|
|
||||||||
|
First published online March 14, 2008; 10.1104/pp.108.116699 Plant Physiology 147:296-305 (2008) © 2008 American Society of Plant Biologists Biosynthesis and Accumulation of Ergoline Alkaloids in a Mutualistic Association between Ipomoea asarifolia (Convolvulaceae) and a Clavicipitalean Fungus1Institut für Pharmazeutische Biologie, D–53115 Bonn, Germany (A.M., S.H., C.D., E.L.); Institut für Pharmazeutische Biologie und Biotechnologie, D–40225 Duesseldorf, Germany (N.S., S.-M.L.); Institut für Nutzpflanzenwissenschaften und Resourcenschutz, D–53115 Bonn, Germany (U.S.); and Department of Bioorganic Chemistry, Max Planck Institute for Chemical Ecology, D–07745 Jena, Germany (K.P., W.B.)
Ergoline alkaloids occur in taxonomically unrelated taxa, such as fungi, belonging to the phylum Ascomycetes and higher plants of the family Convolvulaceae. The disjointed occurrence can be explained by the observation that plant-associated epibiotic clavicipitalean fungi capable of synthesizing ergoline alkaloids colonize the adaxial leaf surface of certain Convolvulaceae plant species. The fungi are seed transmitted. Their capacity to synthesize ergoline alkaloids depends on the presence of an intact differentiated host plant (e.g. Ipomoea asarifolia or Turbina corymbosa [Convolvulaceae]). Here, we present independent proof that these fungi are equipped with genetic material responsible for ergoline alkaloid biosynthesis. The gene (dmaW) for the determinant step in ergoline alkaloid biosynthesis was shown to be part of a cluster involved in ergoline alkaloid formation. The dmaW gene was overexpressed in Saccharomyces cerevisiae, the encoded DmaW protein purified to homogeneity, and characterized. Neither the gene nor the biosynthetic capacity, however, was detectable in the intact I. asarifolia or the taxonomically related T. corymbosa host plants. Both plants, however, contained the ergoline alkaloids almost exclusively, whereas alkaloids are not detectable in the associated epibiotic fungi. This indicates that a transport system may exist translocating the alkaloids from the epibiotic fungus into the plant. The association between the fungus and the plant very likely is a symbiotum in which ergoline alkaloids play an essential role.
Ergoline (syn. ergot-) alkaloids are 3,4-substituted indole derivatives that exhibit remarkable and very diverse physiological activities. They are active ingredients in medications designed to treat migraine or Parkinson's disease or are used in childbirth and weaning (Groeger and Floss, 1998
One of the more frequently investigated features of ergoline alkaloids is their ecological role as natural products synthesized by fungal endophytes or epibionts living in or on grasses. The alkaloids confer environmental tolerance, fitness, drought resistance, insecticidal activity, and feed deterrence to their monocotyledonous plants. Books (Rehacek and Sajdl, 1990
Another remarkable feature of ergoline alkaloids is their disjointed distribution in nature: They occur in ascomycetes belonging to the genera Claviceps, Aspergillus, and Penicillium, in the dicotyledonous plant families Convolvulaceae and Polygalaceae (Groeger and Floss, 1998
The disjointed distribution of natural products has not only been observed in the case of ergoline alkaloids, but also with other natural products, such as maytansinoids, which are bacterial products (Higashide et al., 1977
It is in line with these observations that Ipomoea asarifolia and related plant species belonging to the family Convolvulaceae are associated with a clavicipitalean fungus and contain ergoline alkaloids (Kucht et al., 2004
These observations indicate that the disjointed occurrence of ergoline alkaloids in nature is not due to a horizontal gene transfer that might have happened during evolution, but it has been shown (Kucht et al., 2004
Early tracer experiments demonstrated that ergoline alkaloids are derived from three primary precursors. These are L-Trp,
The enzyme (DmaW or DMATS; i.e. 4-[
PCR experiments revealed that a dmaW gene is also present in clavicipitalean fungi associated with the I. asarifolia plant (Steiner et al., 2006
Presence of Ergoline Alkaloids in Leaves and Nondetectability in Mycelium
Individual ergoline alkaloids present in I. asarifolia and T. corymbosa plants associated with fungal mycelium were identified by a HPLC system connected to a mass spectrometer as described previously (Steiner et al., 2006
The fungi, which are provisionally named IasaF13 (present on I. asarifolia) and TcorF01 (present on T. corymbosa), are visible to the naked eye on the adaxial leaf surface (Ahimsa-Mueller et al., 2007
From young leaves of I. asarifolia and T. corymbosa, respectively, the fungal mycelium was removed by two different techniques as outlined in "Materials and Methods." Ultrasonic treatment of leaves separated the mycelium almost completely from the leaf surface as shown by microscopic inspection (Fig. 2
). Alternatively, the mycelium was collected from the leaf with the aid of a spatula. Isolation of the basic fraction from both the untreated and treated leaf material, as well as the harvested fungal mycelium, revealed that the alkaloids were almost completely recovered from the leaves, but that the epibiotic mycelium was devoid of alkaloids (Table I
). Residual amounts of alkaloids detected in the mycelium after collecting the fungus from the leaves with a spatula may have been due to the mechanical impact of the spatula on the leaf surface (Table I). The alkaloids were identified by thin-layer chromatography (TLC) and by HPLC-mass spectrometry (MS; Steiner et al., 2006
Presence of Genes Responsible for Ergoline Alkaloid Biosynthesis in the Epibiotic Mycelium and Nondetectability of These Genes in the Leaves
Because the alkaloids are present in the leaves, the plant material was investigated for the presence of the 4-(
For the analysis of the genetic material, we used these fungus-free plants as a source of genomic plant DNA, which was employed as a template in PCRs with degenerate oligonucleotides (Wang et al., 2004 We therefore turned to the fungi IasaF13 and TcorF01 collected from the leaf surface and found by PCR (deg1/deg4) a DNA sequence of the expected length (>900 bp), which exhibited high similarity (76% for IasaF13 and 73% for TcorF01) to the corresponding dmaW sequence of C. purpurea (AJ011963). The similarity between both partial dmaW genes found in IasaF13 and TcorF01 was 93%. The partial dmaW sequence amplified from IasaF13 was now extended by chromosome walking to the 5'- as well as to the 3'-end as described in "Materials and Methods." The complete DmaW protein in IasaF13 (AAZ20613) comprises 456 amino acids and has a molecular mass of 52.4 kD. This compares well with the dmaW gene in C. purpurea (CAB39314) showing 448 amino acids and 51.68 kD. The cDNA of the dmaW gene (DQ121453) in IasaF13 has 73% similarity to that of C. purpurea. The intron/exon structure of all seven dmaW genes known up to now is compared in Table II . Interestingly, the length of exon 2 is conserved to 122 bp in each case.
Next and upstream of the 5'-end of the dmaW gene, open reading frames (ORFs) were found with a similarity (amino acid level) of 61% (1,000 bp; EU091292) to orfA, 74% (1,079 bp; EU121852) to orfB, and 73% (1,380 bp; EU121853) to cpox-1 of C. purpurea (Tudzynski et al., 2001
The plants I. asarifolia and T. corymbosa were investigated for their ability to synthesize ergoline alkaloids. The plants (colonized by their respective fungus IasaF13 or TcorF01) were fed with isotopically labeled [5,5-2H2]1-deoxy-D-xylulose ([d2]DOX) and [2,2-2H2]mevalonic acid lactone ([d2]MVA) for 48 h or 1 week. Both compounds are precursors of isopentenyl diphosphate and dimethylallyl diphosphate (DMAPP), which supply the isoprene moiety of ergoline alkaloids (Groeger et al., 1963
This experiment showed that the proffered precursors [d2]DOX and [d2]MVA were taken up by the plant and metabolized. In spite of this, however, the ergoline alkaloids chanoclavine, lysergic acid amide, and isolysergic acid amide were devoid of any deuterium. These experiments were carried out in July 2004 (48-h feeding time) and repeated in December 2004 (48-h feeding time) and May 2005 (1-week feeding time) with the same result regardless of whether I. asarifolia or T. corymbosa were used as experimental systems. During biosynthesis of ergoline alkaloids, DMAPP is involved in the prenylation of Trp (Fig. 1A). In a follow-up experiment, we fed 3-[14C]L-Trp to I. asarifolia shoots during a 48-h experiment. Also, in this case, no incorporation of labeled precursor into ergoline alkaloids was observed. We therefore concluded that it is not the plant that is the producer of alkaloids, but the associated clavicipitalean fungus and that the experimental conditions did not allow the precursors to reach the site of synthesis within the epibiotic plant-associated fungus. The fact that we found genes necessary for ergoline alkaloid biosynthesis (vide supra), including the gene for the pivotal step in ergoline alkaloid biosynthesis in the IasaF13 fungus, supports this view.
To corroborate our conclusions, the dmaW gene detected in IasaF13 was probed for its activity after overexpression in yeast (Saccharomyces cerevisiae) following published procedures that were used to overexpress and characterize the DmaW enzyme from A. fumigatus (Unsoeld and Li, 2005
When the substrate specificity of the enzyme was tested, L-Trp exhibited as expected the highest activity (100%). The activity dropped in the following order when Trp was replaced with Trp derivatives with an altered side chain: L-β-homo-Trp (47.5%), N
After incubation with Trp having variously substituted indole moieties, the following activities were observed: 7-methyl-DL-Trp (26.3%), 5-hydroxy-L-Trp (20.9%), 6-methyl-DL-Trp (9.8%), 5-methyl-DL-Trp (5.3%), and serotonin (2.2%). The identity of the enzymic products was confirmed by electrospray ionization-MS (negative and positive mode) in every single case as described by Steffan et al. (2007)
The disjointed occurrence of ergoline alkaloids in taxonomically unrelated organisms, such as ascomycetes, and a higher plant family, the Convolvulaceae, was until recently explained by one of the following assumptions (Steiner et al., 2006
We have shown in this and previous publications (Kucht et al., 2004
The experiments described in this article are in agreement with these conclusions. They provide independent proof that the clavicipitalean fungus IasaF13 is responsible for the presence of ergoline alkaloids in I. asarifolia and that a closely related clavicipitalean fungus occurs on T. corymbosa (Ahimsa-Mueller et al., 2007
The dmaW genes in both I. asarifolia and T. corymbosa were isolated by two different techniques. These are PCR and reverse genetics starting from RNA and leading to an intronless cDNA. The RNA was isolated from both epibiotic fungi IasaF13 and TcorF1. This shows that the epibiotic fungi do not only harbor, but also transcribe, the dmaW gene. The properties of the encoded DmaW enzyme compare favorably to those observed for the corresponding enzymes in the ergoline alkaloid-producing fungi A. fumigatus (Unsoeld and Li, 2005 These observations leave little doubt that the plant is not the site of ergoline alkaloid biosynthesis, but that the plant-associated epibiotic fungi IasaF13 and TcorF01 are responsible for the biosynthesis of ergoline alkaloids, whereas these natural products accumulate almost exclusively within the I. asarifolia and T. corymbosa plants.
Biosynthesis of ergoline alkaloids in the fungus and accumulation of these alkaloids in the plant leaves suggest that a transport system should exist that translocates the alkaloids from the fungus into the leaves. Translocation of carbohydrates, including an unknown compound, the structure of which remained undefined, is known to occur from fungus to host and vice versa in a fungal/plant association comprising Myriogenospora atramentosa (Clavicipitaceae) and Paspalum notatum (bahiagrass; Smith et al., 1985
Plant Material
The plant material has been described previously (Steiner et al., 2006
To localize the ergoline alkaloids in either the fungal mycelium or in the plant tissue, both organisms were separated by two different techniques. The fungus (500 µg) was collected from the upper surface of young leaf buds (10 g) using a small spatula. Alternatively, the leaf material (10 g) covered with mycelium was immersed in water (200 mL) and submitted to treatment in a small laboratory ultrasonic water bath. Separation of fungal hyphea and leaf material was followed by microscopic inspection of leaves and found to be almost complete after 8-min treatment (Fig. 2). For microscopic inspection of successful removal of fungal material from the leaf surface, samples were stained simultaneously with Nile Red- (Sigma) and Oregon Green-labeled wheat germ agglutinin (Invitrogen) and examined with a Leitz DMRB photomicroscope (Leica) equipped for epifluorescence with filter combination 490/15, 500, BP 525/20 according to Kucht et al. (2004)
The plant material was removed from the water and the water containing the hyphea was centrifuged (11,000g, 10 min). The plant material before and after ultrasonic treatment was analyzed for ergoline alkaloids and the alkaloids were identified as described (Kucht et al., 2004
Several shoots with a total weight of 9 g were cut and immediately placed into a vial containing an aqueous solution (4 mL) of 3-[14C]L-Trp (0.37 MBq; specific activity 1.97 MBq µM–1). The plant cuttings were kept at room temperature in a fume hood. The vials were refilled with water after uptake of the labeled Trp had been completed 9 h after the start of feeding. The alkaloids were extracted 48 h after the start of the experiment, and the alkaloids were separated by TLC (Kucht et al., 2004
[d2]MVA (4 mg in 2 mL of water) and [d2]DOX (4 mg in 2 mL of water) were fed to cuttings of I. asarifolia (8–9 g) and T. corymbosa (8–9 g) during 48 h or 1 week. The plants were enclosed in desiccators for headspace analysis of (E)-β-caryophyllene as described by Mithoefer et al. (2005)
The collected volatiles were eluted from the charcoal traps with dichloromethane (2 x 20 µL) containing n-bromodecane (100 ng µL–1) as an internal standard. Samples were analyzed on a Thermo TRACE GC 2000 connected to a TRACE MS equipped with an ECTM-5 capillary column (15-m x 0.25-mm i.d., 0.25-µm film; Alltech). Injection port, 220°C; transfer line, 280°C; injection volume, 1 µL (split ratio 1:10); ionization energy, 70 eV. Compounds were eluted under programmed conditions starting from 40°C (2-min hold) and ramped up at 10°C min–1 to 200°C, followed by 30°C min–1 to 280°C. Helium at a flow rate of 1.5 mL min–1 served as a carrier gas. The headspace volatile (E)-β-caryophyllene was identified by comparing its mass spectrum with authentic reference material. Prior to gas chromatography-MS analysis, the alkaloids were silylated by treatment with N-methyl-N-(trimethylsilyl)trifluoroacetamide (2 h, 60°C). The compounds were separated on the ECTM-5 capillary column (see above) by programmed elution from 120°C to 280°C at 10°C min–1. The data were analyzed using Finnigan Xcalibur 1.2 software.
Vector pYES2/NTC and yeast (Saccharomyces cerevisiae) INVSc1 were purchased from Invitrogen and maintained on yeast extract/peptone dextrose medium (Ausubel et al., 1996 Transformants were cultivated in liquid or solid minimal medium lacking uracil containing 0.67% yeast nitrogen base (without amino acids but with ammonium sulfate), 2% carbon source (e.g. Glc or raffinose), 0.01% each of adenine, Arg, Cys, Leu, Lys, Thr, and Trp, and 0.005% each of Asp, His, Ile, Met, Phe, Pro, Ser, Tyr, and Val and 2% agar for plates.
Attempts to detect the dmaW gene in plant material (I. asarifolia and T. corymbosa) devoid of fungi (Kucht et al., 2004
Fungal mycelium (500 µg) was collected with a spatula from leaf buds of I. asarifolia and T. corymbosa and DNA extracted according to Cenis (1992)
Subsequently the 5'-end of the dmaW gene was amplified using the DNA Walking SpeedUp premix kit (Seegene) as published by Hwang et al. (2003)
The 3'-end of the dmaW gene was amplified using 3'-RACE-RCR as published by Frohmann et al. (1988) Eventually genomic DNA from fungal mycelium and the following primers were employed to determine the sequences of the introns: Q4 (CAGGGAGATTGATCTTTTTGG) and TSP-IA-4 (CTTGACATGGTTCGCGAAC). This gave an approximately 590-bp stretch, which was cloned and sequenced. Two introns with a length of 58 and 57 bp were found. The accession number of the complete dmaW gene is DQ 121 453. The dmaW gene from the epibiotic clavicipitaceous fungus living on T. corymbosa was essentially sequenced in the same way. The gene had a length of 1,483 bp and two introns comprising 55 and 57 bp. The GenBank accession number is DQ 121 454.
For amplification of a partial cpox1 gene, a degenerate primer (cpox1-deg1) was constructed from the known sequence of the cpox1 gene in Claviceps purpurea (Tudzynski et al., 1999
The pAM16 was introduced into yeast INVSc1 by electroporation (Ausubel et al., 1996
All of the enzyme assays contained 50 mM Tris-HCl (pH 7.5) and 5 mM CaCl2. They differed from each other by incubation volumes, substrate concentrations, amount of DmaW (DMATS), and incubation times. The reaction mixtures of the standard assay for determination of the substrate specificity (100 µL) contained 1 mM Trp or derivatives, 1 mM DMAPP, and 1 µg of purified DmaW. After incubation for 1 h at 30°C, the reaction was stopped with 10 µL of TCA (1.5 M). After removal of the protein by centrifugation (15,000g, 10 min, 4°C), the enzymatic products were analyzed on an HPLC and a LC-MS system (described below). Two independent assays were carried out for quantification. The assay for the isolation of the enzymatic product for structural elucidation contained 1 mM Trp, 2 mM DMAPP, and 20 µg of purified DmaW and was incubated for 16 h. The assays for determination of the kinetic parameters of L-Trp (100 µL) contained 0 to 0.2 mM L-Trp, 1 mM DMAPP, and 0.32 µg of DmaW. The assays for determination of the kinetic parameters of DMAPP (100 µL) contained 0 to 0.5 mM DMAPP, 1 mM L-Trp, and 0.32 µg of DmaW. Incubation was 20 min at 30°C.
Reaction mixtures containing the DmaW protein were analyzed on an Agilent (Hewlett-Packard) HPLC series 1100 instrument by using an Eclipse XBD-C18 column (4.6 x 150 mm, 5 µm; Agilent) at a flow rate of 1 mL min–1. Water (solvent A) and acetonitrile (solvent B), each containing 0.5% trifluoroacetic acid, were used as solvents. A gradient was run from 0% to 70% B in 20 min. After washing with 100% solvent B for 4 min, the column was equilibrated with 100% solvent A for 6 min. The substances were detected with a photo diode array detector.
The enzymatic products were analyzed by positive and negative electrospray ionization-MS with a ThermoFinnigan TSQ Quantum. The mass spectrometer was coupled to an Agilent series 1100 HPLC instrument equipped with a RP18 column (2 x 250 mm, 5 µm). For separation, the column was run with 10% solvent B (methanol) in solvent A (water, each containing 0.1% HCOOH) for 5 min, followed by a gradient from 10% to 100% B over 30 min. After washing with 100% B, the column was equilibrated with 10% B for 10 min. The flow rate was 0.2 mL min–1.
The NMR spectrum of 4-( Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AJ011963, AAZ20613, CAB39314, DQ121453, EU091292, EU121852, EU121853, DQ121454, L39640, AY262013, AY259838, AY775787, XM_751049, EAA61522, BAB13480, and AABX01000271. Received February 9, 2008; accepted March 11, 2008; published March 14, 2008.
1 This work was supported by the Deutsche Forschungsgemeinschaft (grant to E.L.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Eckhard Leistner (eleistner{at}uni-bonn.de). www.plantphysiol.org/cgi/doi/10.1104/pp.108.116699 * Corresponding author; e-mail eleistner{at}uni-bonn.de.
Ahimsa-Mueller MA, Markert A, Hellwig S, Knoop V, Steiner U, Drewke C, Leistner E (2007) Clavicipitaceous fungi associated with ergoline alkaloid-containing Convolvulaceae. J Nat Prod 70: 1955–1960[CrossRef][Medline] Arechavaleta M, Bacon CW, Plattner RD, Hoveland CS, Radcliffe DE (1992) Accumulation of ergopeptine alkaloids in symbiotic tall fescue under deficits of soil water and nitrogen fertilizer. Appl Environ Microbiol 58: 857–861 Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1996) Current Protocols in Molecular Biology. John Wiley and Sons, New York Bacon CW, Lyons P (2005) Ecological fitness factors for fungi within the Balansieae and Clavicipitaceae. In J Dighton, JF White, P Oudemans, eds, The Fungal Community, Its Organisation and Role in the Ecosystem, Ed 3. CRC Taylor & Francis, Boca Raton, FL, pp 519–532 Bacon CW, Siegel MR (1988) Endophyte parasitism of tall fescue. J Prod Agric 1: 45–55 Bischoff JF, White JF Jr (2005) Evolutionary development of the Clavicipitaceae. In J Dighton, JF White, P Oudemans, eds, The Fungal Community, Its Organisation and Role in the Ecosystem, Ed 3. CRC Taylor & Francis, Boca Raton, FL, pp 505–518 Bush LP, Wilkinson HH, Schardl CL (1997) Bioprotective alkaloids of grass-fungal endophyte symbiosis. Plant Physiol 114: 1–7[CrossRef][Web of Science][Medline] Cassady JM, Chan KK, Floss HG, Leistner E (2004) Recent development in the maytansinoid antitumor agents. Chem Pharm Bull (Tokyo) 52: 1–26[Medline] Cenis JL (1992) Rapid extraction of fungal DNA for PCR amplification. Nucleic Acids Res 20: 2380 Clark CA (1994) The chlorotic leaf distortion pathogen, Fusarium lateritium, cross protects sweet potato against Fusarium wilt caused by Fusarium oxysporum f.sp. batatas. Biol Control 4: 59–61[CrossRef] Clay K (2004) Fungi and the food of the gods. Nature 427: 401–402[CrossRef][Medline] Clay K, Schardl C (2002) Evolutionary origins and ecological consequences of endophyte symbiosis with grasses. Am Nat (Suppl) 160: S99–S127 Coyle CM, Panaccione DG (2005) An ergot alkaloid biosynthesis gene and clustered hypothetical genes from Aspergillus fumigatus. Appl Environ Microbiol 71: 3112–3118 Cress WA, Chayet LT, Rilling HC (1981) Crystallization and partial characterization of dimethylallyl pyrophosphate: L-tryptophan dimethylallyl transferase from Claviceps sp. SD58. J Biol Chem 256: 10917–10923 Dellaporta SL, Wool J, Hicks JB (1983) A plant minipreparation: version 2. Plant Mol Biol Rep 1: 19–21[CrossRef] Dieffenbach CW, Dveksler CS (1995) PCR Primer: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Dudareva N, Andersson S, Orlova I, Gatto N, Reichelt M, Rhodes D, Boland W, Gershenzon J (2005) The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers. Proc Natl Acad Sci USA 102: 933–938 Faeth SH, Fagan WF (2002) Fungal endophytes: common host plant symbionts but uncommon mutualists. Integr Comp Biol 42: 360–368 Fleetwood DJ, Scott B, Lane GA, Tanaka A, Johnson RD (2007) A complex ergovaline gene cluster in Epichloe endophytes of grasses. Appl Environ Microbiol 73: 2571–2579 Flügge UI, Gao W (2005) Transport of isoprenoid intermediates across chloroplast envelope membranes. Plant Biol 7: 91–97[CrossRef][Medline] Frohmann MA, Dush MK, Martin GR (1988) Rapid production of full-length cDNA from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA 85: 8998–9002 Gebler JC, Poulter CD (1992) Purification and characterization of dimethylallyl tryptophan synthase from Claviceps purpurea. Arch Biochem Biophys 296: 308–313[CrossRef][Web of Science][Medline] Groeger D, Floss HG (1998) Biochemistry of ergot alkaloids—achievements and challenges. In GA Cordell, ed, The Alkaloids—Chemistry and Biology, Vol 50. Academic Press, New York, pp 171–218 Groeger D, Mothes K, Floss HG, Weygand F (1963) Zur Biogenese von Ergolin-Derivaten in Ipomoea rubro-coerulea Hook. Z Naturforsch 18b: 1123–1124 Gunatilaka AAL (2006) Natural products from plant-associated microorganisms: distribution, structural diversity, bioactivity, and implications of their occurrence. J Nat Prod 69: 509–526[CrossRef][Medline] Haarmann T, Machado C, Luebbe Y, Correia T, Schardl CL, Panaccione DG, Tudzynski P (2005) The ergot alkaloid gene cluster in Claviceps purpurea: extension of the cluster sequence and intra species evolution. Phytochemistry 66: 1312–1320[CrossRef][Web of Science][Medline] Haarmann T, Ortel I, Tudzynski P, Keller U (2006) Identification of the cytochrome P450 monooxygenase that bridges the clavine and ergoline alkaloid pathways. ChemBioChem 7: 645–652[CrossRef][Web of Science][Medline] Hampel D, Mosandl A, Wuest M (2005) Biosynthesis of mono- and sesquiterpenes in carrot roots and leaves (Daucus carota L.): metabolic cross talk of cytosolic mevalonate and plastidial methylerythrytol phosphate pathways. Phytochemistry 66: 305–311[CrossRef][Web of Science][Medline] Heinstein PF, Lee SL, Floss HG (1971) Isolation of dimethylallylpyrophosphate: tryptophan dimethylallyltransferase from the ergot fungus (Claviceps spec.). Biochem Biophys Res Commun 44: 1244–1251[CrossRef][Web of Science][Medline] Higashide E, Asai M, Ootsu K, Tanida S, Kozay Y, Hasegawa T, Kishi T, Sogino Y, Yoneda M (1977) Ansamitocin, a group of novel maytansinoid antibiotics with anti-tumor properties from Nocardia. Nature 270: 721–722[CrossRef][Medline] Hofmann A (1961) Die Wirkstoffe der mexikanischen Zauberdroge "Ololiuqui". Planta Med 9: 354–367 Hofmann A (2006) LSD-mein Sorgenkind, die Entdeckung einer Wunderdroge, Ed 12. Deutscher Taschenbuchverlag, Munich Hwang IT, Kim YL, Kim SH, Kwak CI, Gu YY, Chun JY (2003) Annealing control primer system for improving specificity of PCR amplification. Biotechniques 35: 1180–1184[Web of Science][Medline] Keller U, Tudzynski P (2002) Ergot alkaloids. In HD Osiewacz, ed, The Mycota, Vol X. Springer, Berlin, pp 157–181 Kremer A, Westrich L, Li SM (2007) A 7-dimethylallyltryptophan synthase from Aspargillus fumigatus: overproduction, purification and biochemical characterization. Microbiology 153: 3409–3416 Krupinski VM, Robbers JE, Floss HG (1976) Physiological study of ergot: induction of alkaloid synthesis by tryptophan at the enzymic level. J Bacteriol 125: 158–165 Kucht S, Gross J, Hussein Y, Grothe T, Keller U, Basar S, Koenig WA, Steiner U, Leistner E (2004) Elimination of ergoline alkaloids following treatment of Ipomoea asarifolia (Convolvulaceae) with fungicides. Planta 219: 619–625[Web of Science][Medline] Kupchan SM, Komoda Y, Branfman AR, Sneden AT, Court WA, Thomas GJ, Hintz HPJ, Smith RM, Karim A, Howie GA, et al (1977) The maytansinoids. Isolation, structural elucidation, and chemical interrelation of novel ansa macrolides. J Org Chem 42: 349–357 Laule O, Fürholz A, Chang HS, Zhu T, Wang X, Heifetz PB, Gruissem W, Lange BM (2003) Crosstalk between cytosolic and plastidial pathways of isoprenoid biosynthesis in Arabidopsis thaliana. Proc Natl Acad Sci USA 100: 6866–6871 Lee SL, Floss HG, Heinstein P (1976) Purification and properties of dimethylallylpyrophosphate: tryptophan dimethylallyl transferase, the first enzyme of ergot alkaloid biosynthesis in Claviceps sp.SD 58. Arch Biochem Biophys 77: 84–94 Liang PH, Ko TP, Wang AH (2002) Structure, mechanism and function of prenyltransferases. Eur J Biochem 269: 3339–3354[Web of Science][Medline] Makarieva TN, Ilyin SG, Stonik VA, Lyssenko KA, Denisenko VA (1999) Picobin, the first ergoline marine alkaloid from the Far-Eastern ascidian Eudistoma sp. Tetrahedron Lett 40: 1591–1594[CrossRef][Web of Science] Malinowski DP, Belesky DP (2000) Adaptations of endophyte-infected cool season grasses to environmental stresses. Crop Sci 40: 923–940 Mithoefer A, Wanner G, Boland W (2005) Effects of feeding Spodoptera littoralis on lima bean leaves. II. Continuous mechanical wounding resembling insect feeding is sufficient to elicit herbivory-related volatile emission. Plant Physiol 137: 1160–1168 Moon CD, Craven KD, Leuchtmann A, Clement SL, Schardl CL (2004) Prevalence of interspecific hybrids amongst asexual fungal endophytes of grasses. Mol Ecol 13: 1455–1467[CrossRef][Medline] Mutschler E, Geisslinger G, Kroemer HK, Schaefer-Korting M (2001) Arzneimittelwirkungen- Lehrbuch der Pharmakologie und Toxikologie, Ed 8. Wissenschaftliche Verlagsgesellschaft mbH, Stuttgart Page JE, Hause G, Raschke M, Gao W, Schmidt J, Zenk MH, Kutchan M (2004) Functional analysis of the final steps of the 1-deoxy-D-xylulose 5-phosphate (DXP) pathway to isoprenoids in plants using virus-induced gene silencing. Plant Physiol 134: 1401–1413 Piel J, Donath J, Bandemer K, Boland W (1998) Mevalonat-unabhaengige Biosynthese terpenoider Duftstoffe in Pflanzen: Induzierter und konstituiv emittierter Duft. Angew Chem 110: 2622–2625[CrossRef] Pullen CB, Schmitz P, Hoffmann D, Meurer K, Boettcher T, von Bamberg D, Pereira AM, de Castro França S, Hauser M, Geertsema H, et al (2003) Occurrence and non-detectability of maytansinoids in individual plants of the genera Maytenus and Putterlickia. Phytochemistry 62: 377–387[CrossRef][Web of Science][Medline] Rehacek Z, Sajdl P (1990) Ergot Alkaloids, Chemistry, Biological Effects, Biotechnology. Academia, Prague Robbers JE, Robertson IW, Hornemann KM, Jindra J, Floss HG (1972) Physiological studies on ergot: further studies on the induction of alkaloid synthesis by tryptophan and its inhibition by phosphate. J Bacteriol 112: 791–796 Schardl CL, Craven KD (2003) Interspecific hybridisation in plant-associated fungi and oomycetes: a review. Mol Ecol 12: 2861–2873[CrossRef][Medline] Schardl C, Leuchtmann A (2005) The epichloe endophytes of grasses and the symbiotic continuum. In J Dighton, JF White, P Oudemans, eds, The Fungal Community, Its Organisation and Role in the Ecosystems, Ed 3. CRC Taylor & Francis, Boca Raton, FL, pp 475–503 Schardl CF, Pannacione DG, Tudzynski P (2006) Ergot alkaloids-biology and molecular biology. In GA Cordell, ed, The Alkaloids: Chemistry and Biology, Vol 63. Academic Press, New York, pp 45–86 Schardl CL, Leuchtmann A, Spiering MJ (2004) Symbiosis of grasses with seedborne fungal endophytes. Annu Rev Plant Biol 55: 315–340[CrossRef][Medline] Smith KT, Bacon CW, Luttrell ES (1985) Reciprocal translocation of carbohydrates between host and fungus in Bahiagrass infected with Myriogenospora atramentosa. Phytopathology 75: 407–411[Web of Science] Stanjek V, Piel J, Boland W (1999) Biosynthesis of furanocoumarins: mevalonate-independent prenylation of umbelliferone in Apium graveolens (Apiaceae). Phytochemistry 50: 1141–1145[CrossRef][Web of Science] Steffan N, Unsoeld IA, Li SM (2007) Chemoenzymatic synthesis of prenylated indole derivatives using a 4-dimethylallyltryptophan synthase from Aspergillus fumigatus. ChemBioChem 8: 1298–1307[CrossRef][Web of Science][Medline] Steiner U, Ahimsa-Mueller MA, Markert A, Kucht S, Gross J, Kauf N, Kuzma M, Zych M, Lamshoeft M, Furmanowa M, et al (2006) Molecular characterisation of a seed transmitted clavicipitaceous fungus occurring on dicotyledoneous plants (Convolvulaceae). Planta 224: 533–544[CrossRef][Web of Science][Medline] Tsai HF, Wang H, Gebler JC, Poulter CD, Schardl CL (1995) The Claviceps purpurea gene encoding dimethylallyltryptophan synthase, the committed step for ergot alkaloid biosynthesis. Biochem Biophys Res Commun 216: 119–125[CrossRef][Web of Science][Medline] Tudzynski P, Correia T, Keller U (2001) Biotechnology and genetics of ergot alkaloids. Appl Microbiol Biotechnol 57: 593–605[CrossRef][Web of Science][Medline] Tudzynski P, Hoelter K, Correia T, Arntz C, Grammel N, Keller U (1999) Evidence for an ergot alkaloid gene cluster in Claviceps purpurea. Mol Gen Genet 261: 133–141[CrossRef][Web of Science][Medline] Tudzynski P, Scheffer J (2004) Claviceps purpurea: molecular aspects of a unique pathogenic lifestyle. Mol Plant Pathol 5: 377–388[CrossRef] Unsoeld IA, Li SM (2005) Overproduction, purification and characterization of FgaPT2, a dimethylallyltryptophan synthase from Aspergillus fumigatus. Microbiology 151: 1499–1505 Wang J, Machado C, Panaccione DG, Tsai HF, Schardl CL (2004) The determinant step in ergot alkaloid biosynthesis by an endophyte of perennial ryegrass. Fungal Genet Biol 41: 189–198[CrossRef][Web of Science][Medline] White JF Jr, Bacon CW, Hywel-Jones NL, Spatafora JW (2003) Clavicipitalean Fungi, Evolutionary Biology, Chemistry, Biocontrol, and Cultural Impacts. Marcel Dekker, New York Related articles in Plant Physiol.:
This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|