-mm leaf discs were sampled from fully infiltrated areas adjacent to the puncture hole, transferred to Eppendorf tubes, frozen in liquid nitrogen, and stored at –80°C.
mRNA was isolated from TMV-infected tobacco 5 h after the plants were transferred from 33°C to 25°C using the PolyAtract mRNA isolation system (Promega). First-strand cDNA was synthesized on 5 µg poly(A) RNA using an XhoI-oligo(dT) linker primer and M-MLV reverse transcriptase (Promega), after which the second strand was synthesized using RNaseH and Pfu DNA polymerase (Stratagene). After ligation of EcoRI adapters and digestion with XhoI, 150 ng of the sized cDNA fraction longer than 500 bp was ligated into XhoI/EcoRI double-digested
Fragments of the tobacco PR-1a promoter corresponding to the regions –701 to –612 (region III) and –605 to –513 (region IV) relative to the transcription start site and various mutants of region IV were obtained by PCR using forward primers extended with BamHI and reverse primers extended with BglII restriction sites. This allowed convenient cloning and concatamerization of the fragments in plasmid pIC19H. Collinear tetramers were cloned in front of the His-3 gene of plasmid pHIS3N/X and subsequently the PR-1a promoter tetramer/His-3 bait constructs were cloned into pINT1 for integration into the genome of yeast (Saccharomyces cerevisiae) strain Y187 containing an auxotrophic his3 mutation (Ouwerkerk and Meijer, 2001
Screening of the cDNA library in the yeast one-hybrid system was performed essentially as described by Ouwerkerk and Meijer (2001) Tetramerized subfragments and mutations thereof of promoter fragment IV were analyzed in the one-hybrid system for their ability to confer His-independent growth in one-hybrid assays with the NtWRKY12 DNA-BD of pACT/IV-80.
The cDNA region matching the 5'-part of the mRNA corresponding to the insert of pACT/IV-80 was obtained using RACE (Boehringer) on total RNA from TMV-infected tobacco plants using primer 5'-CCTTCATATGTTGTTATCAAATAGCTGG, which is complementary to an internal region starting at position 271 of the insert of clone pACT/IV-80. Resulting clones were characterized and the clone containing the longest insert was sequenced to confirm that it corresponded to pACT/IV-80. The insert was subsequently fused to the insert of pACT/IV-80 using a common BglII site to result in clone pNtWRKY12 containing the full-length coding region of NtWRK12.
The C-terminal partial open reading frame of pACT/IV-80 (NtWRKY12-BD), mutants in which the GKK sequence was changed into GQK or GEK, and the full-length coding sequence of AtWRKY51 and AtWRKY59 were cloned in frame behind the GST open reading frame of expression vector pGEX-KG (Guan and Dixon, 1991
EMSAs were performed essentially as described by Green et al. (1989) EMSA reaction mixtures contained 0.5 µg purified protein, 3 µL 5x gel shift binding buffer [20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-HCl, pH 7.5, 0.25 mg mL–1 poly(dI-dC)xpoly(dI-dC) (Promega)] in a total volume of 14 µL. After 10-min incubation at room temperature, 1 µL containing 60,000 cpm of labeled probe was added and incubation was continued for 20 min at room temperature. The total mixture was loaded onto a 5% polyacrylamide gel in Tris-borate buffer and electrophoresed at 4°C. After electrophoresis, the gel was dried, autoradiographed, and analyzed using a Bio-Rad Phosphoimager.
Total RNA was isolated from pulverized frozen tobacco leaf tissue by phenol extraction and LiCl precipitation. Oligo(dT)-primed cDNA for PCR was obtained using M-MLV reverse transcriptase. Subsequently, PCR was performed during 25 cycles with primers corresponding to NtWRKY12 (AACACAGTTTAATCCTTAAACG, AGAACAAAGACCGAGCTTGAGATC), PR-1a (ATCCTCCATTGTTACACTGAAC, GCTTCCCAATTGGCTGCAG), and tobacco actin (TGCTAGGAGCCAGTGCAGTA, GTGATGGTGTCAGCCACACT). The products were analyzed on agarose gel.
For RNA-blot analysis, total RNA was denatured using formamide/formaldehyde, electrophoresed in 1.5% agarose gel, blotted to Hybond+ (Amersham), and hybridized to 32P-labeled cDNA probes as described previously (Brederode et al., 1991
Protoplasts were prepared from Arabidopsis (Arabidopsis thaliana) ecotype Columbia-0 cell suspensions according to Axelos et al. (1992)
When the transgenic plants had reached a size of 15 to 20 cm for each transgenic plant for each treatment (untreated, water, and SA), four leaf discs were separately assayed for GUS activity, with each data point being the average of duplicate measurements. Each leaf disc was homogenized in 0.5 mL GUS extraction buffer (Jefferson, 1987 For transient GUS expression measurements, homogenates were made of 10 pooled 12-mm discs from infiltrated areas of leaves of five independently infiltrated plants. GUS activity, normalized against protein concentration, was determined from the average of duplicate measurements per sample.
For protoplast experiments, GUS activity was determined as described (van der Fits and Memelink, 1997 Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number DQ460475.
The following materials are available in the online version of this article.
Received November 7, 2007; accepted January 31, 2008; published February 8, 2008.
The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Huub J.M. Linthorst (h.j.m.linthorst{at}biology.leidenuniv.nl).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[W] The online version of this article contains Web-only data. www.plantphysiol.org/cgi/doi/10.1104/pp.107.112789 * Corresponding author; e-mail h.j.m.linthorst{at}biology.leidenuniv.nl.
Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gómez-Gómez L, Boller T, Ausubel FM, Sheen J (2002) MAP kinase signaling cascade in Arabidopsis innate immunity. Nature 415: 977–983[CrossRef][Medline] Axelos M, Curie C, Mazzolini L, Bardet C, Lescure B (1992) A protocol for transient gene expression in Arabidopsis thaliana protoplasts isolated from cell suspension cultures. Plant Physiol Biochem 30: 123–128[Web of Science] Bol JF, Linthorst HJM, Cornelissen BJC (1990) Plant pathogenesis-related proteins induced by virus infection. Annu Rev Phytopathol 28: 113–138[Web of Science] Boller T (2005) Peptide signalling in plant development and self/non-self perception. Curr Opin Cell Biol 17: 116–122[CrossRef][Web of Science][Medline] Brederode FTh, Linthorst HJM, Bol JF (1991) Differential induction of acquired resistance and PR gene expression in tobacco by virus infection, ethephon treatment, UV light and wounding. Plant Mol Biol 17: 1117–1125[CrossRef][Web of Science][Medline] Buchel AS, Molenkamp R, Bol JF, Linthorst HJM (1996) The PR-1a promoter contains a number of elements that bind GT-1-like nuclear factors with different affinity. Plant Mol Biol 30: 493–504[CrossRef][Web of Science][Medline] Bülow L, Schindler M, Hehl R (2007) PathoPlant: a platform for microarray expression data to analyze co-regulated genes involved in plant defense responses. Nucleic Acids Res 34: 841–845 Chen C, Chen Z (2002) Potentiation of developmentally regulated plant defense response by AtWRKY18, a pathogen-induced Arabidopsis transcription factor. Plant Physiol 129: 706–716 Djamei A, Pitzschke A, Nakagami H, Rajh I, Hirt H (2007) Trojan horse strategy in Agrobacterium transformation: abusing MAPK defense signaling. Science 318: 453–456 Dong J, Chen C, Chen Z (2003) Expression profile of the Arabidopsis WRKY gene superfamily during plant defense response. Plant Mol Biol 51: 21–37[CrossRef][Web of Science][Medline] Duan MR, Nan J, Liang YH, Mao P, Lu L, Li L, Wei C, Lai L, Li Y, Su XD (2007) DNA binding mechanism revealed by high resolution crystal structure of Arabidopsis thaliana WRKY1 protein. Nucleic Acids Res 35: 1145–1154 Durrant WD, Dong X (2004) Systemic acquired resistance. Annu Rev Phytopathol 42: 185–209[CrossRef][Web of Science][Medline] Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily of transcription factors. Trends Plant Sci 5: 199–206[CrossRef][Web of Science][Medline] Eulgem T, Rushton PJ, Schmelzer E, Hahlbrock K, Somssich IE (1999) Early nuclear events in plant defence signalling: rapid gene activation by WRKY transcription factors. EMBO J 18: 4689–4699[CrossRef][Web of Science][Medline] Eulgem T, Somssich IE (2007) Networks of WRKY transcription factors in defense signaling. Curr Opin Plant Biol 10: 366–371[CrossRef][Web of Science][Medline] Felix G, Duran JD, Volko S, Boller T (1999) Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. Plant J 18: 265–276[CrossRef][Web of Science][Medline] Gómez-Gómez L (2004) Plant perception systems for pathogen recognition and defence. Mol Immunol 41: 1055–1062[CrossRef][Web of Science][Medline] Green PJ, Kay SA, Lam E, Chua NH (1989) In vitro DNA footprinting. In SB Gelvin, RA Schilperoort, eds, Plant Molecular Biology Manual B11. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 1–22 Grüner R, Pfitzner UM (1994) The upstream region of the gene for the pathogenesis-related protein 1a from tobacco responds to environmental as well as to developmental signals in transgenic plants. Eur J Biochem 220: 247–255[Web of Science][Medline] Grüner R, Strompen G, Pfitzner AJP, Pfitzner UM (2003) Salicylic acid and the hypersensitive response initiate distinct signal transduction pathways in tobacco that converge on the as-1-like element of the PR-1a promoter. Eur J Biochem 270: 4876–4886[Web of Science][Medline] Guan KL, Dixon JE (1991) Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal Biochem 192: 262–267[CrossRef][Web of Science][Medline] Jefferson R (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5: 387–405[CrossRef] Johnson C, Boden E, Arias J (2003) Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis. Plant Cell 15: 1846–1858 Journot-Catalino N, Somssich IE, Roby D, Kroj T (2006) The transcription factors WRKY11 and WRKY17 act as negative regulators of basal resistance in Arabidopsis thaliana. Plant Cell 18: 3289–3302 Kim CJ, Zhang S (2004) Activation of a mitogen-activated protein kinase cascade induces WRKY family of transcription factors and defense genes in tobacco. Plant J 38: 142–151[CrossRef][Web of Science][Medline] Kim KC, Fan B, Chen Z (2006) Pathogen-induced Arabidopsis WRKY7 is a transcriptional repressor and enhances plant susceptibility to Pseudomonas syringae. Plant Physiol 142: 1180–1192 Kunze G, Zipfel C, Robatzek S, Niehaus K, Boller T, Felix G (2004) The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell 16: 3496–3507 Kosugu S, Ohashi Y, Nakajima K, Arai Y (1990) An improved assay for β-glucuronidase in transformed cells: methanol almost completely suppresses a putative endogenous β-glucuronidase activity. Plant Sci 70: 133–140 Lebel E, Heifetz P, Thorne L, Uknes S, Ryals J, Ward E (1998) Functional analysis of regulatory sequences controlling PR-1 gene expression in Arabidopsis. Plant J 16: 223–33[CrossRef][Web of Science][Medline] Li J, Brader G, Kariola T, Palva ET (2006) WRKY70 modulates the selection of signaling pathways in plant defense. Plant J 46: 477–491[CrossRef][Web of Science][Medline] Linthorst HJM (1991) Pathogenesis-related proteins of plants. Crit Rev Plant Sci 10: 123–150 Linthorst HJM, Meuwissen RLJ, Kauffman S, Bol JF (1989) Constitutive expression of pathogenesis-related proteins PR-1, GRP, and PR-S in tobacco has no effect on virus infection. Plant Cell 1: 285–291 Liu Y, Schiff M, Dinesh-Kumar SP (2004) Involvement of MEK1 MAPKK, NTF6 MAPK, WRKY/MYB transcription factors, COI1 and CTR1 in N-mediated resistance to tobacco mosaic virus. Plant J 38: 800–809[CrossRef][Web of Science][Medline] Maeo K, Hayashi S, Kojima-Suzuki H, Morikami A, Nakamura K (2001) Role of conserved residues of the WRKY domain in the DNA-binding of tobacco WRKY family proteins. Biosci Biotechnol Biochem 65: 2428–2436[CrossRef][Medline] Maleck K, Levine A, Eulgem T, Morgan A, Schmid J, Lawton KA, Dangl JL, Dietrich RA (2000) The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nat Genet 26: 403–410[CrossRef][Web of Science][Medline] Ouwerkerk BFO, Meijer AH (2001) Yeast one-hybrid screening for DNA-protein interactions. In FM Ausubel, R Brent, RE Kingston, DD Moore, JG Seidman, JA Smith, K Struhl, eds, Current Protocols in Molecular Biology. John Wiley & Sons, Chichester, UK, pp 12.12.1–12.12.22 Robatzek S, Somssich IE (2002) Targets of AtWRKY6 regulation during plant senescense and pathogen defense. Genes Dev 16: 1139–1149 Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K, Somssich IE (1996) Interaction of elicitor-induced DNA binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO J 15: 5690–5700[Web of Science][Medline] Sánchez-Navarro J, Miglino R, Ragozzino A, Bol JF (2001) Engineering alfalfa mosaic virus RNA 3 into an expression vector. Arch Virol 146: 923–939[CrossRef][Web of Science][Medline] Schirawski J, Planchais S, Haenni AL (2000) An improved protocol for the preparation of protoplasts from an established Arabidopsis thaliana cell suspension culture and infection with RNA of a turnip yellow mosaic tymovirus: a simple and reliable method. J Virol 86: 85–94 Strompen G, Grüner R, Pfitzner UM (1998) An as-1-like motif controls the level of expression of the gene for the pathogenesis-related protein 1a from tobacco. Plant Mol Biol 37: 871–883[CrossRef][Web of Science][Medline] Sun C, Palmqvist S, Olsson H, Ahlandsberg S, Jansson C (2003) A novel WRKY transcription factor, SUSIBA2, participates in sugar signaling in barley by binding to the sugar-responsive elements of the iso1 promoter. Plant Cell 15: 2076–2092 Töpfer R, Matzeit V, Gronenborn B, Schell J, Steinbiss HH (1987) A set of plant expression vectors for transcriptional and translational fusions. Nucleic Acids Res 15: 5890 Ülker B, Somssich IE (2004) WRKY transcription factors: from DNA binding towards biological function. Curr Opin Plant Biol 7: 491–498[CrossRef][Web of Science][Medline] van de Rhee MD, Bol JF (1993) Induction of the tobacco PR-1a gene by virus infection and salicylate treatment involves an interaction of multiple regulatory elements. Plant J 3: 71–82[CrossRef][Web of Science] van de Rhee MD, van Kan JAL, González Jaén MT, Bol JF (1990) Analysis of regulatory elements involved in the induction of two tobacco genes by salicylate treatment and virus infection. Plant Cell 2: 357–366 van der Fits L, Memelink J (1997) Comparison of the activities of CaMV 35S and FMV 34S promoter derivatives in Catharanthus roseus cells transiently and stably transformed by particle bombardment. Plant Mol Biol 33: 943–946[CrossRef][Web of Science][Medline] van Loon LC, van Strien EA (1999) The families of pathogenesis-related proteins, their activities and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol 55: 85–97[CrossRef] Wang D, Amornsiripanitch N, Dong X (2006) A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. PLoS Pathog 2: e123[CrossRef][Medline] Weigel C, Schmidt A, Rückert B, Lurz R, Messer W (1997) DnaA protein binding to individual DnaA boxes in the Escherichia coli replication origin, oriC. EMBO J 16: 6574–6583[CrossRef][Web of Science][Medline] Xu X, Chen C, Fan B, Chen Z (2006) Physical and functional interactions between pathogen-induced Arabidopsis WRKY18, WRKY40, and WRKY60 transcription factors. Plant Cell 18: 1310–1326 Yamamoto S, Nakano T, Suzuki K, Shinshi H (2004) Elicitor-induced activation of transcription via W box-related cis-acting elements from a basic chitinase gene by WRKY transcription factors in tobacco. Biochim Biophys Acta 1679: 279–287[Medline] Yamasaki K, Kigawa T, Inoue M, Tateno M, Yamasaki T, Yabuki T, Aoki M, Seki E, Matsuda T, Tomo Y, et al (2005) Solution structure of an Arabidopsis WRKY DNA binding domain. Plant Cell 17: 944–956 Yang Y, Klessig DF (1996) Isolation and characterization of a tobacco mosaic virus-inducible myb oncogene homolog from tobacco. Proc Natl Acad Sci USA 93: 14972–14977 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|