Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online March 19, 2008; 10.1104/pp.107.114256

Plant Physiology 147:156-168 (2008)
© 2008 American Society of Plant Biologists

OPEN ACCESS ARTICLE
This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrowOA All Versions of this Article:
147/1/156    most recent
pp.107.114256v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, S.
Right arrow Articles by An, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S.
Right arrow Articles by An, G.
Agricola
Right arrow Articles by Lee, S.
Right arrow Articles by An, G.
DEVELOPMENT AND HORMONE ACTION

Further Characterization of a Rice AGL12 Group MADS-Box Gene, OsMADS261,[C],[W],[OA]

Shinyoung Lee, Young-Min Woo, Sung-Il Ryu, Young-Duck Shin, Woo Taek Kim2, Ky Young Park3, In-Jung Lee4 and Gynheung An*

Department of Life Science and National Research Laboratory of Plant Functional Genomics, Pohang University of Science and Technology, Pohang 790–784, Republic of Korea


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Plant MADS-box genes can be divided into 11 groups. Genetic analysis has revealed that most of them function in flowering-time control, reproductive organ development, and vegetative growth. Here, we elucidated the role of OsMADS26, a member of the AGL12 group. Transcript levels of OsMADS26 were increased in an age-dependent manner in the shoots and roots. Transgenic plants of both rice (Oryza sativa) and Arabidopsis (Arabidopsis thaliana) overexpressing this gene manifested phenotypes related to stress responses, such as chlorosis, cell death, pigment accumulation, and defective root/shoot growth. In addition, apical hook development was significantly suppressed in Arabidopsis. Plants transformed with the OsMADS26-GR (glucocorticoid receptor) fusion construct displayed those stress-related phenotypes when treated with dexamethasone. Microarray analyses using this inducible system showed that biosynthesis genes for jasmonate, ethylene, and reactive oxygen species, as well as putative downstream targets involved in the stress-related process, were up-regulated in OsMADS26-overexpressing plants. These results suggest that OsMADS26 induces multiple responses that are related to various stresses.


The MADS-box gene family encodes transcription factors with a conserved DNA-binding domain, called the MADS-box. These genes, ubiquitous in living organisms, have a wide range of functions. Plant MADS-box genes can be grouped into two evolutionary lineages (types I and II; Alvarez-Buylla et al., 2000Go; Becker and Theissen, 2003Go). When restricted to the putative functional MADS-box genes, this list includes about 100 and 70 genes in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa), respectively (Nam et al., 2004Go). Approximately 40 type II MADS-box genes each have been identified in Arabidopsis (Kofuji et al., 2003Go; Parenicova et al., 2003Go) and rice (Lee et al., 2003Go); these can be divided into 11 groups (Becker and Theissen, 2003Go; Lee et al., 2003Go; Arora et al., 2007Go).

Detailed genetic analyses have shown that, whereas some MADS-box genes are involved in reproductive organ development (being preferentially expressed in the floral organs), others are expressed in the vegetative organs, where they perform various roles in flowering-time control, vegetative growth, and root development (Becker and Theissen, 2003Go). Becker and Theissen (2003)Go have speculated that AGL12 group genes originated before the gymnosperm-angiosperm split about 300 million years ago. In northern-blot analyses, AGL12, the sole MADS-box gene from the AGL12 group in Arabidopsis, shows root-specific expression (Rounsley et al., 1995Go). Recently, AGL12 overexpression analyses of suspension cells from Catharanthus roseus have demonstrated that this gene promotes the organization of those cells into globular parenchyma-like aggregates (Montiel et al., 2007Go). Loss-of-function analyses have elucidated that AGL12 regulates root meristem cell proliferation and flowering transition (Tapia-Lopez et al., 2008Go). In addition, in situ hybridization analyses have shown that this gene is also detected in leaves and floral meristems. In rice, the AGL12 group OsMADS26 is expressed not only in the roots, but also in the shoots and panicles (Shinozuka et al., 1999Go). Pelucchi et al. (2002)Go have also observed that OsMADS26 is highly expressed in the leaves and inflorescences. Furthermore, Arora et al. (2007)Go have shown the expression of this gene in panicles and seeds. These results imply that this gene functions in a broad range of rice organs.

Some MADS-box genes are active in aging-related processes. For example, transgenic plants expressing sense AGAMOUS-LIKE15 (AGL15) inhibit senescence programs in the perianth organs and developing fruits (Fernandez et al., 2000Go; Fang and Fernandez, 2002Go). FRUITFULL (FUL), SHATTERPROOF1 (SHF1), and SHF2 are involved in differentiation within the fruit dehiscence zone (Gu et al., 1998Go; Liljegren et al., 2000Go). When a tomato (Lycopersicon esculentum) MADS-box gene that is most homologous to SHORT VEGETATIVE PHASE (SVP) is mutated, plants fail to develop abscission zones on their pedicels (Mao et al., 2000Go). Mutation in another tomato MADS-box gene, LeMADS-RIN, causes failure of fruit ripening (Vrebalov et al., 2002Go). Recently, the roles of rice SVP group MADS-box genes in senescence responses have been reported as well (Lee et al., 2008Go). Here, we report the functional roles of OsMADS26 that is up-regulated in older tissues and causes stress-related abnormalities when ectopically expressed.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Expression Patterns of OsMADS26

We used semiquantitative reverse transcription (RT)-PCR to study the expression patterns of OsMADS26 at various developmental stages (Fig. 1 ). In 5-d-old seedlings, this gene was more strongly expressed in the roots than in the shoots. Transcript levels rose as the plants aged (Fig. 1A). In the roots, transcription reached a maximum at day 10 and remained at that level in older plants. However, in the leaves, transcripts continued to increase as the plants matured. Detailed analyses at broader developmental stages showed a dramatic rise in OsMADS26 transcripts in the roots between days 6 and 9 (Fig. 1B). In contrast, transcript levels continuously increased in leaves up to day 70 (Fig. 1C). Within individual plants, expression was much stronger in the mature leaves than in young, still-developing leaves (Fig. 1D). Therefore, these results indicate that OsMADS26 is more active in older tissues.


Figure 1
View larger version (45K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Expression patterns for OsMADS26 at various developmental stages. A, Transcript levels in roots and leaf blades from 5-, 10-, 20-, and 40-d-old plants. B, Transcript levels of OsMADS26 in total roots from 3-, 6-, 9-, 25-, and 50-d-old plants. C, Transcript levels of OsMADS26 in leaf blades from 15-, 30-, 50-, 70-, and 90-d-old plants. D, Transcript levels of OsMADS26 at the first, second, fifth, and sixth positions within 35-d-old plants counted from newly emerging leaf.

 

Phenotypes of ubi:OsMADS26S Plants

To elucidate in vivo functioning, we regenerated transgenic rice plants that expressed either sense or antisense constructs of the full-length OsMADS26 cDNA. Plants that ectopically expressed the antisense OsMADS26 showed no visible phenotypic changes (data not shown). We previously identified an OsMADS26 knockout (KO) line (1A-16632) from a T-DNA tagging population via reverse screening (Lee et al., 2003Go; Ryu et al., 2004Go). In that line, T-DNA is inserted into the first intron and the OsMADS26 transcript is not present. As observed with our antisense plants in the current study, the T-DNA insertional KO plants exhibited no abnormality in their growth habit (Supplemental Fig. S1).

In contrast, primary T1 transgenic plants expressing the sense OsMADS26 transcript (ubi:OsMADS26S plants) showed several abnormal phenotypes (Fig. 2 ). Among our 50 regenerated plants, 40 died at the young stage after they manifested such traits as defective root/shoot growth (Fig. 2, A and B), chlorosis and cell death (Fig. 2, A and B), screw-like root curling (Fig. 2, C and D), and pigment accumulation in their roots (Fig. 2, B and D). The remaining 10 plants showed less severe phenotypes and survived to maturity, with the adults displaying semidwarfism (Fig. 2E), pale-green coloration (Fig. 2E), spotted leaves (Fig. 2F), and shrunken seeds (Fig. 2G). Except for three lines, most of the plants were sterile. The T2 seedlings from those fertile lines had phenotypes similar to those observed from the primary transgenic plants, including retarded root/shoot growth, screw-like root curling, and pigment accumulation (Fig. 2H).


Figure 2
View larger version (69K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Phenotypes of ubi:OsMADS26 plants. A, Cell death phenotype (arrows). B, Defective growth, chlorosis, and accumulation of purple pigment in roots. C, Regenerating root showing screw-like curling phenotype. D, Regenerating roots accumulating purple pigments. E, Mature transgenic plant displaying pale-green and dwarf phenotypes (right), compared with wild-type (WT) control (left). F, Transgenic leaves with pigmented spots (right), compared with WT control (left). G, Shrunken transgenic seed (bottom) and WT control (top). H, T2 ubi:OsMADS26 plants displaying defective growth, cell death (arrow), and pigment accumulation. I, Northern-blot analyses of T1 transgenic plants. R, Roots; S, shoots.

 
To check whether the phenotypes were induced by OsMADS26, we performed RNA gel-blot analysis of four representative lines: one that survived to maturity (Fig. 2E), two that developed roots and shoots but died at the seedling stage (Fig. 2B), and one that manifested more serious growth defects (Fig. 2A). In both roots and shoots, the levels of transgene expression were correlated with the severity of the phenotype (Fig. 2I), thereby suggesting that the phenotypes were due to OsMADS26 expression.

Because ubi:OsMADS26S plants developed phenotypes of severe growth retardation that is associated with various stresses, we tested whether this gene is regulated by signaling mediators. Wild-type plants were treated with 1 µM 1-aminocyclopropane-1-carboxylic acid (ACC), 10 µM methyl jasmonate (MJ), or 1 mM hydrogen peroxide (H2O2) beginning at the germination stage; their shoots and roots were sampled 9 d after germination. Expression levels of OsMADS26 mRNA were not significantly changed (Supplemental Fig. S2). Moreover, no alterations were noted when 10-d-old rice seedlings were exposed to these molecules for 1, 3, or 24 h. Therefore, our results suggest that this gene is not regulated by such signaling molecules at the transcriptional level.

Furthermore, we examined behavior of the OsMADS26 KO plants under various stresses. When 3-week-old plants were grown under water-deficit or high-salt (200 mM NaCl) conditions, they showed a degree of stress response similar to that of our wild-type controls (data not shown). We also investigated but found no visible phenotypic changes after treatment with 1 µM ACC, 1 mM H2O2, or 10 µM MJ (Supplemental Fig. S3).


Phenotypes of Plants Expressing the OsMADS26-GR Fusion Transcript

The phenotypes displayed by the ubi:OsMADS26 plants suggested that this gene might be involved in various stress-related processes. However, some of those characteristics may have been due to indirect effects caused by ectopic overexpression at the regeneration stage. To observe the more direct effects, we generated transgenic plants carrying the OsMADS26-GR (glucocorticoid receptor) fusion construct (ubi:OsMADS26GR plants).

Among the 32 T1 primary transgenics, 11 independent lines were examined to test whether this inducible system would be successful when plants were treated with dexamethasone (DEX). Six lines clearly showed abnormal phenotypes (Supplemental Fig. S4). For example, line 33 developed curled and shorter roots, whereas line 17 had severe growth retardation. The six confirmed lines were followed through the next generations and genotyped to obtain homozygous (HO) plants from each line. For genotyping, at least 50 T2 seedlings were tested for hygromycin resistance. If all plants survived, the lines were regarded as HO; if all died, they were considered to be wild type.

For further study, line 33 was selected and its seedlings were treated with DEX in a dose-dependent manner to determine the effective concentration. In the wild-type segregants, DEX did not induce growth defects at up to 1 µM (Fig. 3A ), whereas the transgenic plants showed growth limitations at the lowest concentration (10 nM) and severe retardation at 1 µM (Fig. 3B). Their shoots and roots were significantly shorter (Fig. 3, A and B; Supplemental Fig. S5, A and B), and purple pigments were accumulated in the transgenic roots (Fig. 3B, inset). We obtained the same results with line 17 (data not shown). To understand the nature of these shortened roots, we sectioned their maturation zones. Histological analysis showed that cell elongation was significantly inhibited in the DEX-treated plants (Fig. 3, E and F).


Figure 3
View larger version (74K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Abnormal phenotypes of ubi:OsMADS26GR plants. A and B, Effects of OsMADS26 on germinating rice seedlings. Wild-type segregants (A) and HO plants (B) were treated with DEX. Six to nine T3 plants were analyzed after growing for 9 d in Murashige and Skoog solid medium containing various concentrations of DEX. B (inset), Purple pigments accumulated only in roots of HO plants treated with 100 nM DEX. C, Effects of OsMADS26 on postgerminated rice seedlings. After growth in Murashige and Skoog liquid medium for 6 d, 1 mM DEX was treated for two consecutive days. D, Effects of OsMADS26 on mature rice. After growing for 80 d in a glasshouse, plants were treated with 10 mM DEX for 7 d. E and F, Longitudinal sections of the root maturation zones of a wild-type segregant (E) and HO plant (F). G, Chlorophyll a/b content per gram fresh weight. Each data point is an average of four or five replicates. H and I, Real-time PCR analyses of senescence-related genes Osl2 (H) and Osl52 (I) in ubi:OsMADS26GR plants. y axis represents relative values between transcript levels of target genes and ACTIN. Each data point is an average of four or five replicates.

 
The numbers of emerged roots and leaves were also reduced in DEX-treated transgenic plants in lines 33 and 17. For example, by day 9, wild-type segregants of line 33 had developed their fourth leaves and had an average total of eight to 10 roots (seminal plus nodal roots; Table I ). When HO plants of line 33 were treated with DEX, root numbers were reduced at the lowest concentration (10 nM), whereas leaf numbers were reduced in response to 100 nM DEX. However, by day 12, both wild-type and HO plants grown at 100 nM DEX had developed a similar number of leaves (about 4) and roots (about 10). These results suggest that the production of fewer roots and leaves associated with OsMADS26 overexpression was caused by a slower growth rate rather than because of defective primordia development.


View this table:
[in this window]
[in a new window]

 
Table I. Root and leaf numbers for ubi:OsMADS26GR plants treated with DEX

 
To see the direct effects of this overexpression, we applied 1 µM DEX to 6-d-old seedlings. When treated for three consecutive days, the transgenics manifested phenotypes of retarded growth, pigment accumulation by their roots, and wilting, chlorosis, and senescence in their shoots (Fig. 3C). To further understand the role of this gene in these processes, we measured chlorophyll amounts after DEX treatment. Whereas wild-type control plants did not exhibit any difference, HO plants showed a 41% decrease in chlorophyll a and a 12% decrease in chlorophyll b (Fig. 3G). We examined expression levels of two previously reported senescence-related genes, Osl2 (aminotransferase) and Osl55 (β-methylcrotonyl-CoA carboxylase; Lee et al., 2001Go). Our ubi:OsMADS26GR plants treated with DEX expressed higher levels of these genes, suggesting that the senescence process had been triggered (Fig. 3, H and I).

To study the role of OsMADS26 in mature plants, we treated 80-d-old ubi:OsMADS26GR glasshouse-grown plants with 10 µM DEX. After 7 d of treatment, abnormal phenotypes were revealed only in transgenic plants, and included curled leaves, lesions, and chlorosis (Fig. 3D). In comparison, those transgenics treated with 1 µM DEX did not show any significant abnormality. Therefore, we can conclude that the phenotypes observed in the ubi:OsMADS26 plants were clearly reenacted in our GR-inducible system, suggesting that OsMADS26 may causes plant stress.


Identification of Putative OsMADS26 Downstream Genes

To identify the OsMADS26 downstream genes, we compared genome-wide RNA expression levels between the ubi:OsMADS26GR plants and their wild-type segregants, using a 60K oligo chip. Total RNAs were prepared from the roots of 7-d-old seedlings treated with 1 µM DEX for 3 or 9 h. Two independent lines (17 and 33) were tested, which entailed four sets of microarray analyses: 17 (3 h), 17 (9 h), 33 (3 h), and 33 (9 h).

Supplemental Table S1 lists the genes that were up-regulated (146) or down-regulated (155) at least once and by a minimum of 1.5-fold in the ubi:OsMADS26GR plants. Pearson correlation coefficients between the two replicates for these 301 selected target genes were 0.745, 0.735, 0.928, and 0.923 for line 33 (3 h), line 33 (9 h), line 17 (3 h), and line 17 (9 h), respectively (Supplemental Fig. S6), indicating that line 17 generated more consistent results. When we applied a 2-fold difference as our cutoff criterion, 48 genes were identified, with respective Pearson correlation coefficients of 0.806, 0.880, 0.937, and 0.861 for line 33 (3 h), line 33 (9 h), line 17 (3 h), and line 17 (9 h). Interestingly, this standard allowed us to identify only 13 down-regulated genes compared with the isolation of 35 up-regulated genes, which implies that results fluctuated more with the former type. Our k-means clustering (KMC) analyses showed global expression patterns for these 48 genes (Fig. 4 ). All were induced or suppressed more strongly at 9 h than at 3 h. Moreover, five were induced dramatically at both 3 and 9 h (Fig. 4A), whereas 30 were weakly induced (Fig. 4B). Among the up-regulated genes, OsMADS26 was the most highly expressed (Supplemental Table S2; Fig. 4A).


Figure 4
View larger version (16K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. KMC analyses for 48 target genes showing more than 2-fold change in expression. A, Cluster-containing genes up-regulated by >4-fold on average at both 3 and 9 h. OsMADS26 is included in this cluster. B, Cluster containing genes up-regulated by <4-fold on average at both 3 and 9 h. C, Cluster containing down-regulated genes.

 
The 301 genes with at least 1.5-fold differences in expression were classified according to their functioning via the Clusters of Orthologous Groups (http://www.ncbi.nlm.nih.gov/COG) analysis (Table II ). Major up-regulated or down-regulated genes included those involved in defense mechanisms, signal transduction, posttranslational modification/protein turnover/chaperones, carbohydrate transport/metabolism, and secondary metabolite transport/metabolism. Genes belonging to three groups were changed more frequently (i.e. defense mechanisms [2.40%], inorganic ion transport and metabolism [1.02%], and secondary metabolite transport/metabolism [1.08%]). Genes related to secondary metabolites were more abundant in the up-regulated group, whereas those involved in defense were more abundant in the down-regulated group.


View this table:
[in this window]
[in a new window]

 
Table II. Functional classification of genes that are up- or down-regulated by at least 2-fold in ubi:OsMADS26GR plants treated with DEX

Relative numbers indicate the percentage of up- and down-regulated genes relative to the total genes within a category.

 

Transcript Analyses of Putative OsMADS26 Downstream Genes

We chose eight genes to examine the reliability of our microarray data (Table III ). Four iron/ascorbate family oxidoreductase genes were found in the up-regulated group and could be divided into two groups: ACC oxidase genes involved in ethylene (ET) biosynthesis (A09021902 and A05041211) and putative flavanone 3-hydroxylase genes (A05011009 and B10022103). From these, we selected one ACC oxidase gene (A09021902) and one flavanone 3-hydroxylase gene (A05011009) for further confirmation. The A05011009 protein showed high homology to GA β-hydroxylase. We also identified a lipoxygenase (LOX) gene (A09032318), an NADPH oxidase gene (B03011909), and the S-adenosyl-Met decarboxylase (SAMDC) gene (A10031622), which function in the biosyntheses of jasmonic acid (JA), reactive oxygen species (ROS), and polyamine, respectively. In addition, a MAP kinase gene (A05011217) involved in hormone signaling/biosynthesis and two harpin-induced protein genes (B05032110 and A03011404) were examined.


View this table:
[in this window]
[in a new window]

 
Table III. Partial list of putative target genes that are up- or down-regulated by at least 1.5-fold in ubi:OsMADS26GR plants treated with DEX

Spot_ID, Oligomers selected by microarray; CHR_locus, chromosomal locus given in TIGR database.

 
For semiquantitative RT-PCR analyses of these eight selected genes, 7-d-old OsMADS26GR plants and their wild-type segregants were treated with 1 µM DEX for up to 9 h and RNAs were prepared from their roots. The OsMADS26 and ACTIN genes were included as controls. As expected, OsMADS26 transcript was highly expressed in the transgenic roots, with that level increasing after DEX treatment (Fig. 5 ). Transcripts of these eight genes were induced posttreatment and showed expression patterns similar to those obtained from the microarray analyses. Therefore, these data support the reliability of the microarray results.


Figure 5
View larger version (48K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. RT-PCR analyses to confirm microarray results. After 0, 3, or 9 h of DEX treatment, roots were sampled from wild-type (WT) and ubi:OsMADDS26GR plants. gDNA controls were used to detect contamination with genomic DNA. Putative functions are indicated in the right image.

 

The Relationship between OsMADS26 and Biosynthesis Genes Associated with Stress Responses

The phenotypes observed in our ubi:OsMADS26 and ubi:OsMADS26GR plants were broadly correlated with stress responses. Microarray analyses demonstrated the up-regulation of several genes for the biosynthesis of stress-inducing molecules, such as ET, JA, ROS, and polyamine (Supplemental Table S2).

In ET biosynthesis, ACC synthase and ACC oxidase genes are the most important in mediating the final two steps. Whereas none of the ACC synthase genes was changed significantly, four ACC oxidase genes were up-regulated in three experimental sets. The JA biosynthesis genes include LOX, AOS (allene oxide synthase), AOC (allene oxide cyclase), OPR (oxo-phytodienoic acid reductase), and JMT (JA carboxyl methyltransferase; Agrawal et al., 2004Go). Our microarray analyses showed that the following JA biosynthesis genes were up-regulated: OsLOX3, OsAOS1, OsAOS4, OsAOS5, OsOPR2, OsOPR12, and OsOPR13. Among the genes involved in ROS production, NADPH oxidase gene mRNA was clearly up-regulated, whereas a gene homologous to aldehyde oxidase was down-regulated. Regarding polyamine biosynthesis, only SAMDC was up-regulated, whereas genes encoding Orn decarboxylase, Arg decarboxylase, and spermidine synthase were not changed.


Phenotypes of 35S:OsMADS26 Arabidopsis Plants

To further elucidate the role of OsMADS26, we utilized the Arabidopsis system in which expression is under the control of the cauliflower mosaic virus (CaMV) 35S promoter. Of our 105 kanamycin-resistant T1 transgenic plants (35S:OsMADS26 plants), 11 developed severe dwarfism, chlorosis, and tilted leaves (Fig. 6A ). Their growth was halted and they eventually died without developing reproductive organs. The rest of the T1 plants, which produced fertile seeds, were used for further analyses.


Figure 6
View larger version (43K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. Phenotypes of 35S:OsMADS26 Arabidopsis. All plants were grown on 0.5x Murashige and Skoog medium. A, 28-d-old T1 35S:OsMADS26 plant. B, Ten-day-old T2 35S:OsMADS26 and wild-type (WT) plants. C, Twenty-day-old T2 35S:OsMADS26 and WT plants.

 
T2 segregants of these transgenic lines were analyzed phenotypically. Among the 11 independent lines examined, those from lines 1, 8, and 11 displayed a wide range of abnormal phenotypes (Fig. 6, B and C). Generally, their plants were smaller, but had more lateral roots. Furthermore, line 1 accumulated red pigments, whereas lines 8 and 11 developed twisted leaves. Plants from line 11 were only about one-third as large as the wild type, and they showed a delayed rate of leaf emergence. OsMADS26 transcripts were detected in all the plants with abnormal phenotypes.

To determine whether the abnormal phenotypes were induced by JA, we checked the expression levels of AtMYC2, VSP, and PDF1.2 (Bell and Mullet, 1993Go; Benedetti et al., 1995Go; Penninckx et al., 1998Go; Boter et al., 2004Go; Lorenzo et al., 2004Go) whose expressions generally are induced by that compound. Our analysis showed that transcript levels for VSP were increased in the transgenic plants with medium or strong phenotypes (Supplemental Fig. S7). In contrast, PDF1.2 transcripts were down-regulated in the transgenic plants in proportion to their phenotypic severity, whereas AtMYC2 expression was unaffected. Therefore, these results suggest that OsMADS26 controls the subsets of JA-inducible genes.


Inhibition of Apical Hook Development in 35S:OsMADS26 Arabidopsis Plants

Ellis and Turner (2001)Go have reported that MJ blocks apical hook development in a dose-dependent manner, whereas ET promotes such formations. Therefore, we employed this physiology to study any possible relationship between OsMADS26 and those hormones. As previously reported, MJ induced shorter roots and hypocotyls and inhibited apical hooks, whereas ACC induced exaggerated development of the latter tissue (Fig. 7A ). Proper hooks are defined as those where the angle between hypocotyl and cotyledon is <90°. When homozygous plants were grown in the dark, 86% of the transgenics did not have properly formed hooks (Fig. 7B). Moreover, when treated with 1 µM MJ, all transgenic plants failed to develop apical hooks; ACC also did not induce drastic apical hook development. Therefore, these results suggest that some of the phenotypes observed in our OsMADS26-overproducing Arabidopsis plants are associated with MJ.


Figure 7
View larger version (37K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 7. Apical hook development. Etiolated seedlings of wild type (A) and 35S:OsMADS26 (B) were grown on 0.5x Murashige and Skoog medium, then treated with MJ and ACC at 0, 1, or 10 mM concentrations. [See online article for color version of this figure.]

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

OsMADS26 Transcript Is More Abundant in Old Tissues

OsMADS26 was the first of four rice genes identified in the AGL12 group. Its expression patterns have now been elucidated, with transcripts being detected in the roots, shoots, panicles, and inflorescences throughout all developmental stages (Shinozuka et al., 1999Go; Pelucchi et al., 2002Go). In this study, we showed that the OsMADS26 transcript level was elevated in older leaves and roots, implying that this gene may be involved in senescence or maturation processes.


Suppression of OsMADS26 Expression Does Not Cause Phenotype Alterations

Transgenic plants overexpressing the antisense OsMADS26 or the T-DNA insertional mutant showed no visible alterations in their phenotypes. We examined the KO plants under various stress conditions, such as drought, high salt, and stress mediators such as ACC, MJ, and H2O2; however, there were no differences between KO and segregant wild-type plants. This indicates that the gene may function under specific conditions. Alternatively, other MADS-box genes may complement the loss of its functioning. The rice genome contains three AGL12 group proteins that are closely related to OsMADS26: OsMADS33, OsMADS35, and OsMADS36—these share 52% to 53% overall amino acid identity with OsMADS26 (Lee et al., 2003Go). Potentially, OsMADS33 can be the candidate because it is expressed in a similar pattern to OsMADS26 (Lee et al., 2003Go). Interestingly, whereas four AGL12 group MADS-box genes have now been isolated from rice, only one from this group has been identified in other species, such as Arabidopsis, tomato, and Magnolia praecocissima. The loss-of-function mutant in Arabidopsis agl12 showed defects in root meristem development on vertical plates as well as a phenotype of late flowering under long days (Tapia-Lopez et al., 2008Go). This suggests that the rice AGL12 group genes are functionally redundant.


Overexpression of OsMADS26 Causes Multiple Stress Responses in Rice and Arabidopsis

To elucidate the role of OsMADS26, we regenerated transgenic rice plants overexpressing that gene. Various phenotypes were displayed, such as defective growth, chlorosis, cell death, pigment accumulation, spotted leaves, and senescence. These were almost reenacted in OsMADS26-overexpressing Arabidopsis plants, demonstrating the conserved role of this MADS-box gene in both model systems. We think that these phenotypes reflect the actual function of OsMADS26 because we employed an inducible system that showed the similar phenotypes to be independent of developmental stage. Therefore, the induced phenotypes are likely related to the action of OsMADS26. If the abnormalities had, instead, been artifacts due to disturbing the action of other proteins, we would have expected the influence to be linked with a particular growth stage. A number of overexpression analyses have been conducted previously to study gene function, especially when loss-of-function mutants do not provide any clues.

The phenotypes observed from the transgenics were similar to those previously reported for plants exposed to various stresses. In Arabidopsis, stresses mediated by heavy metals, nutrient deficiencies, and hypoxia induce the development of characteristic traits that include diminished leaf, shoot, and root elongation, as well as enhanced formation of lateral roots (for review, see Potters et al., 2007Go). Similar abnormalities (e.g. chlorosis and cell death) are commonly observed in rice grown under extremely harsh conditions. Pigments are also accumulated in stressed plants (Jordan et al., 1998Go; Harvaux and Kloppstech, 2001Go). Although genes related to cell death and pigment accumulation were identified in our microarray analyses, no gene directly associated with chlorosis was detected. Therefore, the chlorosis phenotype seems to be more of an indirect effect compared with other abnormalities.


OsMADS26 May Generate Various Stress Mediators

Because stress phenomena are connected with various factors, including phytohormones and ROS, the OsMADS26-mediated response described here might be related to hormonal activity. We speculated that JA is the most probable candidate because the phenotypes observed from our transformants were similar to those from plants that overexpress JA-inducible genes. Using a genetics screening system to isolate mutants that constitutively express a thionin (Thi2.1) gene, Hilpert et al. (2001)Go have identified at least five different constitutive expression of thionin mutants. These show phenotypes of retarded growth, whitish rosettes, downward-bending leaves, and spontaneous lesions. Two other mutants, cex1 (constant expression of JA inducible 1) and cev1 (constitutive expression of VSP 1), also manifest slower growth and the accumulation of anthocyanin (Xu et al., 2001Go; Ellis et al., 2002Go).

Our microarray analyses revealed that OsMADS26 overexpression indeed induced JA biosynthesis genes, such as LOX (A09032318), OsLOX3, OsAOS1, OsAOS4, OsAOS5, OsOPR2, OsOPR12, OsOPR13, and OsJMT4. Except for OsLOX3, OsAOS1, OsAOS5, and OsJMT4, at least one CArG box existed within the 2-kb promoter regions of the putative target genes (data not shown), which furthers the possibility that OsMADS26 directly binds to these promoters. Furthermore, MJ-treated rice seedlings partially resembled those with OsMADS26-induced abnormal phenotypes, including reduced root/shoot growth and pigment accumulation in the roots (Supplemental Fig. S8, A and B). The suppression of apical hook development seen in our 35S:OsMADS26 Arabidopsis plants also supports the idea that OsMADS26 activates JA signaling.

However, treatments with JA biosynthesis inhibitors (10 µM ibuprofen, 1 mM salicylic acid [SA], or 100 µM diethyldithiocarbamic acid [DIECA]) did not recover the abnormal phenotypes induced earlier by DEX treatment (data not shown). DIECA inhibits the octadecanoid pathway by reducing the intermediate 13-S-hydroperoxylinolenic acid to 13-hydroxylinolenic acid (Farmer et al., 1994Go). Ibuprofen and acetyl-SA work as LOX inhibitors (Doares et al., 1995Go; Nojiri et al., 1996Go). This might be because total oxylipin content was increased. Recently, Vellosillo et al. (2007)Go have reported on the diverse roles of oxylipin compounds formed by the oxygenation of fatty acids. These molecules prompt not only JA-induced development overall, but also are associated with root waving and the loss of apical dominance. Actually, 35S:OsMADS26 Arabidopsis plants show both a general retardation of growth and no apical dominance. Therefore, it is possible that OsMADS26 induces complex phenotypes by elevating oxylipin content. Alternatively, OsMADS26 may regulate JA, SA, and ET pathways simultaneously. Whereas antagonistic interactions between SA and ET/JA signaling have been documented, overlap in gene induction among JA, SA, and ET treatments also has been reported (Cheong et al., 2003Go; Sasaki et al., 2004Go). For example, BWMK1, up-regulated in our microarray analyses, was increased in response to SA, JA, and ethephon. Therefore, OsMADS26 may act as a common positive regulator for a subset of genes that respond to these hormones.

ET is another possible candidate because some of our phenotypes were similar to those from plants treated with ET in which four ACC oxidase genes were up-regulated. However, ACC synthase gene transcript levels did not change here. Because ACC synthesis is the rate-limiting step in ET production, the effect of OsMADS26 in the ET-mediated response is restricted to the regions where ACC synthase activity is high. In the apical hook, ET-mediated signaling seemed not to be activated because we did not find any ET-induced exaggeration of a hook. However, the leaf-curling phenotype observed in the 35S:OsMADS26 seedlings was similar to that of wild-type plants treated with ET.

Finally, the third candidate is ROS—this may be possible based on our data showing that NADPH oxidase gene transcript levels were up-regulated in the OsMADS26-overexpressing plants. ROS induces morphogenic responses that include defective growth and a relatively large number of lateral roots (Olmos et al., 2006Go). Enhanced ROS production is associated with a broad range of biotic and abiotic stresses (e.g. heat, UV radiation, heavy metal, anoxia, and pathogen attacks [Apel and Hirt, 2004Go]). Unexpectedly, a gene with high homology to GA β-hydroxylase was up-regulated. However, we did not study a relationship between GA and OsMADS26 because this hormone is rarely involved in stress-related responses observed in the OsMADS26-overexpressing plants.

OsMADS26 may directly bind to the promoter regions of these biosynthesis genes. Alternatively, it might regulate these genes via cross talk between stress mediators or by positive feedback mechanisms (Sasaki et al., 2001Go; Zhong and Burns, 2003Go; Cheong and Choi, 2007Go). For example, three JA biosynthesis genes—OsAOS1, OsAOC1, and OsOPR1—are induced not only by JA itself, but also by treatment with ET, abscisic acid, SA, or H2O2 (Agrawal et al., 2002Go, 2003aGo, 2003bGo). Likewise, OsACO2 transcript levels are elevated in indole-3-acetic acid-treated etiolated rice seedlings, whereas OsACO3 mRNA is greatly accumulated following ET exposure (Chae et al., 2000Go).


OsMADS26 Regulates Various Stress-Induced Genes

Microarray analyses have produced a global spectrum for the genes regulated by JA, ET, and ROS. MJ differentially controls the transcription of genes involved in oxidative bursts and programmed cell death, such as those for catalase, glutathione S-transferase, and Cys protease (Schenk et al., 2000Go). Numerous genes associated with cell rescue, disease, and defense mechanisms have been identified as early ET-regulated genes (De Paepe et al., 2004Go). Extensive comparisons have demonstrated redundant and specific roles for ROS in connection with stresses (Gadjev et al., 2006Go). Furthermore, considerable cross talk occurs among these signaling pathways. Schenk et al. (2000)Go have reported that 50% of the genes induced by ET are also induced by MJ. Transcriptome analysis of Col;35S:ERF1 transgenic plants and ET/JA-treated wild-type plants has further revealed a large number of genes responsive to both ET and JA (Lorenzo et al., 2003Go). In the flu mutant, which overproduces 1O2, the ET-responsive element-binding proteins are highly induced, indicating cross talk between 1O2 and ET signaling (Gadjev et al., 2006Go).

Our microarray analyses showed that genes inducible by JA, ET, or ROS were up-regulated in transgenic plants overexpressing OsMADS26. These include not only the biosynthesis genes already discussed here, but also many putative downstream genes, such as Cys proteinase, SAMDC, protease inhibitor, peroxidase, and MAP kinase genes (Zhao and Chye, 1999Go; Schenk et al., 2000Go; Biondi et al., 2001Go; De Paepe et al., 2004Go; Table III. Expression profiles for 22 rice peroxidase genes have revealed that many of them respond to disease, wounding, SA, JA, and ACC (Sasaki et al., 2004Go). A MAP kinase gene (A05011217), designated as BWMK1 (GenBank accession no. AF177392), is induced not only by blast, wounding, and H2O2, but also by the phytohormones SA, JA, and ethephon (He et al., 1999Go; Cheong et al., 2003Go). The two putative flavanone 3-hydroxylase genes found from our microarrays may also cause pigment accumulation. In other species, MJ induces the accumulation of anthocyanin in soybean (Glycine max) and Arabidopsis (Franceschi and Grimes, 1991Go; Jung, 2004Go). Furthermore, transcripts involved in anthocyanin production are coregulated in response to O2·, whereas H2O2 negatively impinges on their expression (Gadjev et al., 2006Go).

Our analyses also showed the activity of hypersensitive response (HR)-related genes that encode a harpin-induced protein or a cell death-associated protein. Harpin from Erwinia amylovora causes the HR (Wei et al., 1992Go). A putative cell death-associated gene has close homology with hsr203J, which is expressed in the leaves of Nicotiana tabacum ‘Samsun NN’ infected with Ralstonia solanacearum 8107 (Kiba et al., 2003Go). An aldo/keto reductase family gene also was induced here. Members of the aldo/keto reductase superfamily can detoxify a major lipid peroxide degradation product, 4-hydroxynon-2-enal (Vander Jagt et al., 1995Go), and the rice aldo/keto reductase gene is induced in vegetative tissues in response to polyethylene glycol-mediated water stress and salinity (Karuna Sree et al., 2000Go).

Three members belonging to the protease inhibitor family were down-regulated, suggesting their negative roles in stress-related responses. These proteins contain a domain commonly found in trypsin {alpha}-amylase inhibitors, seed storage proteins, and lipid transfer proteins (Rico et al., 1996Go). Some peroxidase genes were also down-regulated, perhaps causing the cell death signal to be amplified by reducing H2O2 scavenging. Down-regulation of peroxidase genes by ET has previously been reported (De Paepe et al., 2004Go). Together, our results indicate that OsMADS26 controls various stress responses.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Materials and Chemical Treatments

Rice (Oryza sativa var. japonica ‘Dongjin’) and the Columbia ecotype of Arabidopsis (Arabidopsis thaliana) were used. Rice seeds were surface sterilized and seedlings were grown at 28°C on gauze embedded in sterile Murashige and Skoog medium containing 0.2% agar, 3% Suc, and 0.01% myoinositol. Plants were grown to maturity in a greenhouse supplemented with artificial lighting during the winter period. DEX was dissolved in 95% alcohol at 1 mM and an appropriate amount was added to the growth medium to arrive at the desired final concentration. MJ and ACC were dissolved in 95% alcohol and sterilized water, respectively, at 10 mM, before a suitable amount was added to Murashige and Skoog solid medium containing 0.2% agar, 3% Suc, and 0.01% myoinositol. For Arabidopsis, MJ and ACC were added to 1/2 Gamborg B5 agar (0.8%) medium supplemented with 1% Suc.

For the treatments with JA biosynthesis inhibitors, plants were grown for 7 d in DEX-free Murashige and Skoog solid medium. Healthy plants were selected and incubated in tap water for 1 d. Ibuprofen, SA, and DIECA were added at their final concentrations of 10 µM, 1 mM, and 100 µM, respectively. After 1 h, 1 µM DEX was added and phenotypes were observed for three consecutive days.


Vector Construction

The full-length cDNA clone of OsMADS26 was isolated by nested PCR, using the following four primers: forward 1, 5'-atcaagcttggagctatcgatcatcaagc-3'; forward 2, 5'-atcaagcttgagacttatcttgatcgatgg-3'; reverse 1, 5'-ttgggtaccaaataaggtacatcagaatagc-3'; and reverse 2, 5'-ttgggtaccgttagaaggaatagcccatc-3'. These primers contained the HindIII and Asp-718 restriction enzyme sites for subsequent cloning. The PCR product was first cloned into pBluescript SK– (Stratagene). Afterward, the cDNA was subcloned into the pGA1611 binary vector between the maize (Zea mays) ubi promoter and the nos terminator for the sense construct (Lee et al., 1999Go; Kim et al., 2003Go). For the antisense construct, we used the region between 404 and 900 of OsMADS26. For the DEX-inducible system, the OsMADS26 stop codon was changed to the Asp-718 site by using the reverse primer (5'-ttgggtaccgaaggaatagcccatctcc-3'). The rat GR gene was inserted into that Asp-718 site, generating an in-frame fusion between the two molecules. For Arabidopsis transformation, the pGA1535 binary vector with the CaMV 35S promoter and a kanamycin-selectable marker was used to subclone OsMADS26, with HindIII and Asp-718.


Transformation

Rice transformation was performed according to the Agrobacterium-mediated methods described by Jeon et al. (1999)Go and Lee et al. (1999)Go. All transgenic plants were grown in glass tubes and then transferred to a confined paddy field. The Columbia ecotype was used for Arabidopsis transformation using the floral-dip method (Clough and Bent, 1998Go).


Microarray Analyses

Microarray analyses were conducted as described previously (Jung et al., 2005Go). Total RNA (100 mg) was prepared from two independent lines of the ubi:OsMADS26GR plants and wild-type segregants. KMC analyses were performed with The Institute for Genomic Research (TIGR) MeV software (Saeed et al., 2003Go).


RT-PCR, Real-Time PCR, and Northern-Blot Analysis

Total RNA was isolated from fresh tissues with an RNA isolation kit (Tri reagent; MRC). First-strand cDNA was synthesized from 4 µg of total RNA, using Moloney murine leukemia virus reverse transcriptase (Promega). Synthesized cDNA was used for semiquantitative RT-PCR and real-time PCR. The latter was performed with Roche LightCycler II. ACTIN primers, GCACAGGAAATGCTTCTAATTCTT and AATCACAAGTGAGAACCACAGGTA, were used for normalizing the cDNA quantity. The primers used in real-time PCR experiments were CTGATCATGTGAAGCAAATTTCTC and ACGCTAAGAACAGCGTTATTAC for Osl2, and AAGCATCATCATCATTACAGGCA and CTAATTTATTCACACAGATGAACCC for Osl55. For RT-PCR, the primers for the ACTIN genes were designed as reported previously (Takakura et al., 2000Go). Gene-specific primers were designed for each target gene (Supplemental Table S3). After PCR amplification, the products were separated on a 1.2% agarose gel and photographed. In some cases, PCR products were blotted onto a nylon membrane and hybridized with a 32P-labeled probe. For northern-blot analyses, total RNAs were fractionated on a 1.3% agarose gel, blotted onto a nylon membrane, and hybridized with a 32P-labeled probe. PCR primers F and R indicated in Supplemental Figure S1 were used to generate the probe.


Chlorophyll Content Measurement

Five-day-old seedlings were treated with 1 µM DEX for 3 d. Shoots were harvested, weighed, and ground into fine powder in liquid nitrogen. Chlorophylls were extracted in 80% acetone and diluted to 1/100 for spectrophotometer measurements. Chlorophyll a/b concentrations were determined according to the method of Lichtenthaler (1987)Go.

Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AB003326 (OsMADS26), AY066016 (GR), AF251073 (Osl2), and AF251074 (Osl55).


Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Characterization of OsMADS26 KO plants.
Supplemental Figure S2. Expression patterns of OsMADS26 in response to H2O2, ACC, and MJ.
Supplemental Figure S3. Phenotypes of OsMADS26 KO plants in response to H2O2, ACC, and MJ.
Supplemental Figure S4. Control and ubi:OsMADS26GR plants treated with 1 or 10 µM DEX.
Supplemental Figure S5. Abnormal phenotypes of ubi:OsMADS26GR plants.
Supplemental Figure S6. Reliability tests for microarray results.
Supplemental Figure S7. Effects of OsMADS26 on JA downstream genes.
Supplemental Figure S8. Effects of MJ on wild-type seedling growth.
Supplemental Table S1. Full list of all genes that are up- or down-regulated by at least 1.5-fold in the ubi:OsMADS26GR plants treated with DEX.
Supplemental Table S2. Expression profiles of ET or jasmonate biosynthesis genes in the ubi:OsMADS26GR plants treated with DEX.
Supplemental Table S3. Primer sequences used in RT-PCR analyses.


    ACKNOWLEDGMENTS
 
We thank Jeong Sik Kim and Hong-Gyu Kang for their help in the Arabidopsis research. We also thank Seonghoe Jang and Sung-Hoon Jun for experimental guidance and Priscilla Licht for critical reading of the manuscript.

Received December 10, 2007; accepted March 7, 2008; published March 19, 2008.


    FOOTNOTES
 
1 This work was supported in part by the Crop Functional Genomic Center, the 21st Century Frontier Program (grant no. CG1111); by the Biogreen 21 Program, Rural Development Administration (grant no. 20070401–034–001–007–03–00); and by the Korea Science and Engineering Foundation through the National Research Laboratory Program funded by the Ministry of Science and Technology (grant no. M10600000270–06J0000–27010). Back

2 Present address: Department of Biology, College of Science, Yonsei University, Seoul 120–749, Republic of Korea. Back

3 Present address: Department of Biology, Sunchon National University, Sunchon 540–742, Republic of Korea. Back

4 Present address: Division of Plant Biosciences, College of Agriculture and Life Sciences, Kyungpook National University, Daegu 702–701, Republic of Korea. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Gynheung An (genean{at}postech.ac.kr).

[C] Some figures in this article are displayed in color online but in black and white in the print edition. Back

[W] The online version of this article contains Web-only data. Back

[OA] Open Access articles can be viewed online without a subscription. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.107.114256

* Corresponding author; e-mail genean{at}postech.ac.kr.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Agrawal GK, Jwa N-S, Agrawal SK, Tamogami S, Iwahashi H, Rakwal R (2003a) Cloning of novel rice allene oxide cyclase (OsAOC): mRNA expression and comparative analysis with allene oxide synthase (OsAOS) gene provides insight into the transcriptional regulation of octadecanoid pathway biosynthetic genes in rice. Plant Sci 164: 979–992

Agrawal GK, Jwa NS, Shibato J, Han O, Iwahashi H, Rakwal R (2003b) Diverse environmental cues transiently regulate OsOPR1 of the "octadecanoid pathway" revealing its importance in rice defense/stress and development. Biochem Biophys Res Commun 310: 1073–1082[CrossRef][Web of Science][Medline]

Agrawal GK, Rakwal R, Jwa N-S, Han K-S, Agrawal VP (2002) Molecular cloning and mRNA expression analysis of the first rice jasmonate biosynthetic pathway gene allene oxide synthase. Plant Physiol Biochem 40: 771–782[CrossRef][Web of Science]

Agrawal GK, Tamogami S, Han O, Iwahashi H, Rakwal R (2004) Rice octadecanoid pathway. Biochem Biophys Res Commun 317: 1–15[CrossRef][Web of Science][Medline]

Alvarez-Buylla ER, Liljegren SJ, Pelaz S, Gold SE, Burgeff C, Ditta GS, Vergara-Silva F, Yanofsky MF (2000) MADS-box gene evolution beyond flowers: expression in pollen, endosperm, guard cells, roots and trichomes. Plant J 24: 457–466[CrossRef][Web of Science][Medline]

Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress and signal transduction. Annu Rev Plant Biol 55: 373–399[CrossRef][Medline]

Arora R, Agarwal P, Ray S, Singh AK, Singh VP, Tyagi AK, Kapoor S (2007) MADS-box gene family in rice: genome-wide identification, organization and expression profiling during reproductive development and stress. BMC Genomics 8: 242[CrossRef][Medline]

Becker A, Theissen G (2003) The major clades of MADS-box genes and their role in the development and evolution of flowering plants. Mol Phylogenet Evol 29: 464–489[CrossRef][Web of Science][Medline]

Bell E, Mullet JE (1993) Characterization of an Arabidopsis lipoxygenase gene responsive to methyl jasmonate and wounding. Plant Physiol 103: 1133–1137[Abstract]

Benedetti CE, Xie D, Turner JG (1995) COI1-dependent expression of an Arabidopsis vegetative storage protein in flowers and siliques and in response to coronatine or methyl jasmonate. Plant Physiol 109: 567–572[Abstract]

Biondi S, Scaramagli S, Capitani F, Altamura MM, Torrigiani P (2001) Methyl jasmonate upregulates biosynthetic gene expression, oxidation and conjugation of polyamines and inhibits shoot formation in tobacco thin layers. J Exp Bot 52: 231–242[Abstract/Free Full Text]

Boter M, Ruíz-Rivero O, Abdeen A, Prat S (2004) Conserved MYC transcription factors play a key role in jasmonate signaling both in tomato and Arabidopsis. Genes Dev 18: 1577–1591[Abstract/Free Full Text]

Chae HS, Cho YG, Park MY, Lee MC, Eun MY, Kang BG, Kim WT (2000) Hormonal cross-talk between auxin and ethylene differentially regulates the expression of two members of the 1-aminocyclopropane-1-carboxylate oxidase gene family in rice (Oryza sativa L). Plant Cell Physiol 41: 354–362[Abstract/Free Full Text]

Cheong JJ, Choi YD (2007) Signaling pathways for the biosynthesis and action of jasmonates. J Plant Biol 50: 122–131

Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC, Park BO, Koo SC, et al (2003) BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription factor. Plant Physiol 132: 1961–1972[Abstract/Free Full Text]

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline]

De Paepe A, Vuylsteke M, van Hummelen P, Zabeau M, van der Straeten D (2004) Transcriptional profiling by cDNA-AFLP and microarray analysis reveals novel insights into the early response to ethylene in Arabidopsis. Plant J 39: 537–559[CrossRef][Web of Science][Medline]

Doares SH, Narva'ez-Va'sques J, Conconi A, Ryan CA (1995) Salicylic acid inhibits synthesis of proteinase inhibitors in tomato leaves induced by systemin and jasmonic acid. Plant Physiol 108: 1741–1746[Abstract]

Ellis C, Karafyllidis I, Wasternack C, Turner JG (2002) The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses. Plant Cell 14: 1557–1566[Abstract/Free Full Text]

Ellis C, Turner JG (2001) The Arabidopsis mutant cev1 has constitutively active jasmonate and ethylene signal pathways and enhanced resistance to pathogens. Plant Cell 13: 1025–1033[Abstract/Free Full Text]

Fang SC, Fernandez DE (2002) Effect of regulated overexpression of the MADS domain factor AGL15 on flower senescence and fruit maturation. Plant Physiol 130: 78–89[Abstract/Free Full Text]

Farmer EE, Caldelari D, Pearce G, Walker-Simmons MK, Ryan CA (1994) Diethyldithiocarbamic acid inhibits the octadecanoid signaling pathway for the wound induction of proteinase inhibitors in tomato leaves. Plant Physiol 106: 337–342[Abstract]

Fernandez DE, Heck GR, Perry SE, Patterson SE, Bleecker AB, Fang SC (2000) The embryo MADS domain factor AGL15 acts postembryonically. Inhibition of perianth senescence and abscission via constitutive expression. Plant Cell 12: 183–198[Abstract/Free Full Text]

Franceschi VR, Grimes HD (1991) Induction of soybean vegetative storage proteins and anthocyanins by low-level atmospheric methyl jasmonate. Proc Natl Acad Sci USA 88: 6745–6749[Abstract/Free Full Text]

Gadjev I, Vanderauwera S, Gechev TS, Laloi C, Minkov IN, Shulaev V, Apel K, Inze D, Mittler R, van Breusegem F (2006) Transcriptomic footprints disclose specificity of reactive oxygen species signaling in Arabidopsis. Plant Physiol 141: 436–445[Abstract/Free Full Text]

Gu Q, Ferrandiz C, Yanofsky MF, Martienssen R (1998) The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125: 1509–1517[Abstract]

Harvaux M, Kloppstech K (2001) The protective functions of carotenoid and flavonoid pigments against excess visible radiation at chilling temperature investigated in Arabidopsis npq and tt mutants. Planta 213: 953–966[Web of Science][Medline]

He C, Fong SH, Yang D, Wang GL (1999) BWMK1, a novel MAP kinase induced by fungal infection and mechanical wounding in rice. Mol Plant Microbe Interact 12: 1064–1073[Web of Science][Medline]

Hilpert B, Bohlmann H, op den Camp RO, Przybyla D, Miersch O, Buchala A, Apel K (2001) Isolation and characterization of signal transduction mutants of Arabidopsis thaliana that constitutively activate the octadecanoid pathway and form necrotic microlesions. Plant J 26: 435–446[CrossRef][Web of Science][Medline]

Jeon JS, Chung YY, Lee S, Yi GH, Oh BG, An G (1999) Isolation and characterization of an anther-specific gene, RA8, from rice (Oryza sativa L). Plant Mol Biol 39: 35–44[CrossRef][Web of Science][Medline]

Jordan BR, James PE, A-H-Mackerness S (1998) Factors affecting UV-B-induced changes in Arabidopsis thaliana L. gene expression: the role of development, protective pigments and the chloroplast signal. Plant Cell Physiol 39: 769–778[Abstract/Free Full Text]

Jung KH, Han MJ, Lee YS, Kim YW, Hwang I, Kim MJ, Kim YK, Nahm BH, An G (2005) Rice undeveloped tapetum1 is a major regulator of early tapetum development. Plant Cell 17: 2705–2722[Abstract/Free Full Text]

Jung S (2004) Effect of chlorophyll reduction in Arabidopsis thaliana by methyl jasmonate or norflurazon on antioxidant systems. Plant Physiol Biochem 42: 225–231[CrossRef][Web of Science][Medline]

Karuna Sree B, Rajendrakumar CS, Reddy AR (2000) Aldose reductase in rice (Oryza sativa L): stress response and developmental specificity. Plant Sci 160: 149–157[Medline]

Kiba A, Tomiyama H, Takahashi H, Hamada H, Ohnishi K, Okuno T, Hikichi Y (2003) Induction of resistance and expression of defense-related genes in tobacco leaves infiltrated with Ralstonia solanacearum. Plant Cell Physiol 44: 287–295[Abstract/Free Full Text]

Kim SR, Lee S, Kang HG, Jeon JS, Kim KM, An GH (2003) A complete sequence of the pGA1611 binary vector. J Plant Biol 46: 211–214[CrossRef]

Kofuji R, Sumikawa N, Yamasaki M, Kondo K, Ueda K, Ito M, Hasebe M (2003) Evolution and divergence of the MADS-box gene family based on genome-wide expression analyses. Mol Biol Evol 20: 1963–1977[Abstract/Free Full Text]

Lee RH, Wang CH, Huang LT, Chen SC (2001) Leaf senescence in rice plants: cloning and characterization of senescence up-regulated genes. J Exp Bot 52: 1117–1121[Abstract/Free Full Text]

Lee S, Choi SC, An G (2008) Rice SVP-group MADS-box proteins, OsMADS22 and OsMADS55, are negative regulators of brassinosteroid responses. Plant J 54: 93–105[CrossRef][Web of Science][Medline]

Lee S, Jeon JS, Jung KH, An G (1999) Binary vector for efficient transformation of rice. J Plant Biol 42: 310–316[CrossRef]

Lee S, Kim J, Son JS, Nam J, Jeong DH, Lee K, Jang S, Yoo J, Lee J, Lee DY, et al (2003) Systematic reverse genetic screening of T-DNA tagged genes in rice for functional genomic analyses: MADS-box genes as a test case. Plant Cell Physiol 44: 1403–1411[Abstract/Free Full Text]

Lichtenthaler HK (1987) Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol 148: 350–382[CrossRef][Web of Science]

Liljegren SJ, Ditta GS, Eshed Y, Savidge B, Bowman JL, Yanofsky MF (2000) SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. Nature 404: 766–770[CrossRef][Medline]

Lorenzo O, Chico JM, Sánchez-Serrano JJ, Solano R (2004) JASMONATE-INSENSITIVE1 encodes a myc transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. Plant Cell 16: 1938–1950[Abstract/Free Full Text]

Lorenzo O, Piqueras R, Sanchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15: 165–178[Abstract/Free Full Text]

Mao L, Begum D, Chuang HW, Budiman MA, Szymkowiak EJ, Irish EE, Wing RA (2000) JOINTLESS is a MADS-box gene controlling tomato flower abscission zone development. Nature 406: 910–913[CrossRef][Medline]

Montiel G, Breton C, Thiersault M, Burlat V, Jay-Allemand C, Gantet P (2007) Transcription factor Agamous-like 12 from Arabidopsis promotes tissue-like organization and alkaloid biosynthesis in Catharanthus roseus suspension cells. Metab Eng 9: 125–132[CrossRef][Web of Science][Medline]

Nam J, Kim J, Lee S, An G, Ma H, Nei M (2004) Type I MADS-box genes have experienced faster birth-and-death evolution than type II MADS-box genes in angiosperms. Proc Natl Acad Sci USA 101: 1910–1915[Abstract/Free Full Text]

Nojiri H, Sugimori M, Yamane H, Nishimura Y, Yamada A, Shibuya N, Kodama O, Murofushi N, Omori T (1996) Involvement of jasmonic acid in elicitor-induced phytoalexin production in suspension-cultured rice cells. Plant Physiol 110: 387–392[Abstract]

Olmos E, Kiddle G, Pellny T, Kumar S, Foyer C (2006) Modulation of plant morphology, root architecture and cell structure by low vitamin C in Arabidopsis thaliana. J Exp Bot 57: 1645–1655[Abstract/Free Full Text]

Parenicova L, de Folter S, Kieffer M, Horner DS, Favalli C, Busscher J, Cook HE, Ingram RM, Kater MM, Davies B, et al (2003) Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world. Plant Cell 15: 1538–1551[Abstract/Free Full Text]

Pelucchi N, Fornara F, Favalli C, Masiero S, Lago C, Colombo L, Kater MM (2002) Comparative analysis of rice MADS-box genes expressed during flower development. Sex Plant Reprod 15: 113–122[CrossRef]

Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF (1998) Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103–2113[Abstract/Free Full Text]

Potters G, Pasternak TP, Guisez Y, Palme KJ, Jansen MA (2007) Stress-induced morphogenic responses: growing out of trouble? Trends Plant Sci 12: 98–105[CrossRef][Web of Science][Medline]

Rico M, Bruix M, González C, Monsalve RI, Rodríguez R (1996) 1H NMR assignment and global fold of napin BnIb, a representative 2S albumin seed protein. Biochemistry 35: 15672–15682[CrossRef][Web of Science][Medline]

Rounsley SD, Ditta GS, Yanofsky MF (1995) Diverse roles for MADS box genes in Arabidopsis development. Plant Cell 7: 1259–1269[Abstract]

Ryu CH, You JH, Kang HG, Hur J, Kim YH, Han MJ, An K, Chung BC, Lee CH, An G (2004) Generation of T-DNA tagging lines with a bidirectional gene trap vector and the establishment of an insertion-site database. Plant Mol Biol 54: 489–502[CrossRef][Web of Science][Medline]

Saeed AI, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier T, Thiagarajan M, et al (2003) TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34: 374–378[Web of Science][Medline]

Sasaki K, Iwai T, Hiraga S, Kuroda K, Seo S, Mitsuhara I, Miyasaka A, Iwano M, Ito H, Matsui H, et al (2004) Ten rice peroxidases redundantly respond to multiple stresses including infection with rice blast fungus. Plant Cell Physiol 45: 1442–1452[Abstract/Free Full Text]

Sasaki Y, Asamizu E, Shibata D, Nakamura Y, Kaneko T, Awai K, Amagai M, Kuwata C, Tsugane T, Masuda T, et al (2001) Monitoring of methyl jasmonate-responsive genes in Arabidopsis by cDNA macroarray: self-activation of jasmonic acid biosynthesis and crosstalk with other phytohormone signaling pathways. DNA Res 8: 153–161[Abstract]

Schenk PM, Kazan K, Wilson I, Anderson JP, Richmond T, Somerville SC, Manners JM (2000) Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proc Natl Acad Sci USA 97: 11655–11660[Abstract/Free Full Text]

Shinozuka Y, Kojima S, Shomura A, Ichimura H, Yano M, Yamamoto K, Sasaki T (1999) Isolation and characterization of rice MADS box gene homologues and their RFLP mapping. DNA Res 6: 123–129[Abstract]

Takakura Y, Ito T, Saito H, Inoue T, Komari T, Kuwata S (2000) Flower-predominant expression of a gene encoding a novel class I chitinase in rice (Oryza sativa L). Plant Mol Biol 42: 883–897[CrossRef][Web of Science][Medline]

Tapia-Lopez R, Garcia-Ponce B, Dubrovsky JG, Arroyo AG, Perez-Ruiz RV, Kim SH, Acevedo F, Pelaz S, Alvarez-Buylla ER (2008) An AGAMOUS-related MADS-box gene, XAL1 (AGL12), regulates root meristem cell proliferation and flowering transition in Arabidopsis. Plant Physiol 146: 1182–1192[Abstract/Free Full Text]

Vander Jagt DL, Kolb NS, Vander Jagt TJ, Chino J, Martinez FJ, Hunsaker LA, Royer RE (1995) Substrate specificity of human aldose reductase: identification of 4-hydroxynonenal as an endogenous substrate. Biochim Biophys Acta 1249: 117–126[CrossRef][Medline]

Vellosillo T, Martinez M, Lopez MA, Vicente J, Cascon T, Dolan L, Hamberg M, Castresana C (2007) Oxylipins produced by the 9-lipoxygenase pathway in Arabidopsis regulate lateral root development and defense responses through a specific signaling cascade. Plant Cell 19: 831–846[Abstract/Free Full Text]

Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R, Schuch W, Giovannoni J (2002) A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science 296: 343–346[Abstract/Free Full Text]

Wei ZM, Laby RJ, Zumoff CH, Bauer DW, He SY, Collmer A, Beer SV (1992) Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora. Science 257: 85–88[Abstract/Free Full Text]

Xu L, Liu F, Wang Z, Peng W, Huang R, Huang D, Xie D (2001) An Arabidopsis mutant cex1 exhibits constant accumulation of jasmonate-regulated AtVSP, Thi21 and PDF12. FEBS Lett 494: 161–164[CrossRef][Web of Science][Medline]

Zhao KJ, Chye ML (1999) Methyl jasmonate induces expression of a novel Brassica juncea chitinase with two chitin-binding domains. Plant Mol Biol 40: 1009–1018[CrossRef][Web of Science][Medline]

Zhong GV, Burns JK (2003) Profiling ethylene-regulated gene expression in Arabidopsis thaliana by microarray analysis. Plant Mol Biol 53: 117–131[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
J Exp BotHome page
Compiled by, F. Tooke, T. Chiurugwi, and N. Battey
Flowering Newsletter bibliography for 2008
J. Exp. Bot., June 23, 2009; (2009) erp154v1.
[Full Text] [PDF]


This Article
Free via Open Access: OA
Right arrow OA Abstract
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrowOA All Versions of this Article:
147/1/156    most recent
pp.107.114256v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, S.
Right arrow Articles by An, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S.
Right arrow Articles by An, G.
Agricola
Right arrow Articles by Lee, S.
Right arrow Articles by An, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2008 by the American Society of Plant Biologists