Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

First published online March 28, 2008; 10.1104/pp.108.118174

Plant Physiology 147:169-178 (2008)
© 2008 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow A correction has been published
Right arrow All Versions of this Article:
147/1/169    most recent
pp.108.118174v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bhatia, S.
Right arrow Articles by Chattopadhyay, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bhatia, S.
Right arrow Articles by Chattopadhyay, S.
Agricola
Right arrow Articles by Bhatia, S.
Right arrow Articles by Chattopadhyay, S.
DEVELOPMENT AND HORMONE ACTION

SHORT HYPOCOTYL IN WHITE LIGHT1, a Serine-Arginine-Aspartate-Rich Protein in Arabidopsis, Acts as a Negative Regulator of Photomorphogenic Growth1,[W]

Shikha Bhatia, Sreeramaiah N. Gangappa, Ritu Kushwaha, Snehangshu Kundu and Sudip Chattopadhyay*

National Institute for Plant Genome Research, New Delhi 110067, India


   ABSTRACT
TOP
 ABSTRACT
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Light is an important factor for plant growth and development. We have identified and functionally characterized a regulatory gene SHORT HYPOCOTYL IN WHITE LIGHT1 (SHW1) involved in Arabidopsis (Arabidopsis thaliana) seedling development. SHW1 encodes a unique serine-arginine-aspartate-rich protein, which is constitutively localized in the nucleus of hypocotyl cells. Transgenic analyses have revealed that the expression of SHW1 is developmentally regulated and is closely associated with the photosynthetically active tissues. Genetic and molecular analyses suggest that SHW1 acts as a negative regulator of light-mediated inhibition of hypocotyl elongation, however, plays a positive regulatory role in light-regulated gene expression. The shw1 mutants also display shorter hypocotyl in dark, and analyses of shw1 cop1 double mutants reveal that SHW1 acts nonredundantly with COP1 to control hypocotyl elongation in the darkness. Taken together, this study provides evidences that SHW1 is a regulatory protein that is functionally interrelated to COP1 and plays dual but opposite regulatory roles in photomorphogenesis.

As photoautotrophs, plants are extremely sensitive to light environment (Huq and Quail, 2005Go; Jiao et al., 2007Go). Three distinct families of photoreceptors are known to perceive light: far-red light (FR) and red light (RL) by phytochromes (phyA to phyE), blue and UV-A light by cryptochromes (cry1 to cry3), and phototropins (phot1 and phot2). Recent studies have suggested that major activities of light signaling are concentrated in the nucleus (Chen et al., 2004Go; Huq and Quail, 2005Go). cry1 and cry2 are mostly in the nucleus, and recent studies suggest that cytoplasmic cry1 may have a distinct function other than the nuclear cry1 in photomorphogenic growth. Phytochromes are translocated into the nucleus upon light-mediated activation (Cashmore et al., 1999Go; Guo et al., 1999Go; Yamaguchi et al., 1999Go; Kircher et al., 2002Go; Lin, 2002Go; Nagy and Schafer, 2002Go; Schepens et al., 2004Go; Wu and Spalding, 2007Go).

Molecular characterization of genetically identified regulators has resulted in a dramatic progress in understanding the light signaling processes (Huq and Quail, 2005Go). Several regulatory proteins have been identified, which are involved in the transition of dark-grown skotomorphogenic growth to light-induced photomorphogenic growth (Chen et al., 2004Go; Jiao et al., 2007Go). The expression of about one-third of the total genes in Arabidopsis (Arabidopsis thaliana) genome is altered during the shift from skotomorphogenic to photomorphogenic growth (Ma et al., 2001Go; Tepperman et al., 2001Go). Photomorphogenesis is associated with several morphological and physiological alterations, which are otherwise suppressed during skotomorphogenic growth. These alterations include: inhibition of hypocotyl elongation, opening of apical hook, expansion of cotyledons, and accumulation of chlorophyll and anthocyanin (Whitelam et al., 1993Go; Neff et al., 2000Go; Wang and Deng, 2004Go).

COP1, a master repressor of photomorphogenesis, acts as an ubiquitin ligase and helps to degrade several photomorphogenesis promoting factors such as HY5, HYH, LAF1, and HFR1 in the dark (Ang et al., 1998Go; Wei and Deng, 1999Go; Osterlund et al., 2000Go; Holm et al., 2002Go; Seo et al., 2003Go; Yang et al., 2005Go). The cop1 mutant seedlings show photomorphogenic growth in dark, hypersensitive responses to light and develop less lateral roots as compared to wild-type plants (McNellis et al., 1994Go; Wang and Deng, 2004Go). Recent studies have shown that COP1 interacts with SPA1, another repressor of photomorphogenesis, and SPA1 acts as an associated factor of COP1 in proteasome-mediated degradation of HY5, HFR1, and LAF1 (Hoecker et al., 1999Go; Saijo et al., 2003Go; Seo et al., 2003Go; Laubinger et al., 2004Go; Jang et al., 2005Go).

Although many genes showing light signaling functions have been reported in Arabidopsis, similar information is not available in crop plants. Recent studies have revealed that at least some orthologous genes in crop plants may have additional or altered functions that are not detectable in Arabidopsis and vice versa (Liu et al., 2004Go; Giliberto et al., 2005Go; Chatterjee et al., 2006Go). For example, HP2 gene encodes the tomato (Solanum lycopersicum) homolog of DET1 and dramatic variations between Arabidopsis det1 and tomato hp2 phenotypes have been observed. Most interestingly, hp2 mutants do not display any strong visible phenotypes in darkness, however, det1 mutants display strong deetiolated phenotype in the dark (Mustilli et al., 1999Go).

Guided by the above observations, we carried out subtractive hybridization and identified several regulatory genes from light-grown chickpea (Cicer arietinum) seedlings. In this study, we report the functional characterization of one such regulator, SHORT HYPOCOTYL IN WHITE LIGHT1 (SHW1), involved in Arabidopsis seedling development. SHW1 encodes a Ser-Arg-Asp-rich protein that is localized in the nucleus both in dark- and light-grown Arabidopsis seedlings. Genetic and molecular analyses reveal that SHW1 acts as a negative regulator of light-mediated inhibition of hypocotyl elongation and is functionally interrelated to COP1, a master repressor of photomorphogenesis.


   RESULTS
TOP
 ABSTRACT
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Identification and Molecular Cloning of SHW1

Recent studies have revealed that some of the well-characterized light signaling genes in Arabidopsis have additional or altered functions in crop plants (Mustilli et al., 1999Go; Chatterjee et al., 2006Go; Giovannoni, 2007Go). Intrigued by such observations, we reasoned that there might be some genes in crop plants that are otherwise difficult to identify in Arabidopsis through functional approaches. We therefore performed subtractive complementary DNA (cDNA) hybridizations to identify genes that are either up- or down-regulated in 5-d-old light-grown chickpea seedlings. We have identified several regulatory genes from chickpea, and some of these genes' functions are still unknown in Arabidopsis. Here, we report the identification and functional characterization of one such gene, SHW1, in Arabidopsis that encodes a Ser-Arg-Asp-rich protein with a consensus nuclear localization signal (Fig. 1A ). SHW1 (At1g69935) consists of three introns and four exons (Fig. 1C) and appears to be a unique gene in Arabidopsis genome. To determine the effect of light on the expression of SHW1 during early seedling development in Arabidopsis, we used 5-d-old constant dark- or various light-grown seedlings for RNA gel-blot analysis. As shown in Figure 1B, although the expression of SHW1 was barely detectable in dark and in various wavelengths of light such as RL, FR, and blue light (BL), it was highly expressed in white light (WL).


Figure 1
View larger version (69K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. SHW1 codes for a Ser-Arg-Asp-rich protein. A, The amino acid sequence of SHW1. The Ser-rich region includes 9 to 57 amino acids. Arg-rich region includes 40 to 60 amino acids (bold letters). The NLS region includes 44 to 61 amino acids (underlined letters). The Asp-rich region includes 64 to 91 amino acids (letters in italics). The star indicates the stop codon. B, The light-regulated expression of SHW1. Five-day-old seedlings were grown in constant dark (D) or in various light conditions (WL, RL, BL, and FR) for RNA gel-blot analyses. Total RNA (20 µg) was loaded in each lane; rRNA is shown as the loading control. C, The schematic diagram of the T-DNA insertion sites in SHW1. The inverted triangles show the T-DNA insertion sites. The exons (EX) are shown in gray boxes. The numbers indicate the starting and ending nucleotides of each exon. D, Northern blot of 20 µg of total RNA isolated from 5-d-old WL-grown wild type (Col), shw1-1, and shw1-2 mutant seedlings; a 0.6-kb SHW1 DNA fragment was used as the probe. rRNA is shown as the loading control.

 

SHW1 Is Predominantly Expressed in WL and Its Expression Is Developmentally Regulated

To examine the tissue-specific expression pattern of SHW1, Arabidopsis transgenic lines containing 1-kb upstream sequence of SHW1 fused to the GUS reporter gene (SHW1 promoter-GUS) were generated. The promoter reporter construct was introduced into ecotype Columbia of Arabidopsis (Col-0) plants by stable transformation and several homozygous transgenic lines were generated. A representative transgenic line (as revealed by the GUS stain) was selected for further studies.

To further substantiate the northern-blot results in Figure 1B, we monitored the light inducibility of the SHW1 promoter in various light conditions. For this experiment, 4-d-old dark-grown seedlings were shifted to WL, specific wavelength or a combination of two wavelengths of light, and GUS activities were measured. The activity of the SHW1 promoter was strongly induced in WL and found to be about 3-fold higher after exposure to 48 h (Supplemental Fig. S1A). The promoter was also slightly induced in FR (about 1.5-fold), however, no induction SHW1 promoter was detected in RL or BL (Supplemental Fig. S1, B–D). On the other hand, the SHW1 promoter was induced to about 1.5- to 2-fold when exposed to a combination of two wavelengths of light (Supplemental Fig. S1E). Taken together, these results suggest that the SHW1 promoter is predominantly active in WL and in combination of at least two wavelengths of light.

To determine the tissue-specific expression, we stained the seedlings each day from the second day of germination in WL. As shown in Figure 2, A–D , the SHW1 promoter-GUS transgene was expressed in hypocotyl and cotyledons up to the fifth day after germination. Afterward, the expression of the transgene in hypocotyl gradually decreased and became undetectable in 8-d-old seedlings (Fig. 2, E–G). Furthermore, expression of the transgene in the cotyledons started becoming patchy from 9-d-old seedlings (Fig. 2, H and I). The activity of the SHW1 promoter was not detected in the roots at any stage of development (Fig. 2, A–I).


Figure 2
View larger version (131K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. Tissue-specific expression of SHW1. All seedlings or adult plants carrying SHW1 promoter-GUS transgene were grown in 14-h WL (30 µmol m–2 s–1) and 10-h dark cycles and used for GUS staining using 20 to 30 seedlings in each sample (Yadav et al., 2002Go). A to H, Seedlings of 2- to 9-d-old, respectively. The arrowhead indicates partly stained hypocotyl (E) and cotyledon (H). I, Seedlings of 15-d-old. The arrowhead indicates partly stained cotyledons. J, Leaf of 30-d-old plant. K and L, Inflorescence and flowers buds of 30-d-old plant. M to O, Green, partly dried and mostly dried siliques, respectively. The arrowheads indicate the residual GUS stain.

 
We then examined the expression of SHW1 in various tissues of adult plants. The expression of SHW1 promoter-GUS was detected in green tissues, including leaf, stem, sepal, and young siliques. Interestingly, as the siliques matured and accordingly the greenness of the organ reduced, the level of activity of the SHW1 promoter also gradually decreased (Fig. 2, M–O). Most strikingly, expression of the SHW1 promoter-GUS transgene was found to be patchy in older leaves and siliques with the expression confined to the green tissues (Fig. 2J, N, and O). Furthermore, the residual expression of the transgene was detected in a few seeds that were still partly green in an otherwise dried silique (Fig. 2O). Although the reason for the patchy expression pattern of the SHW1 promoter-GUS transgene is presently unclear, collectively these data suggest that the expression of SHW1 is developmentally regulated and more prominent in photosynthetically active tissues.


Isolation and Characterization of Mutations in SHW1

To determine the in vivo function of SHW1, we searched for mutants in T-DNA knockout collections (Alonso et al., 2003Go). Two independent mutant lines with T-DNA insertion at the first exon of SHW1 or at the upstream promoter region of SHW1 were identified and the corresponding alleles were designated as shw1-1 and shw1-2, respectively (Fig. 1C). We carried out PCR genotyping analyses to determine plants that are homozygous or heterozygous for shw1-1 or shw1-2 mutations. The segregation of self-fertilized plants heterozygous for shw1-1 or shw1-2 was monitored. The segregation ratios determined by the analyses of genotyping PCR in T2 progeny suggested that a single T-DNA locus was present in the shw1-1 or shw1-2 mutant line. To further test these results, we performed backcrosses of shw1 mutant plants with the corresponding wild type (Col-0); and analyses of the segregation ratios in the F2 population confirmed a single genetic locus insertion of T-DNA in shw1 mutant plants. The T-DNA was tightly linked to the mutation, and the drug resistance marker (kanamycin) of T-DNA segregated with the shw1 mutation. The junctions of T-DNA and SHW1 were amplified by PCR and the analysis of DNA sequences revealed that the T-DNA was inserted at nucleotide position 53 of exon1 in shw1-1 or at nucleotide position 187 upstream to start codon in shw1-2 (Fig. 1C). Whereas RNA gel-blot analyses could not detect any transcript encoded by SHW1 in the shw1-1 mutant, the level of transcript was significantly reduced in the shw1-2 mutant background (Fig. 1D).


shw1 Mutants Exhibit Morphological Defects Both in Dark and WL

To determine whether shw1 mutants have any morphological defect, we examined the growth of 6-d-old shw1 and wild-type seedlings grown in constant dark or WL. The dark-grown shw1 mutants displayed significantly (P < 0.01) shorter hypocotyl with drastic reduction in apical hook curvature compared to wild-type seedlings (Fig. 3A, K, and Q ). In WL, the shw1 mutants exhibited enhanced inhibition in hypocotyl elongation as compared to corresponding wild-type seedlings (Fig. 3, B–E, I, and J). Measurements of hypocotyl length revealed that 6-d-old WL grown shw1 mutant seedlings had significantly shorter hypocotyl (P < 0.01) than wild-type seedlings (Fig. 3, M and L), and the enhanced inhibition of hypocotyl elongation in shw1 mutants was more prominent at lower fluence rates of WL (Fig. 3, B–E, and M). To determine whether the shw1 mutants have similar altered morphology in a particular wavelength of light, we examined the growth of 6-d-old seedlings under various wavelengths of light such as RL, FR, and BL (Fig. 3, F–H). However, no significant reduction in hypocotyl length was observed in any of these light conditions at various fluence rates tested (Fig. 3, N–P). Taken together, these results demonstrate that SHW1 acts as a negative regulator of photomorphogenic growth in dark and at lower fluence rates of WL irradiation. These results further demonstrate that the negative regulatory role of SHW1 is not specific to a particular wavelength of light.


Figure 3
View larger version (80K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. The shw1 mutants show short hypocotyl phenotype. A, Six-day-old constant dark-grown seedlings. Wild-type (Col), shw1-1, and shw1-2 seedlings are shown from left to right, respectively. B, Six-day-old constant WL (5 µmol m–2 s–1) grown seedlings. C, Six-day-old constant WL (15 µmol m–2 s–1) grown seedlings. D, Six-day-old constant WL (30 µmol m–2 s–1) grown seedlings. E, Six-day-old constant WL (60 µmol m–2 s–1) grown seedlings. F, Six-day-old constant RL (15 µmol m–2 s–1) grown seedlings. G, Six-day-old constant FR (15 µmol m–2 s–1) grown seedlings. H, Six-day-old constant BL (15 µmol m–2 s–1) grown seedlings. I, Six-day-old constant WL (5 µmol m–2 s–1) grown seedlings. J, Six-day-old constant WL (15 µmol m–2 s–1) grown seedlings. K, Hypocotyl length of 6-d-old constant dark-grown seedlings. L, Hypocotyl length of 6-d-old constant WL (5 µmol m–2 s–1) grown seedlings. M, Hypocotyl length of 6-d-old constant WL grown wild type (Col) and shw1-1 mutant seedlings at various fluence rates. N, Hypocotyl length of 6-d-old constant RL grown wild type (Col) and shw1-1 mutant seedlings at various fluence rates. O, Hypocotyl length of 6-d-old constant FR-grown wild type (Col) and shw1-1 mutant seedlings at various fluence rates. P, Hypocotyl length of 6-d-old constant BL-grown wild type and shw1-1 mutant seedlings at various fluence rates. Q, The quantification of curvature of apical hooks of 6-d-old wild type (Col), shw1-1, and shw1-2 mutant seedlings grown in constant darkness.

 
We then asked whether the shw1 mutants have any altered morphology in the later stage of development. Examination of growth of adult plants and the flowering time revealed that shw1 mutation caused delayed flowering under long-day conditions (16-h light and 8-h darkness). Whereas long-day-grown wild-type plants started flowering after the formation of about eight rosette leaves, the shw1 mutants flowered after 12 rosette leaves formed (Fig. 4, A and C ). However, this effect was not observed in short-day-grown plants (8-h light and 16-h darkness). Examination of root growth of shw1 mutant plants revealed that 16-d-old mutant plants developed significantly fewer lateral roots as compared to wild-type plants (Fig. 4, B and D). Taken together, these results suggest that although SHW1 acts as a negative regulator of photomorphogenic growth, it positively regulates flowering time and lateral root formation.


Figure 4
View larger version (67K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. Phenotypes of shw1 adult plants. A, Three-week-old wild type (Col) and shw1-1 mutant plants grown under long-day cycles of 16-h WL (90 µmol m–2 s–1) and 8-h dark. B, The root growth of 16-d-old wild type (Col) and shw1-1 mutant plants grown in long-day cycles of 14-h WL (90 µmol m–2 s–1) and 10-h darkness. C, Quantification of the number of rosette leaves formed at bolting. D, Quantification of lateral roots formed at various days.

 

Mutation in SHW1 Results in Reduced Chlorophyll Accumulation and Expression of Light-Regulated Genes

Accumulation of chlorophyll and anthocyanin are two physiological responses controlled by light signaling. To determine the role of SHW1 in chlorophyll and anthocyanin accumulation, we quantified chlorophyll and anthocyanin contents in shw1 mutant seedlings and compared with the corresponding wild-type background. As shown in Figure 5, A and E , the accumulation of chlorophyll was significantly reduced in shw1 mutants as compared to wild-type background, suggesting that SHW1 is required for the optimum level of chlorophyll accumulation. The level of anthocyanin remained similar to wild-type background in WL, however, there was a significant increase in the anthocyanin level in shw1 mutants in dark (Figs. 5B and 7G).


Figure 5
View larger version (23K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 5. Chlorophyll and anthocyanin contents and the expression of light-inducible genes in shw1 mutants. A, Accumulation of chlorophyll in 6-d-old constant WL (30 µmol m–2 s–1) grown wild type (Col) and shw1-1 mutant seedlings. B, Accumulation of anthocyanin in 6-d-old constant WL (30 µmol m–2 s–1) grown wild type (Col) and shw1-1 mutant seedlings. C, Quantification of RNA gel-blot analysis data of CAB1 in wild type (Col) and shw1-1 mutant seedlings. Five-day-old dark-grown seedlings were transferred to WL for 2, 4, and 8 h. Five-day-old dark-grown seedlings have been shown as 0 h. The experiment was repeated three times. The intensity of each band in autoradiograph was quantified by the Fluor-S-MultiImager (Bio-Rad) and ratios of the CAB1 gene versus its corresponding 18S rRNA band were determined and plotted (Fluor-S-MultiImager; Bio-Rad). D, Quantification of RNA gel-blot analysis data of RBCS in wild type (Col) and shw1-1 mutant seedlings. For experimental detail see legend to Figure 5C. E, Accumulation of chlorophyll in the cotyledons after normalized by cotyledon size in 6-d-old constant WL (30 µmol m–2 s–1) grown wild type (Col) and shw1-1 mutant seedlings.

 

Figure 7
View larger version (54K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 7. Characterization of shw1 cop1 double mutants. A and B, Visible phenotype of 6-d-old wild type and various mutant seedlings (all in Col background) grown in constant dark and WL (15 µmol m–2 s–1), respectively. C and D, Hypocotyl length of 6-d-old wild type and different mutant seedlings grown in constant dark and WL (5 µmol m–2 s–1), respectively. E, Visible fusca phenotype in 6-d-old cop1-6 and shw1 cop1-6 mutant seedlings grown in constant WL (60 µmol m–2 s–1). F, Percentage of fusca phenotype in WL (60 µmol m–2 s–1) grown seedlings. G, Accumulation of anthocyanin in 6-d-old constant dark-grown wild type (WT) and various mutant seedlings. H, Accumulation of anthocyanin in 6-d-old constant WL (60 µmol m–2 s–1) grown wild type (WT) and various mutant seedlings. I, Percentage of seedlings turned green whereas 5-d-old dark-grown seedlings were transferred to WL for 2 d.

 
We carried out RNA gel-blot analyses to determine the possible role of SHW1 in the regulation of light-inducible gene expression. For this experiment, 5-d-old constant dark-grown seedlings were transferred to WL for 2, 4, and 8 h and the transcript levels of CAB and RBCS were measured. As shown in Figure 5, C–D, the level of light-mediated induction of CAB and RBCS expression was significantly reduced in shw1 mutants as compared to wild-type background. Taken together, these results indicate that SHW1 plays a positive regulatory role for WL-mediated induction of CAB and RBCS gene expression.


SHW1 Is Constitutively Localized in the Nucleus

The light-dependent shuttling of regulatory proteins between cytosol and nucleus has been shown to be crucial in controlling photomorphogenic growth in Arabidopsis (Jiao et al., 2007Go). SHW1 has a consensus nuclear localization signal (Fig. 1A). To determine the subcellular localization of SHW1, and also to investigate whether subcellular localization of SHW1 is light dependent, we generated Arabidopsis transgenic lines containing SHW1-GUS transgene expressed under a 1-kb upstream DNA fragment of SHW1. To test the functionality of SHW1-GUS fusion protein, we introduced SHW1-GUS transgene into the shw1 mutant background by genetic crosses. The measurement of hypocotyl length revealed that the mutant transgenic lines displayed hypocotyl length similar to wild-type seedlings in WL (Supplemental Fig. S2). To determine the GUS staining pattern, we used hypocotyl cells of 3-d-old transgenic seedlings grown in constant dark or WL. In either dark- or light-grown seedlings, the GUS stain was exclusively visible in the nucleus (Fig. 6, A–D ). These results demonstrate that SHW1 is constitutively localized in the nucleus either in dark- or light-grown Arabidopsis seedlings.


Figure 6
View larger version (82K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 6. Subcellular localization of SHW1 in hypocotyl cells of transgenic seedlings. The hypocotyls of transgenic seedlings containing SHW1-GUS transgene expressed under SHW1 promoter were stained for GUS (A and C), and for DNA using DAPI to identify nuclei (B and D). The arrowheads indicate nuclei. The hypocotyl cells of 3-d-old constant dark- or WL-grown seedlings were used for NLS studies (von Arnim and Deng, 1994Go). A and B, Hypocotyl cells of dark-grown seedlings. C and D, Hypocotyl cells of WL-grown seedlings.

 

The Photomorphogenic Growth of cop1 Mutants Is Further Enhanced by the Additional Loss of SHW1 Function in Dark

A group of repressors, COP/DET/FUS, acts downstream to multiple photoreceptors to repress photomorphogenesis (Wei and Deng, 1999Go; Jiao et al. 2007Go). Among them, COP1 has been studied in detail and is considered as a key repressor of photomorphogenic growth. The cop1 mutants display photomorphogenic growth in the dark and are hypersensitive to light. Since shw1 mutants display shorter hypocotyl in the dark and enhanced inhibition in hypocotyl elongation in WL, we asked whether SHW1 was functionally related to COP1. To address this question, we constructed shw1-1 cop1-6 double mutants. Since the null alleles of cop1 are seedling lethal, we selected a relatively weak allele of cop1 (cop1-6) for our studies (McNellis et al., 1994Go).

We examined the growth of shw1 cop1 double mutants and the corresponding single mutants in dark and WL. The shw1 cop1 double mutants exhibited shorter hypocotyl than cop1 or shw1 single mutants in constant darkness (Fig. 7, A and C ). However, shw1 cop1 double mutants exhibited similar hypocotyl length to cop1-6 in WL (Fig. 7, B and D). These results indicate that shw1 and cop1 act in an additive manner in repressing photomorphogenic growth in dark. However, enhanced inhibition of hypocotyl elongation of shw1 mutants in WL requires functional COP1 protein.

The cop1 mutants exhibit dark-purple color fusca phenotype due to high-level accumulation of anthocyanin, however, such effects are not visible in shw1 mutants. The percent of fusca phenotype, when examined, was dramatically increased in shw1 cop1 double mutants as compared to cop1 alone (Fig. 7, E and F). Consistent with this observation, the quantification of anthocyanin levels revealed a drastic increase in anthocyanin accumulation in shw1 cop1 double mutants as compared to cop1 single mutants either in dark or WL conditions (Fig. 7, G and H).

The cop1 mutants are hypersensitive to light, and some of them are unable to turn green while dark-grown cop1 seedlings are transferred to light. This physiological response of cop1 mutants, known as COP1-mediated blocking of greening phenotype, becomes more severe with longer incubation in the darkness (Ang and Deng, 1994Go). To determine whether SHW1 can modulate cop1-mediated blocking of greening phenotype, we examined the blocking of greening effects in shw1 cop1 double mutants. A significantly higher percentage of shw1 cop1 double mutants were able to turn green when 5-d-old dark-grown seedlings were transferred to light, suggesting that shw1 can partly suppress the blocking of greening phenotype of cop1 (Fig. 7I).


   DISCUSSION
TOP
 ABSTRACT
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 LITERATURE CITED
 
Analyses of shw1 mutants have revealed that the light-mediated enhanced inhibition of hypocotyl elongation is restricted to WL with no visible effect in RL, FR, or BL. Whereas several photomorphogenic mutants show wavelength-specific phenotypes without displaying any morphological defect in WL, several other loss-of-function mutants exhibit phenotype both in WL and in specific wavelength of light. Additionally, mutants of several wavelength-specific negative regulators of seedling development including PIF3, SUB1, SPA1, MYC2, and GBF1 show hypersensitive responses in light, however, exhibit complete etiolation similar to wild-type seedlings in dark (Parks and Quail, 1993Go; Guo et al., 2001Go; Holm et al., 2002Go; Laubinger et al., 2004Go; Wang and Deng, 2004Go; Huq and Quail, 2005Go; Yadav et al., 2005Go; Mallappa et al., 2006Go). Therefore, this study reveals that SHW1 is a unique negative regulator of photomorphogenic growth.

The Ser- and Arg-rich domains are commonly found in the SR protein family, which plays important roles in constitutive and alternative splicing of pre-mRNA in eukaryotes (Black, 2003Go). Interestingly, whereas the Ser- and Arg-rich domains are well separated from each other in SR proteins, both these two domains are present at the N-terminal end and are overlapped in SHW1 protein. SR proteins are fairly conserved in higher plant and animal systems. However, SHW1 does not have any homolog in the animal system or in lower eukaryotes, suggesting it is likely to be evolved as a plant-specific protein. Recent studies have revealed that there are at least 19 and 20 SR proteins in Arabidopsis and rice (Oryza sativa), respectively, and SHW1 is not included in this family of proteins (Lorkovic and Barta, 2002Go; Reddy, 2004Go; Isshiki et al., 2006Go). SHW1 appears to be a single-copy gene in the Arabidopsis genome, and the protein shows homology to unknown proteins from rice and grape (Vitis vinifera). The consensus sequences derived from these homologs, and the alignment of SHW1 with these proteins are shown in Supplemental Figure 3.

The morphological analyses of shw1 mutants clearly demonstrate that the short hypocotyl phenotype of shw1 seedlings is restricted to dark light and WL with no significant effect in RL, FR, or BL. It appears that shw1 mutants may have a weak phenotype in RL, especially at 60 µmol m–2 s–1 fluences (Fig. 3N). However, measurement of hypocotyl length revealed that the difference in hypocotyl length between the wild type and shw1 was not statistically significant (n = 120; P ~ 0.08). The negative regulatory role of SHW1 in light-mediated inhibition of hypocotyl elongation is thereby confined to WL, likely to be a cumulative effect mediated by multiple photoreceptors.

Examination of tissue-specific expression reveals that SHW1 is expressed in all tissue types tested except in roots, and the gene is predominantly expressed in photosynthetically active tissues. Interestingly, although we did not detect any expression of SHW1 in the root tissue, the microarray data available in the public domain apparently suggest that the gene is also expressed in roots (www.genevestigator.ethz.ch). It could be envisioned that the root-specific cis-acting elements involved in the expression of SHW1 in roots are outside the length of the promoter used in this study. Alternatively, the expression level of SHW1 is extremely low in roots and is beyond the sensitivity level of the reporter gene used in this study. Similar arguments could also be applicable for the weak activity of the SHW1 promoter in the specific wavelength of light (Supplemental Fig. 1).

Analyses of the light-regulated gene expression reveal that the rate of light-mediated induction of CAB and RBCS gene expression was significantly compromised in shw1 mutants indicating that SHW1 is required for the optimal expression of light-inducible genes. Thus, SHW1 plays an opposite regulatory function in photomorphogenic growth and light-regulated gene expression. Several regulatory genes involved in seedling development have been described previously that function as positive as well as negative regulators of light responses (Ward et al., 2005Go; Kang and Ni, 2006Go; Jiao et al., 2007Go). For example, PIF3, a bHLH transcription factor, is a negative regulator of photomorphogenic growth, however, acts as a positive regulator of light-regulated gene expression (Kim et al., 2003Go). GBF1/ZBF2, a bZIP transcription factor, acts as a negative regulator of inhibition of hypocotyl elongation, however, acts as a positive regulator of cotyledon expansion. Furthermore, GBF1/ZBF2 differentially regulates the expression of light-regulated genes (Mallappa et al., 2006Go).

Light-controlled shuttling of COP1 protein between the nucleus and cytoplasm is an important regulatory mechanism of light-mediated seedling development (von Arnim and Deng, 1994Go; Osterlund and Deng, 1998Go; Jiao et al., 2007Go). COP1 degrades several photomorphogenesis promoting factors in the dark to suppress photomorphogenic growth in the darkness (Jiao et al., 2007Go). It has been shown that mutations at COP2, COP3, and COP4 result in cotyledon expansion in darkness (Hou et al., 1993Go). However, these loci are not involved in hypocotyl elongation and in light-regulated gene expression. It has been postulated from such observations that these less pleiotropic loci act as downstream-branched pathways of the highly pleiotropic photomorphogenic regulatory loci such as COP1 and regulate subsets of seedling morphogenic responses to light. The analyses of shw1 cop1 double mutants in this study suggest that SHW1 and COP1 function nonredundantly to control hypocotyl elongation in dark. On the other hand, in WL, enhanced inhibition in hypocotyl elongation in shw1 mutants requires functional COP1 protein. The physiological responses of cop1 mutants are also altered by additional loss of SHW1 function. Thus, collectively, these data imply a role of SHW1 in downstream-branched pathways of COP1, similar to COP2, COP3, or COP4, in Arabidopsis seedling development.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
LITERATURE CITED
 

Plant Materials and Growth Conditions

Arabidopsis (Arabidopsis thaliana) seeds were surface sterilized and sown on Murashige and Skoog plates, then kept at 4°C in darkness for 3 to 5 d, and transferred to specific light conditions at 22°C. The intensities of WL and various color lights (in the light-emitting diode chamber, Q-Beam 3200–A; Quantum Devices) used were described in Yadav et al. (2002)Go.

To obtain the homozygous shw1 mutant lines, plants heterozygous or homozygous for the shw1-1 or shw1-2 mutations were examined by PCR genotyping analyses. Individual plants were examined by PCR using the left border specific primer LBP (5'-GCGTGGACCGCTTGCTGCACCT-3') and the shw1-1 specific primers LP11 (5'-TGCAAAAGACACCTGCAAATCA-3') and RP11 (5-'ATGCAA AGAACCGAGAGGTCG-3'); or shw1-2 specific primers LP9 (TCACCACCGCCGAAGAATCTA) and RP9 (ACCCAATCGGTCCATGTCCTT).

For the generation of double mutants, such as shw1-1 cop1-6, homozygous shw1-1 (Col-0) mutant plants were genetically crossed with cop1-6 (Col-0) homozygous mutant lines. In the F2 generation, seedlings were grown in WL (90 µmol s–1 m–2) for the identification of cop1 homozygous lines, and short hypocotyl cop1 mutants were selected and transferred to soil. To determine the genotype at shw1 locus, about 40 seedlings from each line were tested by genomic PCR. F3 progenies that were homozygous for shw1-1 mutant plants were further examined and considered as shw1-1 cop1-6 double mutants.


GUS Assays and NLS Studies

For the generation of transgenic lines, a 1-kb upstream DNA sequence of SHW1 gene was amplified by PCR using the primers (forward 5'-GGAATTCTTACGTTGAAGGAACATTC-3' and reverse 5'-CATGCCATGGAATTAAAACGGACCTTTTTG-3'), and cloned into EcoRI + NcoI site of pCAMBIA recombinant vector containing SHW1 in frame fused to GUS or GUS alone. Agrobacterium strain GV3101 was transformed with the recombinant constructs, and wild-type ecotype Wassilewskija of Arabidopsis plants were transformed using Agrobacterium carrying recombinant pCAMBIA construct by the vacuum infiltration method. Transgenic plants were screened on 15 µg/mL hygromycin plates and several independent lines of homozygous transgenic plants containing the transgene were generated. Nuclear localization signal (NLS) studies were carried out as described in von Arnim and Deng (1994)Go. GUS activity measurements were carried out essentially as described in Yadav et al. (2002)Go.


Subtractive cDNA Library

Total RNA was isolated from 5-d-old constant dark- or light-grown chickpea (Cicer arietinum) seedlings using Tripure reagent (Tripure; Roche). The polyA-RNA was purified using the mRNA isolation kit (Roche) according to manufacturer protocol. The subtractive cDNA library was constructed from polyA-RNA using Clontech kit (Clontech) according to the manufacturer's procedure.


Northern-Blot Analyses

Total RNA was extracted using the RNeasy plant minikit (QIAGEN). Northern-blot analyses with 20 µg of total RNA for each sample was carried out essentially as described in Hettiarachchi et al. (2003)Go. The 0.6-kb SHW1 DNA fragment was used as probe after random prime labeling (Amersham). The DNA fragments of CAB1 and RBCS genes were used for probes as described in Yadav et al. (2005)Go. The 18S ribosomal RNA was used as loading control. The intensity of each band in the autoradiograph was quantified by the Fluor-S-MultiImager (Bio-Rad) and ratios of the CAB1 or RBCS gene versus its corresponding 18S ribosomal RNA (rRNA) band were determined and plotted (Fluor-S-MultiImager; Bio-Rad).


Chlorophyll and Anthocyanin Measurements

Chlorophyll and anthocyanin levels were measured following protocols as described in Holm et al. (2002)Go.

Sequence data from this article have been deposited with the EMBL/GenBank data libraries under accession number AM419013.


Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Light-mediated induction of SHW1 promoter.
Supplemental Figure S2. Functional analyses of SHW1-GUS fusion protein.
Supplemental Figure S3. Alignment of protein sequence of SHW1.


   ACKNOWLEDGMENTS
 
We thank Ashis Nandi (Jawaharlal Nehru University) for reading and critically commenting on this manuscript, and Sudeepa Mukherjee and Babu Rajendra Prasad for the technical assistance.

Received February 20, 2008; accepted March 13, 2008; published March 28, 2008.


   FOOTNOTES
 
1 This work was supported by the core grant of the National Institute for Plant Genome Research (to S.C.), Council of Scientific and Industrial Research fellowships (to S.N.G. and S.K.), and a University Grants Commission of India fellowship (to R.K.). Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Sudip Chattopadhyay (sudipchatto{at}yahoo.com).

[W] The online version of this article contains Web-only data. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.108.118174

* Corresponding author; e-mail sudipchatto{at}yahoo.com.


   LITERATURE CITED
TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657[Abstract/Free Full Text]

Ang LH, Chattopadhyay S, Wei N, Oyama T, Okada K, Batschauer A, Deng XW (1998) Molecular interaction between COP1 and HY5 defines a regulatory switch for light control of Arabidopsis development. Mol Cell 1: 213–222[CrossRef][Web of Science][Medline]

Ang LH, Deng XW (1994) Regulatory hierarchy of photomorphogenic loci: allele-specific and light-dependent interaction between the HY5 and COP1 loci. Plant Cell 6: 613–628[Abstract/Free Full Text]

Black DL (2003) Mechanisms of alternative pro-messenger RNA splicing. Annu Rev Biochem 72: 291–336[CrossRef][Web of Science][Medline]

Cashmore AR, Jarillo JA, Wu YJ, Liu D (1999) Cryptochromes: blue light receptors for plants and animals. Science 284: 760–765[Abstract/Free Full Text]

Chatterjee M, Sharma P, Khurana JP (2006) Cryptochrome 1 from Brassica napus is up-regulated by blue light and controls hypocotyl/stem growth and anthocyanin accumulation. Plant Physiol 141: 61–74[Abstract/Free Full Text]

Chen M, Chory J, Fankhauser C (2004) Light signal transduction in higher plants. Annu Rev Genet 38: 87–117[CrossRef][Web of Science][Medline]

Giliberto L, Perrotta G, Pallara P, Weller JL, Fraser PD, Bramley PM, Fiore A, Tavazza M, Giuliano G (2005) Manipulation of blue light photoreceptor cryptochrome 2 in tomato affects vegetative development, flowering time and fruit antioxidant content. Plant Physiol 137: 199–208[Abstract/Free Full Text]

Giovannoni J (2007) Fruit ripening mutants yield insights into ripening control. Curr Opin Plant Biol 10: 283–289[CrossRef][Web of Science][Medline]

Guo H, Duong H, Ma N, Lin C (1999) The Arabidopsis blue light receptor cryptochrome 2 is a nuclear protein regulated by a blue light-dependent post-transcriptional mechanism. Plant J 19: 279–87[CrossRef][Web of Science][Medline]

Guo H, Mocker T, Duong H, Lin C (2001) SUB1, an Arabidopsis Ca2+-binding protein involved in cryptochrome and phytochrome coaction. Science 291: 487–490[Abstract/Free Full Text]

Hettiarachchi GHCM, Yadav V, Reddy MK, Chattopadhyay S, Sopory SK (2003) Light-mediated regulation defines a minimal promoter region of TOP2. Nucleic Acids Res 31: 5256–5265[Abstract/Free Full Text]

Hoecker U, Tepperman JM, Quail PH (1999) SPA1, a WD-repeat protein specific to phytochrome A-specific signal transduction. Science 284: 496–499[Abstract/Free Full Text]

Holm M, Ma LG, Qn LJ, Deng XW (2002) Two interacting bZIP proteins are direct targets of COP1-mediated control of light-dependent gene expression in Arabidopsis. Genes Dev 16: 1247–1259[Abstract/Free Full Text]

Hou Y, von Arnim AG, Deng XW (1993) A new class of Arabidopsis constitutive photomorphogenic genes involved in regulating cotyledon development. Plant Cell 5: 329–339[Abstract]

Huq E, Quail PH (2005) Phytochrome signaling. In WR Briggs and JL Spudich, eds, Handbook of Photosensory Receptors. Wiley VCH, Weinheim, Germany, pp 151–170

Isshiki M, Tsumoto A, Shimamoto K (2006) The serine/arginine-rich protein family in rice plays important roles in constitutive and alternative splicing of pre-mRNA. Plant Cell 18: 146–158[Abstract/Free Full Text]

Jang IC, Yang JY, Seo HS, Chua NH (2005) HFR1 is targeted by COP1 E3 ligase for post-translational proteolysis during phytochrome A signaling. Genes Dev 19: 593–602[Abstract/Free Full Text]

Jiao Y, Lau OS, Deng XW (2007) Light-regulated transcriptional networks in higher plants. Nat Rev Genet 8: 217–230[CrossRef][Web of Science][Medline]

Kang X, Ni M (2006) Arabidopsis SHORT HYPOCOTYL UNDER BLUE1 contains SPX and EXS domains and acts in cryptochrome signaling. Plant Cell 18: 921–934[Abstract/Free Full Text]

Kim J, Yi H, Choi G, Shin B, Song PS, Choi G (2003) Functional characterization of phytochrome interacting factor 3 in phytochrome mediated light signal transduction. Plant Cell 15: 2399–2407[Abstract/Free Full Text]

Kircher S, Kozma-Bognar L, Kim L, Adam E, Harter K, Schafer E, Nagy F (2002) Nucleocytoplasmic partitioning of the plant photoreceptors phytochrome A, B, C, D, and E is regulated differentially by light and exhibits a diurnal rhythm. Plant Cell 14: 1541–1555[Abstract/Free Full Text]

Laubinger S, Fittingoff K, Hoecker U (2004) The SPA quartet: a family of WD-repeat proteins with a central role in suppression of photomormogenesis in Arabidopsis. Plant Cell 16: 2293–2306[Abstract/Free Full Text]

Lin C (2002) Blue light receptors and signal transduction. Plant Cell 14: S207–S225[Free Full Text]

Liu Y, Roof S, Ye Z, Barry C, Tuinen A, Vrebalov J, Bowler C, Giovannoni J (2004) Manipulation of light signal transduction as a means of modifying fruit nutritional quality in tomato. Proc Natl Acad Sci USA 101: 9897–9902[Abstract/Free Full Text]

Lorkovic ZJ, Barta A (2002) Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res 30: 623–635[Abstract/Free Full Text]

Ma L, Li J, Qu L, Hager J, Chen Z, Zhao H, Deng XW (2001) Light control of Arabidopsis development entails coordinated regulation of genome expression and cellular pathways. Plant Cell 13: 2589–2607[Abstract/Free Full Text]

Mallappa C, Yadav V, Negi P, Chattopadhyay S (2006) A bzip transcription factor, GBF1, regulates blue light mediated photomorphogenic growth in Arabidopsis. J Biol Chem 281: 22190–22199[Abstract/Free Full Text]

McNellis TW, von Arnim AG, Deng XW (1994) Expression of Arabidopsis COP1 results in partial suppression of light-mediated development: evidence for a light-inactivable repressor of photomorphogenesis. Plant Cell 6: 1391–400[Abstract]

Mustilli AC, Fenzi F, Ciliento R, Alfano F, Bowler C (1999) Phenotype of the tomato high pigment-2 mutant is caused by a mutation in the tomato homolog of DEETIOLATED1. Plant Cell 11: 145–157[Abstract/Free Full Text]

Nagy F, Schafer E (2002) Phytochromes control photomorphogenesis by differentially regulated, interacting signaling pathways in higher plants. Annu Rev Plant Biol 53: 329–55[CrossRef][Medline]

Neff MM, Fanhauser C, Chory J (2000) Light: an indicator of time and place. Genes Dev 14: 257–271[Free Full Text]

Osterlund MT, Deng XW (1998) Multiple photoreceptors mediate the light induced reduction of GUS-COP1 from Arabidopsis hypocotyl nuclei. Plant J 16: 201–208[CrossRef][Web of Science][Medline]

Osterlund MT, Hardtke CS, Wei N, Deng XW (2000) Targeted destabilization of HY5 during light-regulated development of Arabidopsis. Nature 405: 462–466[CrossRef][Medline]

Parks BM, Quail PH (1993) hy8, a new class of Arabidopsis long hypocotyl mutants deficient in functional phytochrome A. Plant Cell 5: 39–48[Abstract/Free Full Text]

Reddy AS (2004) Plant serine/arginine-rich proteins and their role in pre-mRNA spicing. Trends Plant Sci 9: 541–547[CrossRef][Web of Science][Medline]

Saijo Y, Sullivan JA, Wang H, Yang J, Shen Y, Rubio V, Ma L, Hoecker U, Deng XW (2003) The COP1-SPA1 interaction defines a critical step in phytochrome A-mediated regulation of HY5 activity. Genes Dev 17: 2642–2647[Abstract/Free Full Text]

Schepens I, Duek P, Fankhauser C (2004) Phytochrome-mediated light signalling in Arabidopsis. Curr Opin Plant Biol 7: 564–9[CrossRef][Web of Science][Medline]

Seo HS, Yang JY, Ishikawa M, Bole C, Ballesteros ML, Chua NH (2003) LAF1 ubiquitination by COP1 controls photomorphogenesis and is stimulated by SPA1. Nature 423: 995–999[CrossRef][Medline]

Tepperman JM, Zhu T, Chang HS, Wang X, Quail PH (2001) Multiple transcription factor genes are early targets of phytochrome signaling. Proc Natl Acad Sci USA 98: 9437–9442[Abstract/Free Full Text]

von Arnim AG, Deng XW (1994) Light inactivation of Arabidopsis photomorphogenic repressor COP1 involves a cell-specific regulation of its nucleocytoplasmic partitioning. Cell 79: 1035–1045[CrossRef][Web of Science][Medline]

Wang H, Deng XW (April 4, 2004) Phytochrome signaling mechanisms. In CR Somerville, EM Meyerowitz, eds, The Arabidopsis Book. American Society of Plant Physiologists, Rockville, MD, doi: 10.1199/tab.0016, http://www.aspb.org/publications/arabidopsis/

Ward JM, Cufr CA, Denzel MA, Neff MM (2005) The Dof domain transcription factor OBP3 modulates phytochrome and cryptochrome signaling in Arabidopsis. Plant Cell 17: 475–485[Abstract/Free Full Text]

Wei N, Deng XW (1999) Making sense of the COP9 signalosome: a regulatory protein complex conserved from Arabidopsis to human. Trends Genet 15: 98–103[CrossRef][Web of Science][Medline]

Whitelam GC, Johnson E, Peng J, Carol P, Anderson ML, Cowl JS, Harberd NP (1993) Phytochrome A null mutants of Arabidopsis display a wild-type phenotype in white light. Plant Cell 5: 757–68[Abstract/Free Full Text]

Wu G, Spalding EP (2007) Separate functions for nuclear and cytoplasmic cryptochrome 1 during photomorphogenesis of Arabidopsis seedlings. Proc Natl Acad Sci USA 104: 18813–18818[Abstract/Free Full Text]

Yadav V, Kundu S, Chattopadhyay D, Negi P, Wei N, Deng XW, Chattopadhyay S (2002) Light regulated modulation of Z-box containing promoters by photoreceptors and downstream regulatory components, COP1 and HY5, in Arabidopsis. Plant J 31: 741–753[CrossRef][Web of Science][Medline]

Yadav V, Mallappa C, Gangappa NS, Bhatia S, Chattopadhyay S (2005) A basic helix-loop-helix transcription factor in Arabidopsis, MYC2, acts as a repressor of blue light-mediated photomorphogenic growth. Plant Cell 17: 1953–1966[Abstract/Free Full Text]

Yamaguchi R, Nakamura M, Mochizuki N, Kay SA, Nagatani A (1999) Light-dependent translocation of a phytochrome B-GFP fusion protein to the nucleus in transgenic Arabidopsis. J Cell Biol 145: 437–45[Abstract/Free Full Text]

Yang J, Lin R, Roecker U, Liu B, Xu L, Wang H (2005) Repression of light signaling by Arabidopsis SPA1 involves post-translational regulation of HFR1 protein accumulation. Plant J 43: 131–141[CrossRef][Web of Science][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow A correction has been published
Right arrow All Versions of this Article:
147/1/169    most recent
pp.108.118174v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bhatia, S.
Right arrow Articles by Chattopadhyay, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bhatia, S.
Right arrow Articles by Chattopadhyay, S.
Agricola
Right arrow Articles by Bhatia, S.
Right arrow Articles by Chattopadhyay, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2008 by the American Society of Plant Biologists