|
|
||||||||
|
First published online March 19, 2008; 10.1104/pp.107.114256 Plant Physiology 147:156-168 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Further Characterization of a Rice AGL12 Group MADS-Box Gene, OsMADS261,[C],[W],[OA]Department of Life Science and National Research Laboratory of Plant Functional Genomics, Pohang University of Science and Technology, Pohang 790–784, Republic of Korea
Plant MADS-box genes can be divided into 11 groups. Genetic analysis has revealed that most of them function in flowering-time control, reproductive organ development, and vegetative growth. Here, we elucidated the role of OsMADS26, a member of the AGL12 group. Transcript levels of OsMADS26 were increased in an age-dependent manner in the shoots and roots. Transgenic plants of both rice (Oryza sativa) and Arabidopsis (Arabidopsis thaliana) overexpressing this gene manifested phenotypes related to stress responses, such as chlorosis, cell death, pigment accumulation, and defective root/shoot growth. In addition, apical hook development was significantly suppressed in Arabidopsis. Plants transformed with the OsMADS26-GR (glucocorticoid receptor) fusion construct displayed those stress-related phenotypes when treated with dexamethasone. Microarray analyses using this inducible system showed that biosynthesis genes for jasmonate, ethylene, and reactive oxygen species, as well as putative downstream targets involved in the stress-related process, were up-regulated in OsMADS26-overexpressing plants. These results suggest that OsMADS26 induces multiple responses that are related to various stresses.
The MADS-box gene family encodes transcription factors with a conserved DNA-binding domain, called the MADS-box. These genes, ubiquitous in living organisms, have a wide range of functions. Plant MADS-box genes can be grouped into two evolutionary lineages (types I and II; Alvarez-Buylla et al., 2000
Detailed genetic analyses have shown that, whereas some MADS-box genes are involved in reproductive organ development (being preferentially expressed in the floral organs), others are expressed in the vegetative organs, where they perform various roles in flowering-time control, vegetative growth, and root development (Becker and Theissen, 2003
Some MADS-box genes are active in aging-related processes. For example, transgenic plants expressing sense AGAMOUS-LIKE15 (AGL15) inhibit senescence programs in the perianth organs and developing fruits (Fernandez et al., 2000
Expression Patterns of OsMADS26 We used semiquantitative reverse transcription (RT)-PCR to study the expression patterns of OsMADS26 at various developmental stages (Fig. 1 ). In 5-d-old seedlings, this gene was more strongly expressed in the roots than in the shoots. Transcript levels rose as the plants aged (Fig. 1A). In the roots, transcription reached a maximum at day 10 and remained at that level in older plants. However, in the leaves, transcripts continued to increase as the plants matured. Detailed analyses at broader developmental stages showed a dramatic rise in OsMADS26 transcripts in the roots between days 6 and 9 (Fig. 1B). In contrast, transcript levels continuously increased in leaves up to day 70 (Fig. 1C). Within individual plants, expression was much stronger in the mature leaves than in young, still-developing leaves (Fig. 1D). Therefore, these results indicate that OsMADS26 is more active in older tissues.
Phenotypes of ubi:OsMADS26S Plants
To elucidate in vivo functioning, we regenerated transgenic rice plants that expressed either sense or antisense constructs of the full-length OsMADS26 cDNA. Plants that ectopically expressed the antisense OsMADS26 showed no visible phenotypic changes (data not shown). We previously identified an OsMADS26 knockout (KO) line (1A-16632) from a T-DNA tagging population via reverse screening (Lee et al., 2003 In contrast, primary T1 transgenic plants expressing the sense OsMADS26 transcript (ubi:OsMADS26S plants) showed several abnormal phenotypes (Fig. 2 ). Among our 50 regenerated plants, 40 died at the young stage after they manifested such traits as defective root/shoot growth (Fig. 2, A and B), chlorosis and cell death (Fig. 2, A and B), screw-like root curling (Fig. 2, C and D), and pigment accumulation in their roots (Fig. 2, B and D). The remaining 10 plants showed less severe phenotypes and survived to maturity, with the adults displaying semidwarfism (Fig. 2E), pale-green coloration (Fig. 2E), spotted leaves (Fig. 2F), and shrunken seeds (Fig. 2G). Except for three lines, most of the plants were sterile. The T2 seedlings from those fertile lines had phenotypes similar to those observed from the primary transgenic plants, including retarded root/shoot growth, screw-like root curling, and pigment accumulation (Fig. 2H).
To check whether the phenotypes were induced by OsMADS26, we performed RNA gel-blot analysis of four representative lines: one that survived to maturity (Fig. 2E), two that developed roots and shoots but died at the seedling stage (Fig. 2B), and one that manifested more serious growth defects (Fig. 2A). In both roots and shoots, the levels of transgene expression were correlated with the severity of the phenotype (Fig. 2I), thereby suggesting that the phenotypes were due to OsMADS26 expression. Because ubi:OsMADS26S plants developed phenotypes of severe growth retardation that is associated with various stresses, we tested whether this gene is regulated by signaling mediators. Wild-type plants were treated with 1 µM 1-aminocyclopropane-1-carboxylic acid (ACC), 10 µM methyl jasmonate (MJ), or 1 mM hydrogen peroxide (H2O2) beginning at the germination stage; their shoots and roots were sampled 9 d after germination. Expression levels of OsMADS26 mRNA were not significantly changed (Supplemental Fig. S2). Moreover, no alterations were noted when 10-d-old rice seedlings were exposed to these molecules for 1, 3, or 24 h. Therefore, our results suggest that this gene is not regulated by such signaling molecules at the transcriptional level. Furthermore, we examined behavior of the OsMADS26 KO plants under various stresses. When 3-week-old plants were grown under water-deficit or high-salt (200 mM NaCl) conditions, they showed a degree of stress response similar to that of our wild-type controls (data not shown). We also investigated but found no visible phenotypic changes after treatment with 1 µM ACC, 1 mM H2O2, or 10 µM MJ (Supplemental Fig. S3).
The phenotypes displayed by the ubi:OsMADS26 plants suggested that this gene might be involved in various stress-related processes. However, some of those characteristics may have been due to indirect effects caused by ectopic overexpression at the regeneration stage. To observe the more direct effects, we generated transgenic plants carrying the OsMADS26-GR (glucocorticoid receptor) fusion construct (ubi:OsMADS26GR plants). Among the 32 T1 primary transgenics, 11 independent lines were examined to test whether this inducible system would be successful when plants were treated with dexamethasone (DEX). Six lines clearly showed abnormal phenotypes (Supplemental Fig. S4). For example, line 33 developed curled and shorter roots, whereas line 17 had severe growth retardation. The six confirmed lines were followed through the next generations and genotyped to obtain homozygous (HO) plants from each line. For genotyping, at least 50 T2 seedlings were tested for hygromycin resistance. If all plants survived, the lines were regarded as HO; if all died, they were considered to be wild type. For further study, line 33 was selected and its seedlings were treated with DEX in a dose-dependent manner to determine the effective concentration. In the wild-type segregants, DEX did not induce growth defects at up to 1 µM (Fig. 3A ), whereas the transgenic plants showed growth limitations at the lowest concentration (10 nM) and severe retardation at 1 µM (Fig. 3B). Their shoots and roots were significantly shorter (Fig. 3, A and B; Supplemental Fig. S5, A and B), and purple pigments were accumulated in the transgenic roots (Fig. 3B, inset). We obtained the same results with line 17 (data not shown). To understand the nature of these shortened roots, we sectioned their maturation zones. Histological analysis showed that cell elongation was significantly inhibited in the DEX-treated plants (Fig. 3, E and F).
The numbers of emerged roots and leaves were also reduced in DEX-treated transgenic plants in lines 33 and 17. For example, by day 9, wild-type segregants of line 33 had developed their fourth leaves and had an average total of eight to 10 roots (seminal plus nodal roots; Table I ). When HO plants of line 33 were treated with DEX, root numbers were reduced at the lowest concentration (10 nM), whereas leaf numbers were reduced in response to 100 nM DEX. However, by day 12, both wild-type and HO plants grown at 100 nM DEX had developed a similar number of leaves (about 4) and roots (about 10). These results suggest that the production of fewer roots and leaves associated with OsMADS26 overexpression was caused by a slower growth rate rather than because of defective primordia development.
To see the direct effects of this overexpression, we applied 1 µM DEX to 6-d-old seedlings. When treated for three consecutive days, the transgenics manifested phenotypes of retarded growth, pigment accumulation by their roots, and wilting, chlorosis, and senescence in their shoots (Fig. 3C). To further understand the role of this gene in these processes, we measured chlorophyll amounts after DEX treatment. Whereas wild-type control plants did not exhibit any difference, HO plants showed a 41% decrease in chlorophyll a and a 12% decrease in chlorophyll b (Fig. 3G). We examined expression levels of two previously reported senescence-related genes, Osl2 (aminotransferase) and Osl55 (β-methylcrotonyl-CoA carboxylase; Lee et al., 2001 To study the role of OsMADS26 in mature plants, we treated 80-d-old ubi:OsMADS26GR glasshouse-grown plants with 10 µM DEX. After 7 d of treatment, abnormal phenotypes were revealed only in transgenic plants, and included curled leaves, lesions, and chlorosis (Fig. 3D). In comparison, those transgenics treated with 1 µM DEX did not show any significant abnormality. Therefore, we can conclude that the phenotypes observed in the ubi:OsMADS26 plants were clearly reenacted in our GR-inducible system, suggesting that OsMADS26 may causes plant stress.
To identify the OsMADS26 downstream genes, we compared genome-wide RNA expression levels between the ubi:OsMADS26GR plants and their wild-type segregants, using a 60K oligo chip. Total RNAs were prepared from the roots of 7-d-old seedlings treated with 1 µM DEX for 3 or 9 h. Two independent lines (17 and 33) were tested, which entailed four sets of microarray analyses: 17 (3 h), 17 (9 h), 33 (3 h), and 33 (9 h). Supplemental Table S1 lists the genes that were up-regulated (146) or down-regulated (155) at least once and by a minimum of 1.5-fold in the ubi:OsMADS26GR plants. Pearson correlation coefficients between the two replicates for these 301 selected target genes were 0.745, 0.735, 0.928, and 0.923 for line 33 (3 h), line 33 (9 h), line 17 (3 h), and line 17 (9 h), respectively (Supplemental Fig. S6), indicating that line 17 generated more consistent results. When we applied a 2-fold difference as our cutoff criterion, 48 genes were identified, with respective Pearson correlation coefficients of 0.806, 0.880, 0.937, and 0.861 for line 33 (3 h), line 33 (9 h), line 17 (3 h), and line 17 (9 h). Interestingly, this standard allowed us to identify only 13 down-regulated genes compared with the isolation of 35 up-regulated genes, which implies that results fluctuated more with the former type. Our k-means clustering (KMC) analyses showed global expression patterns for these 48 genes (Fig. 4 ). All were induced or suppressed more strongly at 9 h than at 3 h. Moreover, five were induced dramatically at both 3 and 9 h (Fig. 4A), whereas 30 were weakly induced (Fig. 4B). Among the up-regulated genes, OsMADS26 was the most highly expressed (Supplemental Table S2; Fig. 4A).
The 301 genes with at least 1.5-fold differences in expression were classified according to their functioning via the Clusters of Orthologous Groups (http://www.ncbi.nlm.nih.gov/COG) analysis (Table II ). Major up-regulated or down-regulated genes included those involved in defense mechanisms, signal transduction, posttranslational modification/protein turnover/chaperones, carbohydrate transport/metabolism, and secondary metabolite transport/metabolism. Genes belonging to three groups were changed more frequently (i.e. defense mechanisms [2.40%], inorganic ion transport and metabolism [1.02%], and secondary metabolite transport/metabolism [1.08%]). Genes related to secondary metabolites were more abundant in the up-regulated group, whereas those involved in defense were more abundant in the down-regulated group.
Transcript Analyses of Putative OsMADS26 Downstream Genes We chose eight genes to examine the reliability of our microarray data (Table III ). Four iron/ascorbate family oxidoreductase genes were found in the up-regulated group and could be divided into two groups: ACC oxidase genes involved in ethylene (ET) biosynthesis (A09021902 and A05041211) and putative flavanone 3-hydroxylase genes (A05011009 and B10022103). From these, we selected one ACC oxidase gene (A09021902) and one flavanone 3-hydroxylase gene (A05011009) for further confirmation. The A05011009 protein showed high homology to GA β-hydroxylase. We also identified a lipoxygenase (LOX) gene (A09032318), an NADPH oxidase gene (B03011909), and the S-adenosyl-Met decarboxylase (SAMDC) gene (A10031622), which function in the biosyntheses of jasmonic acid (JA), reactive oxygen species (ROS), and polyamine, respectively. In addition, a MAP kinase gene (A05011217) involved in hormone signaling/biosynthesis and two harpin-induced protein genes (B05032110 and A03011404) were examined.
For semiquantitative RT-PCR analyses of these eight selected genes, 7-d-old OsMADS26GR plants and their wild-type segregants were treated with 1 µM DEX for up to 9 h and RNAs were prepared from their roots. The OsMADS26 and ACTIN genes were included as controls. As expected, OsMADS26 transcript was highly expressed in the transgenic roots, with that level increasing after DEX treatment (Fig. 5 ). Transcripts of these eight genes were induced posttreatment and showed expression patterns similar to those obtained from the microarray analyses. Therefore, these data support the reliability of the microarray results.
The Relationship between OsMADS26 and Biosynthesis Genes Associated with Stress Responses The phenotypes observed in our ubi:OsMADS26 and ubi:OsMADS26GR plants were broadly correlated with stress responses. Microarray analyses demonstrated the up-regulation of several genes for the biosynthesis of stress-inducing molecules, such as ET, JA, ROS, and polyamine (Supplemental Table S2).
In ET biosynthesis, ACC synthase and ACC oxidase genes are the most important in mediating the final two steps. Whereas none of the ACC synthase genes was changed significantly, four ACC oxidase genes were up-regulated in three experimental sets. The JA biosynthesis genes include LOX, AOS (allene oxide synthase), AOC (allene oxide cyclase), OPR (oxo-phytodienoic acid reductase), and JMT (JA carboxyl methyltransferase; Agrawal et al., 2004
To further elucidate the role of OsMADS26, we utilized the Arabidopsis system in which expression is under the control of the cauliflower mosaic virus (CaMV) 35S promoter. Of our 105 kanamycin-resistant T1 transgenic plants (35S:OsMADS26 plants), 11 developed severe dwarfism, chlorosis, and tilted leaves (Fig. 6A ). Their growth was halted and they eventually died without developing reproductive organs. The rest of the T1 plants, which produced fertile seeds, were used for further analyses.
T2 segregants of these transgenic lines were analyzed phenotypically. Among the 11 independent lines examined, those from lines 1, 8, and 11 displayed a wide range of abnormal phenotypes (Fig. 6, B and C). Generally, their plants were smaller, but had more lateral roots. Furthermore, line 1 accumulated red pigments, whereas lines 8 and 11 developed twisted leaves. Plants from line 11 were only about one-third as large as the wild type, and they showed a delayed rate of leaf emergence. OsMADS26 transcripts were detected in all the plants with abnormal phenotypes.
To determine whether the abnormal phenotypes were induced by JA, we checked the expression levels of AtMYC2, VSP, and PDF1.2 (Bell and Mullet, 1993
Ellis and Turner (2001)
OsMADS26 Transcript Is More Abundant in Old Tissues
OsMADS26 was the first of four rice genes identified in the AGL12 group. Its expression patterns have now been elucidated, with transcripts being detected in the roots, shoots, panicles, and inflorescences throughout all developmental stages (Shinozuka et al., 1999
Transgenic plants overexpressing the antisense OsMADS26 or the T-DNA insertional mutant showed no visible alterations in their phenotypes. We examined the KO plants under various stress conditions, such as drought, high salt, and stress mediators such as ACC, MJ, and H2O2; however, there were no differences between KO and segregant wild-type plants. This indicates that the gene may function under specific conditions. Alternatively, other MADS-box genes may complement the loss of its functioning. The rice genome contains three AGL12 group proteins that are closely related to OsMADS26: OsMADS33, OsMADS35, and OsMADS36—these share 52% to 53% overall amino acid identity with OsMADS26 (Lee et al., 2003
To elucidate the role of OsMADS26, we regenerated transgenic rice plants overexpressing that gene. Various phenotypes were displayed, such as defective growth, chlorosis, cell death, pigment accumulation, spotted leaves, and senescence. These were almost reenacted in OsMADS26-overexpressing Arabidopsis plants, demonstrating the conserved role of this MADS-box gene in both model systems. We think that these phenotypes reflect the actual function of OsMADS26 because we employed an inducible system that showed the similar phenotypes to be independent of developmental stage. Therefore, the induced phenotypes are likely related to the action of OsMADS26. If the abnormalities had, instead, been artifacts due to disturbing the action of other proteins, we would have expected the influence to be linked with a particular growth stage. A number of overexpression analyses have been conducted previously to study gene function, especially when loss-of-function mutants do not provide any clues.
The phenotypes observed from the transgenics were similar to those previously reported for plants exposed to various stresses. In Arabidopsis, stresses mediated by heavy metals, nutrient deficiencies, and hypoxia induce the development of characteristic traits that include diminished leaf, shoot, and root elongation, as well as enhanced formation of lateral roots (for review, see Potters et al., 2007
Because stress phenomena are connected with various factors, including phytohormones and ROS, the OsMADS26-mediated response described here might be related to hormonal activity. We speculated that JA is the most probable candidate because the phenotypes observed from our transformants were similar to those from plants that overexpress JA-inducible genes. Using a genetics screening system to isolate mutants that constitutively express a thionin (Thi2.1) gene, Hilpert et al. (2001) Our microarray analyses revealed that OsMADS26 overexpression indeed induced JA biosynthesis genes, such as LOX (A09032318), OsLOX3, OsAOS1, OsAOS4, OsAOS5, OsOPR2, OsOPR12, OsOPR13, and OsJMT4. Except for OsLOX3, OsAOS1, OsAOS5, and OsJMT4, at least one CArG box existed within the 2-kb promoter regions of the putative target genes (data not shown), which furthers the possibility that OsMADS26 directly binds to these promoters. Furthermore, MJ-treated rice seedlings partially resembled those with OsMADS26-induced abnormal phenotypes, including reduced root/shoot growth and pigment accumulation in the roots (Supplemental Fig. S8, A and B). The suppression of apical hook development seen in our 35S:OsMADS26 Arabidopsis plants also supports the idea that OsMADS26 activates JA signaling.
However, treatments with JA biosynthesis inhibitors (10 µM ibuprofen, 1 mM salicylic acid [SA], or 100 µM diethyldithiocarbamic acid [DIECA]) did not recover the abnormal phenotypes induced earlier by DEX treatment (data not shown). DIECA inhibits the octadecanoid pathway by reducing the intermediate 13-S-hydroperoxylinolenic acid to 13-hydroxylinolenic acid (Farmer et al., 1994 ET is another possible candidate because some of our phenotypes were similar to those from plants treated with ET in which four ACC oxidase genes were up-regulated. However, ACC synthase gene transcript levels did not change here. Because ACC synthesis is the rate-limiting step in ET production, the effect of OsMADS26 in the ET-mediated response is restricted to the regions where ACC synthase activity is high. In the apical hook, ET-mediated signaling seemed not to be activated because we did not find any ET-induced exaggeration of a hook. However, the leaf-curling phenotype observed in the 35S:OsMADS26 seedlings was similar to that of wild-type plants treated with ET.
Finally, the third candidate is ROS—this may be possible based on our data showing that NADPH oxidase gene transcript levels were up-regulated in the OsMADS26-overexpressing plants. ROS induces morphogenic responses that include defective growth and a relatively large number of lateral roots (Olmos et al., 2006
OsMADS26 may directly bind to the promoter regions of these biosynthesis genes. Alternatively, it might regulate these genes via cross talk between stress mediators or by positive feedback mechanisms (Sasaki et al., 2001
Microarray analyses have produced a global spectrum for the genes regulated by JA, ET, and ROS. MJ differentially controls the transcription of genes involved in oxidative bursts and programmed cell death, such as those for catalase, glutathione S-transferase, and Cys protease (Schenk et al., 2000
Our microarray analyses showed that genes inducible by JA, ET, or ROS were up-regulated in transgenic plants overexpressing OsMADS26. These include not only the biosynthesis genes already discussed here, but also many putative downstream genes, such as Cys proteinase, SAMDC, protease inhibitor, peroxidase, and MAP kinase genes (Zhao and Chye, 1999
Our analyses also showed the activity of hypersensitive response (HR)-related genes that encode a harpin-induced protein or a cell death-associated protein. Harpin from Erwinia amylovora causes the HR (Wei et al., 1992
Three members belonging to the protease inhibitor family were down-regulated, suggesting their negative roles in stress-related responses. These proteins contain a domain commonly found in trypsin
Plant Materials and Chemical Treatments Rice (Oryza sativa var. japonica Dongjin) and the Columbia ecotype of Arabidopsis (Arabidopsis thaliana) were used. Rice seeds were surface sterilized and seedlings were grown at 28°C on gauze embedded in sterile Murashige and Skoog medium containing 0.2% agar, 3% Suc, and 0.01% myoinositol. Plants were grown to maturity in a greenhouse supplemented with artificial lighting during the winter period. DEX was dissolved in 95% alcohol at 1 mM and an appropriate amount was added to the growth medium to arrive at the desired final concentration. MJ and ACC were dissolved in 95% alcohol and sterilized water, respectively, at 10 mM, before a suitable amount was added to Murashige and Skoog solid medium containing 0.2% agar, 3% Suc, and 0.01% myoinositol. For Arabidopsis, MJ and ACC were added to 1/2 Gamborg B5 agar (0.8%) medium supplemented with 1% Suc. For the treatments with JA biosynthesis inhibitors, plants were grown for 7 d in DEX-free Murashige and Skoog solid medium. Healthy plants were selected and incubated in tap water for 1 d. Ibuprofen, SA, and DIECA were added at their final concentrations of 10 µM, 1 mM, and 100 µM, respectively. After 1 h, 1 µM DEX was added and phenotypes were observed for three consecutive days.
The full-length cDNA clone of OsMADS26 was isolated by nested PCR, using the following four primers: forward 1, 5'-atcaagcttggagctatcgatcatcaagc-3'; forward 2, 5'-atcaagcttgagacttatcttgatcgatgg-3'; reverse 1, 5'-ttgggtaccaaataaggtacatcagaatagc-3'; and reverse 2, 5'-ttgggtaccgttagaaggaatagcccatc-3'. These primers contained the HindIII and Asp-718 restriction enzyme sites for subsequent cloning. The PCR product was first cloned into pBluescript SK– (Stratagene). Afterward, the cDNA was subcloned into the pGA1611 binary vector between the maize (Zea mays) ubi promoter and the nos terminator for the sense construct (Lee et al., 1999
Rice transformation was performed according to the Agrobacterium-mediated methods described by Jeon et al. (1999)
Microarray analyses were conducted as described previously (Jung et al., 2005
Total RNA was isolated from fresh tissues with an RNA isolation kit (Tri reagent; MRC). First-strand cDNA was synthesized from 4 µg of total RNA, using Moloney murine leukemia virus reverse transcriptase (Promega). Synthesized cDNA was used for semiquantitative RT-PCR and real-time PCR. The latter was performed with Roche LightCycler II. ACTIN primers, GCACAGGAAATGCTTCTAATTCTT and AATCACAAGTGAGAACCACAGGTA, were used for normalizing the cDNA quantity. The primers used in real-time PCR experiments were CTGATCATGTGAAGCAAATTTCTC and ACGCTAAGAACAGCGTTATTAC for Osl2, and AAGCATCATCATCATTACAGGCA and CTAATTTATTCACACAGATGAACCC for Osl55. For RT-PCR, the primers for the ACTIN genes were designed as reported previously (Takakura et al., 2000
Five-day-old seedlings were treated with 1 µM DEX for 3 d. Shoots were harvested, weighed, and ground into fine powder in liquid nitrogen. Chlorophylls were extracted in 80% acetone and diluted to 1/100 for spectrophotometer measurements. Chlorophyll a/b concentrations were determined according to the method of Lichtenthaler (1987) Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AB003326 (OsMADS26), AY066016 (GR), AF251073 (Osl2), and AF251074 (Osl55).
The following materials are available in the online version of this article.
We thank Jeong Sik Kim and Hong-Gyu Kang for their help in the Arabidopsis research. We also thank Seonghoe Jang and Sung-Hoon Jun for experimental guidance and Priscilla Licht for critical reading of the manuscript. Received December 10, 2007; accepted March 7, 2008; published March 19, 2008.
1 This work was supported in part by the Crop Functional Genomic Center, the 21st Century Frontier Program (grant no. CG1111); by the Biogreen 21 Program, Rural Development Administration (grant no. 20070401–034–001–007–03–00); and by the Korea Science and Engineering Foundation through the National Research Laboratory Program funded by the Ministry of Science and Technology (grant no. M10600000270–06J0000–27010).
2 Present address: Department of Biology, College of Science, Yonsei University, Seoul 120–749, Republic of Korea.
3 Present address: Department of Biology, Sunchon National University, Sunchon 540–742, Republic of Korea.
4 Present address: Division of Plant Biosciences, College of Agriculture and Life Sciences, Kyungpook National University, Daegu 702–701, Republic of Korea. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Gynheung An (genean{at}postech.ac.kr).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.107.114256 * Corresponding author; e-mail genean{at}postech.ac.kr.
Agrawal GK, Jwa N-S, Agrawal SK, Tamogami S, Iwahashi H, Rakwal R (2003a) Cloning of novel rice allene oxide cyclase (OsAOC): mRNA expression and comparative analysis with allene oxide synthase (OsAOS) gene provides insight into the transcriptional regulation of octadecanoid pathway biosynthetic genes in rice. Plant Sci 164: 979–992 Agrawal GK, Jwa NS, Shibato J, Han O, Iwahashi H, Rakwal R (2003b) Diverse environmental cues transiently regulate OsOPR1 of the "octadecanoid pathway" revealing its importance in rice defense/stress and development. Biochem Biophys Res Commun 310: 1073–1082[CrossRef][Web of Science][Medline] Agrawal GK, Rakwal R, Jwa N-S, Han K-S, Agrawal VP (2002) Molecular cloning and mRNA expression analysis of the first rice jasmonate biosynthetic pathway gene allene oxide synthase. Plant Physiol Biochem 40: 771–782[CrossRef][Web of Science] Agrawal GK, Tamogami S, Han O, Iwahashi H, Rakwal R (2004) Rice octadecanoid pathway. Biochem Biophys Res Commun 317: 1–15[CrossRef][Web of Science][Medline] Alvarez-Buylla ER, Liljegren SJ, Pelaz S, Gold SE, Burgeff C, Ditta GS, Vergara-Silva F, Yanofsky MF (2000) MADS-box gene evolution beyond flowers: expression in pollen, endosperm, guard cells, roots and trichomes. Plant J 24: 457–466[CrossRef][Web of Science][Medline] Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress and signal transduction. Annu Rev Plant Biol 55: 373–399[CrossRef][Medline] Arora R, Agarwal P, Ray S, Singh AK, Singh VP, Tyagi AK, Kapoor S (2007) MADS-box gene family in rice: genome-wide identification, organization and expression profiling during reproductive development and stress. BMC Genomics 8: 242[CrossRef][Medline] Becker A, Theissen G (2003) The major clades of MADS-box genes and their role in the development and evolution of flowering plants. Mol Phylogenet Evol 29: 464–489[CrossRef][Web of Science][Medline] Bell E, Mullet JE (1993) Characterization of an Arabidopsis lipoxygenase gene responsive to methyl jasmonate and wounding. Plant Physiol 103: 1133–1137[Abstract] Benedetti CE, Xie D, Turner JG (1995) COI1-dependent expression of an Arabidopsis vegetative storage protein in flowers and siliques and in response to coronatine or methyl jasmonate. Plant Physiol 109: 567–572[Abstract] Biondi S, Scaramagli S, Capitani F, Altamura MM, Torrigiani P (2001) Methyl jasmonate upregulates biosynthetic gene expression, oxidation and conjugation of polyamines and inhibits shoot formation in tobacco thin layers. J Exp Bot 52: 231–242 Boter M, Ruíz-Rivero O, Abdeen A, Prat S (2004) Conserved MYC transcription factors play a key role in jasmonate signaling both in tomato and Arabidopsis. Genes Dev 18: 1577–1591 Chae HS, Cho YG, Park MY, Lee MC, Eun MY, Kang BG, Kim WT (2000) Hormonal cross-talk between auxin and ethylene differentially regulates the expression of two members of the 1-aminocyclopropane-1-carboxylate oxidase gene family in rice (Oryza sativa L). Plant Cell Physiol 41: 354–362[Web of Science][Medline] Cheong JJ, Choi YD (2007) Signaling pathways for the biosynthesis and action of jasmonates. J Plant Biol 50: 122–131 Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC, Park BO, Koo SC, et al (2003) BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription factor. Plant Physiol 132: 1961–1972 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline] De Paepe A, Vuylsteke M, van Hummelen P, Zabeau M, van der Straeten D (2004) Transcriptional profiling by cDNA-AFLP and microarray analysis reveals novel insights into the early response to ethylene in Arabidopsis. Plant J 39: 537–559[CrossRef][Web of Science][Medline] Doares SH, Narva'ez-Va'sques J, Conconi A, Ryan CA (1995) Salicylic acid inhibits synthesis of proteinase inhibitors in tomato leaves induced by systemin and jasmonic acid. Plant Physiol 108: 1741–1746[Abstract] Ellis C, Karafyllidis I, Wasternack C, Turner JG (2002) The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses. Plant Cell 14: 1557–1566 Ellis C, Turner JG (2001) The Arabidopsis mutant cev1 has constitutively active jasmonate and ethylene signal pathways and enhanced resistance to pathogens. Plant Cell 13: 1025–1033 Fang SC, Fernandez DE (2002) Effect of regulated overexpression of the MADS domain factor AGL15 on flower senescence and fruit maturation. Plant Physiol 130: 78–89 Farmer EE, Caldelari D, Pearce G, Walker-Simmons MK, Ryan CA (1994) Diethyldithiocarbamic acid inhibits the octadecanoid signaling pathway for the wound induction of proteinase inhibitors in tomato leaves. Plant Physiol 106: 337–342[Abstract] Fernandez DE, Heck GR, Perry SE, Patterson SE, Bleecker AB, Fang SC (2000) The embryo MADS domain factor AGL15 acts postembryonically. Inhibition of perianth senescence and abscission via constitutive expression. Plant Cell 12: 183–198 Franceschi VR, Grimes HD (1991) Induction of soybean vegetative storage proteins and anthocyanins by low-level atmospheric methyl jasmonate. Proc Natl Acad Sci USA 88: 6745–6749 Gadjev I, Vanderauwera S, Gechev TS, Laloi C, Minkov IN, Shulaev V, Apel K, Inze D, Mittler R, van Breusegem F (2006) Transcriptomic footprints disclose specificity of reactive oxygen species signaling in Arabidopsis. Plant Physiol 141: 436–445 Gu Q, Ferrandiz C, Yanofsky MF, Martienssen R (1998) The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125: 1509–1517[Abstract] Harvaux M, Kloppstech K (2001) The protective functions of carotenoid and flavonoid pigments against excess visible radiation at chilling temperature investigated in Arabidopsis npq and tt mutants. Planta 213: 953–966[Web of Science][Medline] He C, Fong SH, Yang D, Wang GL (1999) BWMK1, a novel MAP kinase induced by fungal infection and mechanical wounding in rice. Mol Plant Microbe Interact 12: 1064–1073[Web of Science][Medline] Hilpert B, Bohlmann H, op den Camp RO, Przybyla D, Miersch O, Buchala A, Apel K (2001) Isolation and characterization of signal transduction mutants of Arabidopsis thaliana that constitutively activate the octadecanoid pathway and form necrotic microlesions. Plant J 26: 435–446[CrossRef][Web of Science][Medline] Jeon JS, Chung YY, Lee S, Yi GH, Oh BG, An G (1999) Isolation and characterization of an anther-specific gene, RA8, from rice (Oryza sativa L). Plant Mol Biol 39: 35–44[CrossRef][Web of Science][Medline] Jordan BR, James PE, A-H-Mackerness S (1998) Factors affecting UV-B-induced changes in Arabidopsis thaliana L. gene expression: the role of development, protective pigments and the chloroplast signal. Plant Cell Physiol 39: 769–778 Jung KH, Han MJ, Lee YS, Kim YW, Hwang I, Kim MJ, Kim YK, Nahm BH, An G (2005) Rice undeveloped tapetum1 is a major regulator of early tapetum development. Plant Cell 17: 2705–2722 Jung S (2004) Effect of chlorophyll reduction in Arabidopsis thaliana by methyl jasmonate or norflurazon on antioxidant systems. Plant Physiol Biochem 42: 225–231[CrossRef][Web of Science][Medline] Karuna Sree B, Rajendrakumar CS, Reddy AR (2000) Aldose reductase in rice (Oryza sativa L): stress response and developmental specificity. Plant Sci 160: 149–157[Medline] Kiba A, Tomiyama H, Takahashi H, Hamada H, Ohnishi K, Okuno T, Hikichi Y (2003) Induction of resistance and expression of defense-related genes in tobacco leaves infiltrated with Ralstonia solanacearum. Plant Cell Physiol 44: 287–295 Kim SR, Lee S, Kang HG, Jeon JS, Kim KM, An GH (2003) A complete sequence of the pGA1611 binary vector. J Plant Biol 46: 211–214[CrossRef] Kofuji R, Sumikawa N, Yamasaki M, Kondo K, Ueda K, Ito M, Hasebe M (2003) Evolution and divergence of the MADS-box gene family based on genome-wide expression analyses. Mol Biol Evol 20: 1963–1977 Lee RH, Wang CH, Huang LT, Chen SC (2001) Leaf senescence in rice plants: cloning and characterization of senescence up-regulated genes. J Exp Bot 52: 1117–1121 Lee S, Choi SC, An G (2008) Rice SVP-group MADS-box proteins, OsMADS22 and OsMADS55, are negative regulators of brassinosteroid responses. Plant J 54: 93–105[CrossRef][Web of Science][Medline] Lee S, Jeon JS, Jung KH, An G (1999) Binary vector for efficient transformation of rice. J Plant Biol 42: 310–316[CrossRef] Lee S, Kim J, Son JS, Nam J, Jeong DH, Lee K, Jang S, Yoo J, Lee J, Lee DY, et al (2003) Systematic reverse genetic screening of T-DNA tagged genes in rice for functional genomic analyses: MADS-box genes as a test case. Plant Cell Physiol 44: 1403–1411 Lichtenthaler HK (1987) Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol 148: 350–382[CrossRef][Web of Science] Liljegren SJ, Ditta GS, Eshed Y, Savidge B, Bowman JL, Yanofsky MF (2000) SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. Nature 404: 766–770[CrossRef][Medline] Lorenzo O, Chico JM, Sánchez-Serrano JJ, Solano R (2004) JASMONATE-INSENSITIVE1 encodes a myc transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. Plant Cell 16: 1938–1950 Lorenzo O, Piqueras R, Sanchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15: 165–178 Mao L, Begum D, Chuang HW, Budiman MA, Szymkowiak EJ, Irish EE, Wing RA (2000) JOINTLESS is a MADS-box gene controlling tomato flower abscission zone development. Nature 406: 910–913[CrossRef][Medline] Montiel G, Breton C, Thiersault M, Burlat V, Jay-Allemand C, Gantet P (2007) Transcription factor Agamous-like 12 from Arabidopsis promotes tissue-like organization and alkaloid biosynthesis in Catharanthus roseus suspension cells. Metab Eng 9: 125–132[CrossRef][Web of Science][Medline] Nam J, Kim J, Lee S, An G, Ma H, Nei M (2004) Type I MADS-box genes have experienced faster birth-and-death evolution than type II MADS-box genes in angiosperms. Proc Natl Acad Sci USA 101: 1910–1915 Nojiri H, Sugimori M, Yamane H, Nishimura Y, Yamada A, Shibuya N, Kodama O, Murofushi N, Omori T (1996) Involvement of jasmonic acid in elicitor-induced phytoalexin production in suspension-cultured rice cells. Plant Physiol 110: 387–392[Abstract] Olmos E, Kiddle G, Pellny T, Kumar S, Foyer C (2006) Modulation of plant morphology, root architecture and cell structure by low vitamin C in Arabidopsis thaliana. J Exp Bot 57: 1645–1655 Parenicova L, de Folter S, Kieffer M, Horner DS, Favalli C, Busscher J, Cook HE, Ingram RM, Kater MM, Davies B, et al (2003) Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world. Plant Cell 15: 1538–1551 Pelucchi N, Fornara F, Favalli C, Masiero S, Lago C, Colombo L, Kater MM (2002) Comparative analysis of rice MADS-box genes expressed during flower development. Sex Plant Reprod 15: 113–122[CrossRef] Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF (1998) Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103–2113 Potters G, Pasternak TP, Guisez Y, Palme KJ, Jansen MA (2007) Stress-induced morphogenic responses: growing out of trouble? Trends Plant Sci 12: 98–105[CrossRef][Web of Science][Medline] Rico M, Bruix M, González C, Monsalve RI, Rodríguez R (1996) 1H NMR assignment and global fold of napin BnIb, a representative 2S albumin seed protein. Biochemistry 35: 15672–15682[CrossRef][Web of Science][Medline] Rounsley SD, Ditta GS, Yanofsky MF (1995) Diverse roles for MADS box genes in Arabidopsis development. Plant Cell 7: 1259–1269[Abstract] Ryu CH, You JH, Kang HG, Hur J, Kim YH, Han MJ, An K, Chung BC, Lee CH, An G (2004) Generation of T-DNA tagging lines with a bidirectional gene trap vector and the establishment of an insertion-site database. Plant Mol Biol 54: 489–502[CrossRef][Web of Science][Medline] Saeed AI, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier T, Thiagarajan M, et al (2003) TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34: 374–378[Web of Science][Medline] Sasaki K, Iwai T, Hiraga S, Kuroda K, Seo S, Mitsuhara I, Miyasaka A, Iwano M, Ito H, Matsui H, et al (2004) Ten rice peroxidases redundantly respond to multiple stresses including infection with rice blast fungus. Plant Cell Physiol 45: 1442–1452 Sasaki Y, Asamizu E, Shibata D, Nakamura Y, Kaneko T, Awai K, Amagai M, Kuwata C, Tsugane T, Masuda T, et al (2001) Monitoring of methyl jasmonate-responsive genes in Arabidopsis by cDNA macroarray: self-activation of jasmonic acid biosynthesis and crosstalk with other phytohormone signaling pathways. DNA Res 8: 153–161[Abstract] Schenk PM, Kazan K, Wilson I, Anderson JP, Richmond T, Somerville SC, Manners JM (2000) Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proc Natl Acad Sci USA 97: 11655–11660 Shinozuka Y, Kojima S, Shomura A, Ichimura H, Yano M, Yamamoto K, Sasaki T (1999) Isolation and characterization of rice MADS box gene homologues and their RFLP mapping. DNA Res 6: 123–129[Abstract] Takakura Y, Ito T, Saito H, Inoue T, Komari T, Kuwata S (2000) Flower-predominant expression of a gene encoding a novel class I chitinase in rice (Oryza sativa L). Plant Mol Biol 42: 883–897[CrossRef][Web of Science][Medline] Tapia-Lopez R, Garcia-Ponce B, Dubrovsky JG, Arroyo AG, Perez-Ruiz RV, Kim SH, Acevedo F, Pelaz S, Alvarez-Buylla ER (2008) An AGAMOUS-related MADS-box gene, XAL1 (AGL12), regulates root meristem cell proliferation and flowering transition in Arabidopsis. Plant Physiol 146: 1182–1192 Vander Jagt DL, Kolb NS, Vander Jagt TJ, Chino J, Martinez FJ, Hunsaker LA, Royer RE (1995) Substrate specificity of human aldose reductase: identification of 4-hydroxynonenal as an endogenous substrate. Biochim Biophys Acta 1249: 117–126[CrossRef][Medline] Vellosillo T, Martinez M, Lopez MA, Vicente J, Cascon T, Dolan L, Hamberg M, Castresana C (2007) Oxylipins produced by the 9-lipoxygenase pathway in Arabidopsis regulate lateral root development and defense responses through a specific signaling cascade. Plant Cell 19: 831–846 Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R, Schuch W, Giovannoni J (2002) A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science 296: 343–346 Wei ZM, Laby RJ, Zumoff CH, Bauer DW, He SY, Collmer A, Beer SV (1992) Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora. Science 257: 85–88 Xu L, Liu F, Wang Z, Peng W, Huang R, Huang D, Xie D (2001) An Arabidopsis mutant cex1 exhibits constant accumulation of jasmonate-regulated AtVSP, Thi21 and PDF12. FEBS Lett 494: 161–164[CrossRef][Web of Science][Medline] Zhao KJ, Chye ML (1999) Methyl jasmonate induces expression of a novel Brassica juncea chitinase with two chitin-binding domains. Plant Mol Biol 40: 1009–1018[CrossRef][Web of Science][Medline] Zhong GV, Burns JK (2003) Profiling ethylene-regulated gene expression in Arabidopsis thaliana by microarray analysis. Plant Mol Biol 53: 117–131[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|