Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online April 11, 2008; 10.1104/pp.108.117481

Plant Physiology 147:611-623 (2008)
© 2008 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
147/2/611    most recent
pp.108.117481v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brandner, K.
Right arrow Articles by Heinlein, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brandner, K.
Right arrow Articles by Heinlein, M.
Agricola
Right arrow Articles by Brandner, K.
Right arrow Articles by Heinlein, M.
CELL BIOLOGY AND SIGNAL TRANSDUCTION

Tobacco Mosaic Virus Movement Protein Interacts with Green Fluorescent Protein-Tagged Microtubule End-Binding Protein 11,[W]

Katrin Brandner2, Adrian Sambade2, Emmanuel Boutant, Pascal Didier, Yves Mély, Christophe Ritzenthaler and Manfred Heinlein*

Institut de Biologie Moléculaire des Plantes, laboratoire propre du CNRS (UPR 2357) conventionné avec l'Université Louis Pasteur, 67084 Strasbourg cedex, France (K.B., A.S., E.B., C.R. M.H.); and Institut Gilbert Laustriat, UMR CNRS 7034, Faculté de Pharmacie, Université Louis Pasteur, 67401 Illkirch, France (P.D., Y.M.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The targeting of the movement protein (MP) of Tobacco mosaic virus to plasmodesmata involves the actin/endoplasmic reticulum network and does not require an intact microtubule cytoskeleton. Nevertheless, the ability of MP to facilitate the cell-to-cell spread of infection is tightly correlated with interactions of the protein with microtubules, indicating that the microtubule system is involved in the transport of viral RNA. While the MP acts like a microtubule-associated protein able to stabilize microtubules during late infection stages, the protein was also shown to cause the inactivation of the centrosome upon expression in mammalian cells, thus suggesting that MP may interact with factors involved in microtubule attachment, nucleation, or polymerization. To further investigate the interactions of MP with the microtubule system in planta, we expressed the MP in the presence of green fluorescent protein (GFP)-fused microtubule end-binding protein 1a (EB1a) of Arabidopsis (Arabidopsis thaliana; AtEB1a:GFP). The two proteins colocalize and interact in vivo as well as in vitro and exhibit mutual functional interference. These findings suggest that MP interacts with EB1 and that this interaction may play a role in the associations of MP with the microtubule system during infection.


The tobacco mosaic virus RNA (TMV/vRNA) requires the virus-encoded 30-kD movement protein (MP; Deom et al., 1987Go) for its intercellular spread via plasmodesmata (PD), cytoplasmic pores in the plant cell wall that interconnect adjacent cells (Heinlein, 2002Go; Heinlein and Epel, 2004Go). During infection, the protein targets PD and transiently increases their size exclusion limit (Oparka et al., 1997Go). MP also has the capacity to bind single-stranded nucleic acids (Citovsky et al., 1990Go; Boyko et al., 2002Go), and because complexes of MP and vRNA were isolated from TMV-infected plants (Dorokhov et al., 1983Go, 1984Go) and coat protein-deficient virus can still move between cells (Dawson et al., 1988Go), vRNA is proposed to be transported in the form of a nonencapsidated ribonucleoprotein complex. Like other RNA viruses, TMV replicates in association with the endoplasmic reticulum (ER; Heinlein et al., 1995Go, 1998aGo; Reichel and Beachy, 1998Go). During infection, ER membranes transiently condense to form inclusion bodies (Heinlein et al., 1998aGo; Reichel and Beachy, 1998Go) that harbor viral replication complexes and accumulate vRNA, replicase, MP, and coat protein (Más and Beachy, 1999Go; Asurmendi et al., 2004Go). Recently, it was shown that the actin/ER network is involved in the targeting of MP to PD (Wright et al., 2007Go). However, while the MP may target PD via ER, several in vivo studies indicate that the cell-to-cell movement of vRNA also involves interactions of MP with the microtubule cytoskeleton (Heinlein et al., 1995Go; McLean et al., 1995Go; Boyko et al., 2000aGo, 2000bGo, 2000cGo, 2002Go, 2007Go). Consistent with a role of the ER/actin network in the targeting of MP to PD, MP mutants specifically deficient in microtubule association and vRNA transport are still capable to accumulate in PD (Kahn et al., 1998Go; Boyko et al., 2000aGo, 2000cGo, 2007Go), suggesting that interactions with the microtubule system specifically contribute to the transport of vRNA. On the other hand, an intact microtubule cytoskeleton is not required for the spread of infection (Gillespie et al., 2002Go; Ashby et al., 2006Go), indicating that microtubules are either not essential or that individual microtubules or localized activities of the microtubule cytoskeleton are sufficient to support the transport of vRNA (Seemanpillai et al., 2006Go). Recent in vivo observations imply the occurrence of mobile MP-associated particles, which were visualized proximal to microtubules, in vRNA movement (Boyko et al., 2007Go). However, the exact mechanism by which the microtubule system contributes to vRNA movement is still unknown. Interestingly, point mutations in MP that affect the ability of the protein to associate with microtubules and to function in vRNA transport in a temperature-sensitive manner cluster in a domain with structural similarity to the M-loop of tubulin known to mediate tubulin-tubulin interactions between microtubule protofilaments (Nogales et al., 1999Go; Boyko et al., 2000aGo, 2007Go). Functional mimicry of the tubulin M-loop may allow MP to undergo direct interactions with tubulin as well as with tubulin-binding factors. Indeed, MP can bind to polymerized microtubules with characteristics of a genuine microtubule-associated protein (MAP) which, dependent on the amount of bound MP, can lead to the stabilization of the filaments against disruption by cold or by treatment with microtubule-disrupting agents (Boyko et al., 2000aGo; Ashby et al., 2006Go; Ferralli et al., 2006Go). The potential ability of MP to interact with tubulin-binding factors is supported by heterologous expression experiments, which demonstrated that MP expression interferes with centrosomal microtubule anchorage, {gamma}-tubulin recruitment, and microtubule nucleation activity in mammalian cells (Ferralli et al., 2006Go). This phenotype of MP-expressing cells is independent of microtubule association of the protein and also independent of microtubules themselves and thus suggests that this protein may interact with factors involved in microtubule anchorage or polymerization.

To further investigate the interactions of MP with the microtubule system in planta, we analyzed infected or MP-transfected cells expressing the Arabidopsis (Arabidopsis thaliana) microtubule end-binding protein AtEB1a fused to GFP (AtEB1a:GFP). EB1 is a microtubule plus-end-tracking protein that regulates microtubule dynamics and promotes end-on attachment to different cellular sites (Korinek et al., 2000Go; Vaughan, 2005Go; Akhmanova and Steinmetz, 2008Go). AtEB1a represents one of three EB1 proteins in Arabidopsis (AtEB1a, AtEB1b, and AtEB1c; Chan et al., 2003Go). In transgenic Arabidopsis suspension cell lines, Arabidopsis plants, or tobacco (Nicotiana tabacum) BY-2 cells, the expression of AtEB1a:GFP from either a constitutive or inducible promoter resulted in a typical gradient- or comet-like labeling of the plus ends of growing microtubules (Chan et al., 2003Go; Mathur et al., 2003Go; Dixit et al., 2006Go). Under conditions of constitutive expression, the protein was also observed to label the minus ends, thus revealing the dynamic behavior and localization of cortical microtubule nucleation sites (Chan et al., 2003Go). By analogy to EB1 function in other eukaryotes (Askham et al., 2002Go; Rehberg and Graf, 2002Go; Louie et al., 2004Go) and because knockdown experiments do not indicate a role of EB1 in microtubule nucleation per se (Askham et al., 2002Go; Rehberg and Graf, 2002Go; Rogers et al., 2002Go), it has been proposed that AtEB1 is involved in anchoring microtubules to their nucleation sites that may then function as a reservoir for EB1 distribution to the growing end (Chan et al., 2003Go).

Here, we show that coexpression of MP fused to red fluorescent protein (MP:RFP) together with AtEB1a:GFP causes mutual interference between the proteins with respect to both subcellular localization and function. The two proteins colocalize on microtubules and interact in vivo as well as in vitro. Based on these observations, we propose that EB1 and MP represent mutual interaction targets that mediate, guide, or control microtubule-associated functions during infection.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

TMV Infection Interferes with AtEB1a:GFP Dynamics

To test the effect of TMV infection on microtubule dynamics and nucleation sites, we used Nicotiana benthamiana leaves expressing AtEB1a:GFP following agroinfiltration. As previously reported for Arabidopsis and also BY-2 suspension cells (Chan et al., 2003Go; Van Damme et al., 2004Go; Dixit et al., 2006Go), cells in the agroinfiltrated N. benthamiana tissue exhibited the protein in the form of comet-like gradients at the tip of growing microtubules, thus confirming the potency of this marker to label the dynamic microtubule cytoskeleton in heterologous plant species (Supplemental Movie S1). The average rate of the observed microtubule polymerization was 4.8 (±1.1) µm min–1 (n = 40 microtubules), which is comparable to the rates measured in Arabidopsis and tobacco BY-2 suspension cells (Chan et al., 2003Go; Dixit et al., 2006Go). In cells highly expressing AtEB1a:GFP, the protein sometimes labeled microtubules along their length, as has also been observed for other systems involving AtEB1a:GFP overexpression (Dixit et al., 2006Go). However, the microtubules in such cells were nevertheless dynamic (see, for example, Fig. 1D ; Supplemental Movie S5), and the comet-like staining pattern was always most prominently and clearly seen.


Figure 1
View larger version (98K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Viral infection inhibits microtubule dynamics in AtEB1a:GFP-expressing N. benthamiana epidermal leaf cells. A, Expanding infection site (4 dpi) caused by TMV-MP:RFP. Zones for observation by high magnification video microscopy and confocal microscopy are indicated by white and yellow rectangles, respectively, referring to B to L. Scale bar = 200 µm. B, In cells outside the spreading infection site, microtubules are highly dynamic, and AtEB1a:GFP localizes to the tips of growing microtubule plus ends. The bottom segment shows dynamic GFP pixels within a time frame of 30 s. See also Supplemental Movie S2. Scale bar = 10 µm. C, In infected cells, AtEB1a:GFP is associated with microtubules along their length, and no dynamic behavior of the AtEB1a:GFP-associated microtubules can be detected by video time lapse microscopy. The bottom segment shows the absence of dynamic GFP pixels within a time frame of 30 s. See also Supplemental Movie S3. Scale bar = 10 µm. D to F, Dynamics of AtEB1a:GFP in cells at the front of infection, which express low levels of MP. The cell on the left shows AtEB1:GFP comets, whereas in the cell on the right, which is marked by a white rectangle, the dynamic behavior of microtubules and AtEB1a:GFP is inhibited (see Supplemental Movie S5). The area within the white rectangle is magnified in E and F showing that in the cell on the right, MP:RFP (E) colocalizes with AtEB1a:GFP (F) on microtubules and microtubule-associated spots (arrows). Scale bar = 10 µm. G, Confocal image of the leading front of a TMV-MP:RFP infection site. In the absence of AtEB1a:GFP, MP:RFP is localized to PD (arrows) and replication bodies and does not show any accumulation on microtubules. Differential interference contrast is applied to show the localization of cell walls. Scale bar = 20 µm. H, Dual-color confocal image of the leading front of infection in the presence of AtEB1a:GFP. The leading front cell is marked by an asterisk. An adjacent noninfected cell is marked by a double asterisk. The highlighted area shows parts of adjacent infected and noninfected cells and is magnified in I. Scale bar = 50 µm. I, Whereas in the lower, noninfected cell (double asterisk) microtubules are dynamic and show the typical comet-like staining pattern of AtEB1a:GFP (arrow), the dynamic behavior of microtubules and AtEB1a:GFP is inhibited in the upper, infected cell (asterisk; see also Supplemental Movie S6). In the infected cell, MP:RFP colocalizes with AtEB1a:GFP in microtubule-associated spots. The yellow color is due to colocalization of green AtEB1a:GFP and red MP:RFP signal (for individual red and green channels, see Supplemental Fig. S1). Scale bar = 10 µm. J to L, Split red (J), green (K), and merged (L) dual-color confocal image of a cell just behind the infection front. MP:RFP (J) colocalizes with AtEB1a:GFP (K) on microtubules. Scale bar = 10 µm.

 
To test the effect of TMV infection on microtubule dynamics and nucleation sites, we infected the leaves with TMV-MP:RFP, a TMV derivative expressing the MP in fusion to RFP (Ashby et al., 2006Go). At 2 d postinfection (dpi), the leaves were agroinfiltrated for expression of AtEB1a:GFP and analyzed by microscopy 40 h later (Fig. 1A). Time-lapse microscopy revealed that cells in front of spreading infection sites exhibit numerous growing microtubules with the typical comet-like gradient of AtEB1a:GFP fluorescence at their tips (Fig. 1B; see also Supplemental Movie S2). However, cells within the infection site were characterized by the absence of any growing microtubules and comet-like structures usually formed by AtEB1a:GFP. Instead, AtEB1a:GFP now accumulated along the length of the microtubules (Fig. 1C; see also Supplemental Movie S3). Thus, infection appears to interfere with the ability of transiently AtEB1a:GFP-expressing cells to nucleate and polymerize new microtubules. The inhibitory effect of infection on AtEB1a:GFP dynamics occurred already in cells at the leading front of infection (Fig. 1, D–F; Supplemental Movies S4 and S5). In these cells (e.g. in the cell marked by the white rectangle in Fig. 1D), AtEB1a:GFP showed excessive colocalization with MP:RFP (Fig. 1, E and F) within spots along microtubules. Given that MP usually does not yet accumulate on microtubules in leading front cells, this localization of MP is likely induced by AtEB1a:GFP. The colocalization of both proteins suggests that the inhibition of AtEB1a:GFP dynamics occurs in consequence of an interaction between the two proteins. Inhibition may occur as AtEB1a:GFP sequesters MP, thereby causing premature microtubule association and, therefore, microtubule stabilization by MP (Ashby et al., 2006Go). In parallel, or alternatively, MP may sequester AtEB1a:GFP and, potentially, endogenous EB1, thus leading to the inhibition of polymerization at the microtubule end.

The aggregation of MP:RFP and AtEB1a:GFP to microtubule-associated spots and inhibition of microtubule dynamics in cells at the leading front of infection was also revealed by confocal microscopy (Fig. 1, H and I; Supplemental Movie S6; Supplemental Fig. S1). Colocalization of MP:RFP with AtEB1a:GFP was even more evident in cells of the second or third cell layer behind the infection front, where more MP:RFP accumulated. Here, both proteins could be found to localize along the length of the dynamically inactivated microtubules (Fig. 1, J–L). Collectively, these findings indicate that TMV-MP:RFP infection interferes with microtubule dynamics in AtEB1a:GFP-expressing cells. The observed colocalization of MP:RFP and AtEB1a:GFP to microtubule-associated spots in cells at the leading front of infection expressing only low amounts of the protein suggests that these two proteins interact and mutually interfere with their normal localization and function. This effect may be enhanced by the MAP-like properties of MP (Ashby et al., 2006Go), especially in cells in which MP:RFP is highly expressed.

We note that the effect of infection on microtubule and AtEB1a:GFP dynamics is transient. For example, when cells at the leading front of infection were analyzed at 72 h postinfiltration, the comet-like appearance of AtEB1a:GFP had partially resumed (data not shown). Thus, the effect of infection on microtubule and AtEB1a:GFP dynamics may depend on specific transient AtEB1a:GFP and MP:RFP expression conditions or may be overcome by cellular mechanisms at later time points.


EB1a:GFP Expression Interferes with Virus Movement

The above findings indicate that EB1a:GFP expression leads to microtubule localization of MP:RFP in cells at the leading front of infection, where its microtubule localization is not usually observed. To investigate whether this change in localization of the virus-encoded MP:RFP is correlated with changes in the efficiency of TMV cell-to-cell spread, we compared the MP:RFP-mediated virus movement between tissues expressing either AtEB1a:GFP or free, nonfused GFP as a control. Thus, leaves were inoculated with TMV-MP:RFP and, at 3 dpi, images of individual infection sites were acquired and their sizes measured. Subsequently, the leaves were agroinfiltrated for expression of AtEB1a:GFP or GFP, respectively. After 48 h (5 dpi), the infection sites observed at 3 dpi were again analyzed to reveal the increase in their size over time. Eleven TMV-MP:RFP infection sites each were analyzed in AtEB1a:GFP- and GFP-expressing leaves. As is shown in Figure 2 , although variable to some extent, the increase in the size of TMV-MP:RFP infection sites is significantly reduced in AtEB1a:GFP-expressing leaves compared to GFP-expressing leaves. Thus, AtEB1a:GFP expression interferes with the efficient spread of TMV-MP:RFP infection. Given that TMV-MP:GFP infection in turn interferes with microtubule and AtEB1a:GFP dynamics, it appears that MP:RFP and AtEB1a:GFP interfere with each other in a mutual manner. This mutual interaction is supported by the observed colocalization of both proteins. Moreover, the finding that the colocalization of MP:RFP and AtEB1a:GFP on microtubules is correlated with AtEB1a:GFP-induced inhibition of TMV spread may confirm the concept that the quantitative accumulation of MP on microtubules seen during late stages of normal infection (Heinlein et al., 1998aGo) may be related to the inactivation of its transport function and that microtubule binding and inactivation of MP may be enhanced by ectopic expression of microtubule-interacting proteins, such as AtEB1a:GFP, as described here, or MPB2C, as described previously (Curin et al., 2007Go).


Figure 2
View larger version (34K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Expression of AtEB1a:GFP, but not expression of GFP, significantly reduces the efficiency of TMV-MP:RFP cell-to-cell movement. The statistical significance of the effect was confirmed by a Student's t test (P << 0.01).

 

Interference of TMV Infection with AtEB1a:GFP Dynamics Is MP Mediated

To investigate if the colocalization of MP:RFP and AtEB1a:GFP and the loss of microtubule dynamics involve a function of MP that is independent of virus infection, we analyzed the localization of MP:RFP and AtEB1a:GFP in N. benthamiana epidermal cells upon transient coexpression of both proteins in agroinfiltrated leaves. As in the previous agroinfiltration experiment, the cells were observed at 40 h postinfiltration. When expressed alone in wild-type or tua-GFP-expressing plants under these conditions, MP:RFP localized predominantly to bodies of various sizes (Fig. 3A ), rather weakly to filaments (microtubules, weakly seen in Fig. 3A) and strongly to PD-like structures (Fig. 3B), as has been previously reported for MP:GFP expressed upon transfection by microparticle bombardment (Kotlizky et al., 2001Go). Time-lapse analysis of tua-GFP-expressing plants indicates that microtubules are dynamic in MP:RFP-expressing cells (Fig. 3, D, 1–3, and E, 1–4) unless they are covered with the protein, in which case they are stabilized (Ashby et al., 2006Go). The analysis of tua-GFP-expressing plants also revealed that at least some of the MP:RFP bodies occurred in association with microtubule y-junctions or intersections, which may suggest that MP:RFP targets cortical microtubule nucleation sites (Supplemental Fig. S2).


Figure 3
View larger version (64K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Transient expression of MP:RFP, AtEB1a:GFP, and both MP:RFP and AtEB1a:GFP. A to E4, Transient expression of MP:RFP. A, Upon expression by agroinfiltration, MP:RFP localizes to small and larger bodies as well as (weakly) to filaments. Scale bar = 10 µm. B, Transiently expressed MP:RFP also localizes to PD. Scale bar = 10 µm. C to D3, Expression of MP:RFP upon agroinfiltration in tua:GFP plants. The presence of MP:RFP (C) does not interfere with dynamic microtubule growth (yellow arrows, movie frames D1–3 and E1–4) or shrinkage (red arrows, movie frames E3 and 4). Scale bars = 5 µm. F to H7, Expression of AtEB1a:GFP. F, AtEB1a:GFP highlights growing plus ends of tua:GFP-labeled microtubules (see also Supplemental Movie S7). Scale bar = 10 µm. G1 to 3, Movie frames showing that AtEB1a:GFP also labels foci (arrow in G2) from which microtubules originate (arrow in G3) and, thus, marks the location of microtubule nucleation sites (arrowhead in G1). As the microtubule polymerizes, AtEB1a:GFP associates with the growing plus end (arrow in G3). Scale bar = 2.5 µm. H1 to 7, Loss of AtEB1a:GFP labeling is associated with microtubule shrinkage. Movie frames showing a growing microtubule with AtEB1a:GFP labeling at the tip (H1–3, arrow) that upon loss of the AtEB1a:GFP cap (H4, arrow) exhibits rapid shrinkage (H5–7, arrow). Scale bar = 2.5 µm. I to L, Transient coexpression of MP:RFP and AtEB1a:GFP. I to K, Green channel (I), red channel (J), and merged channel (K) movie frames showing transiently expressed MP:RFP and AtEB1a:GFP colocalizing to microtubules, which show no signs of dynamic activity. See also Supplemental Movie S8. Scale bar = 10 µm. L, Projection of green channel dynamic pixels within 30 s of the time-lapse movie. The absence of dynamic pixels indicates that the AtEB1a:GFP-labeled microtubules shown in I are dynamically inactive. M to Q, Protoplasts derived from an AtEB1a:GFP-transgenic BY2-cell suspension line infected with TMV-MP:RFP. M to O, Confocal images illustrating that AtEB1a:GFP and MP:RFP colocalize along the length of dynamically inhibited microtubules. Green (M) and red (N) channel images, showing the distribution of AtEB1:GFP and MP:RFP, respectively, as well as a merged image (O), are shown. Scale bar = 5 µm. P and Q, Movie data showing the lack of microtubule dynamics in TMV-MP:RFP-infected protoplasts.

 
When we used agroinfiltration to coexpress AtEB1a:GFP together with tua-GFP, a dynamic microtubule cytoskeleton was observed, and the growing microtubule plus ends were highlighted by EB1a:GFP (Fig. 3F; Supplemental Movie S7). We note that, consistent with the reports by Chan et al. (2003)Go and Murata et al. (2005)Go, AtEB1a:GFP also labeled microtubule nucleation sites on existing microtubules, from which new tua-GFP- and AtEB1a:GFP-labeled microtubules emerged, thus forming y-junctions (Fig. 3G, 1–3). Importantly, we also observed that following microtubule growth, microtubule shortening coincided with the disappearance of the AtEB1a:GFP-labeled cap from the plus end (Fig. 3H, 1–7; Supplemental Movie S7), thus providing evidence for the functional integration of AtEB1a:GFP in microtubule polymerization.

We then replaced tua-GFP with MP:RFP and analyzed the agroinfiltrated cells again at 40 h postagroinfiltration. Here, unlike in cells expressing AtEB1a:GFP alone or in combination with tua:GFP, the dynamic behavior of microtubules and AtEB1a:GFP was impaired and AtEB1a:GFP localized along the length of the microtubules (Fig. 3, I–L; Supplemental Movie S8). Moreover, also the MP:RFP localized predominantly to microtubules (Fig. 3, I–K), which is in contrast to cells expressing MP:RFP in the absence of AtEB1:GFP (Fig. 3A). Control agroinfiltration experiments demonstrated that the strong inhibitory effect of MP:RFP on microtubule dynamics in AtEB1a:GFP-expressing cells cannot be mimicked by coexpression of the RFP-tagged microtubule-binding domain of MAP4 (RFP:MAP4-MBD; Van Damme et al., 2004Go) and also the coexpression of the microtubule-stabilizing, GFP-tagged, Arabidopsis MAP65-5 (AtMAP65-5:GFP; Van Damme et al., 2004Go) does not produce such inhibition (Supplemental Movies S9 and S10; Supplemental Fig. S3). Based on these findings, we conclude that the inhibitory effect of TMV-MP:RFP infection on microtubule dynamics observed in AtEB1a:GFP-expressing cells at 40 h postinfiltration (Fig. 1C) is mediated by an interaction of AtEB1a:GFP with MP:RFP and does not require infection. This interaction is not caused by the RFP moiety, and the ability of MP to bind and stabilize microtubules (Ashby et al., 2006Go) appears to be insufficient to fully account for this effect.

We note that in agreement with the transient nature of inhibition of microtubule and AtEB1a:GFP dynamics and the colocalization of MP:RFP and AtEB1a:GFP on microtubules during infection, AtEB1a:GFP comets were occasionally seen also in transiently expressing cells. In these cases, the MP:RFP localized to PD, or to ER or punctate foci in protoplasts.

Moreover, in cells expressing only moderate levels of MP:RFP and AtEB1a:GFP, microtubule colocalization of the two proteins appeared to be concentrated in rather distinct spots that often localized at microtubule y-junctions (Supplemental Fig. S2), which is consistent with the notion that MP may target microtubule nucleation sites.

To determine whether our observations could be dependent on agroinfiltration and transient expression conditions in leaves, we prepared protoplasts of a transgenic BY-2 suspension cell line stably expressing AtEB1a:GFP under the control of a 35S-promotor (Van Damme et al., 2004Go) and infected them with TMV-MP:RFP. Consistent with our observations in planta, the typical dynamic EB1 and microtubule pattern seen in this cell line was maintained in noninfected protoplasts (Supplemental Fig. S4), whereas infection resulted in the colocalization of AtEB1a:GFP with MP:RFP along the length of the microtubules (Fig. 3, M–O) and in the inhibition of microtubule polymerization dynamics (Fig. 3, P and Q). This finding confirms that the inhibitory influence of MP:RFP on microtubule dynamics in AtEB1a:GFP-expressing cells is independent of both the plant system and the method used for expression. We also infected the protoplasts with TMV-MPP81S:GFP. The MP:GFP encoded by this virus carries an inactivating P81S amino acid exchange mutation that does not interfere with the ability of the protein to bind single-stranded nucleic acids but causes mislocalization of the protein to the cytosol (Boyko et al., 2002Go; Vogler et al., 2008Go). Unlike MP:GFP or MP:RFP, this mutant MP:GFP neither colocalized with AtEB1a:GFP nor interfered with microtubule and AtEB1a:GFP dynamics (Supplemental Fig. S4; Supplemental Movie S11).


MP:RFP and AtEB1a:GFP Form a Complex in Vitro and in Vivo

To test whether the inhibitory effect of MP:RFP on AtEB1a:GFP and microtubule dynamics may be mediated by the formation of a complex between both proteins, a pulldown assay was performed by using recombinant MP:His6 bound to NiNTA sepharose (Ashby et al., 2006Go) as affinity matrix for proteins present in the soluble fraction of a lysate prepared from the AtEB1a:GFP-expressing BY-2 cells. The cell lysate was prepared in the cold and in the presence of Triton X-100 to disrupt microtubules and membranes, respectively. The extract was cleared by subsequent centrifugations at 20,000g and 100,000g to obtain a soluble protein fraction, which was used for incubation with MP:His6. To control for nonspecific binding, the proteins were also incubated with the nonconjugated NiNTA matrix. Moreover, to disrupt unspecific ionic interactions between MP and proteins in the extract, the assay was performed in the presence of 1% bovine serum albumin (BSA) and 250 mM NaCl.

Western-blot analysis (Fig. 4A ) leads to the detection of AtEB1a:GFP in the elution fraction, along with {alpha}-tubulin. Binding of these proteins is specific for functional MP, because the amount of these proteins found in the elution fraction was significantly reduced when the assay was performed with MPP81S:His6 (Fig. 4B), despite that the amount of MPP81S:His6 was equal to the amount of MP:His6 applied in this assay (data not shown). The interaction between AtEB1a:GFP and MP indicated by this result was further tested by far-western analysis (Fig. 4C). Here, proteins in cell lysates derived from the AtEB1a:GFP-expressing BY-2 cells and from nontransgenic control cells were blotted on polyvinylidene fluoride membrane following electrophoresis, then denatured and renatured, and finally incubated with soluble recombinant MPP81S:His6 (lanes 1 and 2) or MP:His6 (lanes 3–6). Detection of MPP81S:His6 and MP:His6 with anti-MP antibody a band of about 60 kD, which is present on the blot incubated with MP:His6 (lane 4, asterisk) but is absent on the blot incubated with MPP81S:His6 (lane 2), and which is also absent from lanes in which proteins derived from AtEB1a:GFP-nonexpressing control cells were separated (lanes 1 and 3). Reprobing the membrane with anti-GFP antibody (lanes 5 and 6) revealed that the 60-kD band detected in the MP-overlay corresponds to AtEB1a:GFP (lane 6, asterisk). This 60-kD band is not detected when the overlay experiment is performed with denatured MPP81S:His6 (lanes 7 and 8), denatured MP:His6 (lanes 9 and 10), or no protein (lanes 11 and 12), and probing the membrane with anti-MP antibody, indicating that the binding of MP to AtEB1a:GFP (lane 4) is specific and requires the tertiary structure of MP. Antibody cross-reactivity leads to detection of a single nonspecific band around 40 kD (double asterisk) in all experiments involving anti-MP antibody. Collectively, these results indicate that AtEB1a:GFP is an interaction partner for MP.


Figure 4
View larger version (56K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. MP interacts with EB1a:GFP in vitro and in vivo. A, Pulldown assay with MP:His6 as bait. Immobilized recombinant MP:His6 binds AtEB1a:GFP as well as tubulin. MP:His6 resin and control resin (control) were incubated with protein extracts derived from BY2-cells that were either wild type (WT) or transgenic for AtEB1a:GFP (EB1a). Following electrophoresis and blotting of the eluted proteins, the membrane was incubated with antibody against {alpha}-tubulin (left, lanes 1–4) or antibody against GFP (right, lanes 5–8; detection of AtEB1a:GFP). A slight cross reactivity of anti-GFP antibody with MP:His6 is indicated by an asterisk. B, Compared to MP:His6, MPP81S:His6 has reduced capacity to bind EB1 or tubulin in vitro. Pulldown assay with MP:His6, MPP81S:His6, and control resin for binding of proteins from extracts derived from AtEB1a:GFP-transgenic BY2-cells. Eluted proteins were blotted and probed with antibody against {alpha}-tubulin (left, lanes 1–3) or antibody against GFP (right, lanes 4–6; detection of AtEB1a:GFP). The column chart displays the amount of eluted proteins averaged from four experiments. Amount of MP:His6-bound {alpha}-tubulin and AtEB1a:GFP in the eluate was set to 100%. C, Far-western assay. Recombinant soluble MP:His6, but not recombinant MPP81S:His6, binds to immobilized AtEB1a:GFP. Proteins derived from BY2-cells that were either wild type (WT) or transgenic for AtEB1a:GFP (EB1a) were separated by electrophoresis and blotted. Following denaturation and subsequent renaturation the blotted proteins were incubated with either soluble, recombinant MPP81S:His6 (lanes 1 and 2), MP:His6 (lanes 3, 4, 5, 6, 13, and 14), heat-denatured MPP81S:His6 (lanes 7 and 8), heat-denatured MP:His6 (lanes 9 and 10), or mock solution (lanes 11 and 12). Following extensive washing, the blot overlays were incubated with antibody against either MP (lanes 1 – 4 and 7–12) or GFP (lanes 5 and 6). Blot overlays were also incubated with secondary antibody only (lanes 13 and 14). *, Lanes 4 and 6, AtEB1a:GFP; **, all lanes except 5, 6, 13, and 14, unspecific cross reactivity with anti-MP antibody. D to G, FLIM assay. MP interacts with AtEB1a:GFP in vivo. Fluorescence intensity images acquired by FLIM are shown as gray scale pictures (left). Lifetime images (central) are represented as pseudo-color according to the color code ranging from 1 ns (blue) to 3 ns (orange). The respective lifetime values measured for AtEB1a:GFP (D) and GFP:MAP4 (F) alone or upon coexpression with MP:RFP (E) and (G), respectively, are indicated on the color scales. Coexpression with MP:RFP strongly reduces the fluorescence lifetime of AtEB1a:GFP but not of GFP:MAP4-MBD.

 
To confirm in vivo the interactions observed between AtEB1a:GFP and MP:RFP, we analyzed the value of fluorescence resonance energy transfer (FRET) from the excited fluorescent donor GFP to the RFP acceptor. FRET is dependent on both protein tags being in close proximity, generally up to a maximum of 5 to 10 nm, a distance corresponding to intermolecular protein-protein interactions (Bastiaens and Pepperkok, 2000Go; Hink et al., 2002Go). The FRET efficiency was straightforwardly measured with the fluorescence lifetime imaging microscopy (FLIM) technique through the decrease of the fluorescence lifetime of the donor at each spatially resolvable element of a microscope image. Indeed, in contrast to fluorescence intensities, the fluorescence lifetimes are absolute parameters that do not depend on the instrumentation or the local concentration of the fluorescent molecules. Thus, changes of the fluorescence lifetimes of the donor will provide a direct evidence for a physical interaction between the labeled proteins with high spatial and temporal resolution (Bastiaens and Squire, 1999Go).

The mean fluorescence lifetime of the donor molecule was first determined in cells expressing AtEB1a:GFP alone. An average fluorescence lifetime of 2.37 ± 0.06 ns was determined from measurements performed on 170 individual microtubules analyzed in three separate experiments (Table I ; Fig. 4D). This average lifetime for the S65T GFP variant moiety of AtEB1a:GFP is well in agreement with the 2.4-ns lifetime reported for EGFP (F64L, S65T)-labeled proteins (Jakobs et al., 2000Go; Treanor et al., 2005Go). Subsequently, FLIM-based FRET analysis was performed on microtubules in cells expressing AtEB1a:GFP together with MP:RFP as acceptor molecule. Here, the fluorescence lifetime of the donor AtEB1a:GFP was reduced to 1.89 ± 0.13 ns (t test >0.05), which equals a FRET efficiency of 21% (Table I; Fig. 4E). As a control, no photons at wavelengths corresponding to S65T-GFP emission could be detected when only MP:RFP or free RFP was present (data not shown), confirming that FLIM measurements are specific for the S65T-GFP-tagged donor molecule. To determine whether FRET between MP:RFP and AtEB1:GFP might occur because of overexpression or because of colocalization and vicinity of binding of the two proteins to the microtubule surface, we replaced AtEB1a:GFP with GFP-fused MAP4-MBD (GFP:MAP4-MBD). In this case, the average lifetime of the donor (Fig. 4F) remained unchanged in the presence of MP:RFP (Fig. 4G). We therefore conclude that MP:RFP interacts with AtEB1a:GFP in vivo.


View this table:
[in this window]
[in a new window]

 
Table I. FRET-FLIM analysis of interactions between AtEB1a:GFP (S65T) or GFP:MAP4-MBD and MP:RFP (mRFP1) upon transient expression in N. benthamiana leaf cells

The average fluorescence lifetime ({tau}) values and their respective SDs, as determined for AtEB1a:GFP alone or in the presence of MP:RFP, are shown. From the fluorescence lifetimes, the percentage of FRET was calculated by the equation given in "Materials and Methods." The total number of microtubules analyzed is indicated by n, and N is the number of independent experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Research presented here was undertaken to further address the interaction of the TMV MP with the microtubule cytoskeleton. Recent evidence has shown that during the course of infection, the MP first forms mobile, microtubule-associated particles (Boyko et al., 2007Go) and, during later stages, accumulates on microtubules, leading to their stabilization (Boyko et al., 2000aGo; Ashby et al., 2006Go). However, although these associations with microtubules are related to the function of the protein in TMV RNA movement (Boyko et al., 2000aGo, 2000bGo, 2000cGo, 2002Go, 2007Go), the microtubules themselves may not represent the initial target of MP. Indeed, results of experiments using heterologous expression of MP in mammalian cells suggested that the MP may interact with microtubule nucleation factors before accumulating on the microtubules themselves (Ferralli et al., 2006Go).

The findings described herein provide confirmation to this notion by showing that during infection and in transfected plant cells, MP colocalizes and interacts with AtEB1a:GFP. The ability of MP to interact with AtEB1a:GFP and to undergo FRET in vivo is demonstrated by FLIM and supported by the ability of His-tagged MP to form a complex with plant-derived AtEB1a:GFP in vitro. These findings indicate that MP may target EB1, a factor of central importance in the regulation of microtubule dynamics (Chan et al., 2003Go; Bisgrove et al., 2004Go; Lansbergen and Akhmanova, 2006Go; Akhmanova and Steinmetz, 2008Go). An interaction with EB1 could be in the pathway that during late infection leads to microtubule accumulation of MP because MPP81S, which fails to efficiently interact with AtEB1a:GFP in vitro, also fails to colocalize with microtubules and AtEB1a:GFP in vivo.

Our experiments involved the expression of high amounts of AtEB1a:GFP and, except for cells at the leading front of infection, also of MP:RFP. Thus, some of our in vivo observations may be related to the high expression of these proteins. For example, at a high concentration, like during late stages of infection, the MP exhibits properties of a MAP that binds and stabilizes microtubules (Ashby et al., 2006Go). Thus, the observed inhibition of microtubule and AtEB1a:GFP dynamics may involve manifestations of this MAP activity. Nevertheless, interactions are implied by the fact that, generally, the proteins behaved normally when ectopically expressed alone, whereas they colocalized to the length of microtubules when expressed together. In fact, several observations argue for direct in vivo interactions between MP:RFP and AtEB1a:GFP.

First, MP:RFP colocalized with AtEB1a:GFP to microtubules also in cells at the leading front of infection, which express only low amounts of MP:RFP and in which MP:RFP usually does not occur at detectable levels on microtubules. Thus, in this case, the inhibition of microtubule and AtEB1a:GFP dynamics is independent of high MP:RFP expression but rather a result of sequestration of MP:RFP by AtEB1a:GFP.

Second, we show by in vitro affinity binding and far-western experiments, as well as by in vivo FLIM experiments, that MP:RFP and AtEB1a:GFP have the capacity to interact. Given that the FLIM results are indicative of FRET, which occurs only if protein tags are less than 10 nm apart, the interactions involve direct binding interactions in vivo.

Third, coexpression of AtEB1a:GFP with other microtubule-binding proteins, i.e. RFP:MAP4-MBD and MAP65-5:GFP, did not result in an inhibition of cellular microtubule and AtEB1a:GFP dynamics to the extent seen with MP:RFP under the same experimental conditions. Thus, binding and stabilization of microtubules seem insufficient to explain the effects of MP:RFP on microtubule dynamics occurring in the presence of AtEB1a:GFP.

In addition, when expressed alone or together with AtEB1a:GFP, MP was observed to accumulate at punctate, microtubule y-junctions and other microtubule-associated sites, which may bear resemblance to previously described cortical microtubule nucleation sites (Chan et al., 2003Go; Murata et al., 2005Go). This finding may reflect interactions of MP with endogenous EB1 at microtubule nucleation sites. An interaction of MP with endogenous EB1 at such sites would be consistent with our previous finding that the expression of MP in mammalian COS7 cells interferes with the ability of centrosomes to anchor and polymerize microtubules (Boyko et al., 2000aGo; Ferralli et al., 2006Go). Mammalian EB1 localizes to the centrosome and is required for centrosomal microtubule minus-end anchorage and polymerization (Louie et al., 2004Go). The MP-induced inhibition of centrosomal activity is independent of microtubule association (Ferralli et al., 2006Go) and indeed appears to mimic the cytoskeletal phenotype of EB1-depleted cells (Louie et al., 2004Go), thus suggesting that MP may bind and sequester EB1 in mammalian cells.

Because AtEB1a:GFP binds MP:RFP, the effects of ectopic expression of AtEB1a:GFP may resemble the effects of ectopic expression previously reported for MPB2C (Kragler et al., 2003Go). Like AtEB1a:GFP, MPB2C also binds both microtubules and MP. Moreover, similar to the case of AtEB1a:GFP, the expression of MPB2C also resulted in the binding of MP to microtubules and inhibition of PD-mediated transport (Kragler et al., 2003Go; Curin et al., 2007Go). It may be possible that EB1 and MPB2C share a role in regulating or mediating microtubule interactions of MP and lead to the production of an inhibitory complex when overexpressed.

Considering that AtEB1a:GFP may be expressed to a higher level than endogenous EB1, the observed inhibition of microtubule dynamics in cells expressing both AtEB1a:GFP and MP does not necessarily imply that interactions of MP with endogenous EB1 would also lead to the formation of an inhibitory complex. Indeed, we noted here that in the absence of AtEB1a:GFP, microtubules are dynamic in MP-expressing cells, unless microtubules are coated with the protein (Ashby et al., 2006Go). Unfortunately, the analysis of potential interactions of MP with endogenous N. benthamiana EB1 is hampered by the lack of EB1 protein sequence information and of suitable antibodies. Thus, without such important tools, further studies may have to be performed with an Arabidopsis-infecting tobamovirus, because EB1 protein sequences are known for Arabidopsis and can be addressed by mass spectroscopy.

Nevertheless, given the evidence indicating that MP interacts with EB1, several potential roles of such an interaction can be envisioned. Because in our experiments the overexpression of AtEB1a:GFP promoted the binding of MP to microtubules, EB1 could participate in the formation of MP:microtubule complexes usually observed during late stages of infection, when high amounts of MP have accumulated. On the other hand, MP may target EB1 to manipulate microtubule polymerization. For example, EB1b, another member of the EB1 family in Arabidopsis, was shown to localize to microtubule tips that upon extension can exert pulling forces on ER membranes and thus contribute to dynamic endomembrane reorganization (Mathur et al., 2003Go). Considering that in the plant cortical cytoplasm, microtubules are in close proximity to the endomembrane network (Lancelle et al., 1987Go; Hepler et al., 1990Go; Lichtscheidl and Hepler, 1996Go), an interaction between MP and EB1 could thus contribute to the formation, distribution, or movement of membrane-associated replication complexes. The interaction of MP with EB1 may also allow MP to capture microtubule plus ends and thereby cause the local reorganization of the microtubule array. A precedent for such a model is provided by the EB1-interacting adenomatous polyposis coli protein. This protein occurs in the centrosome (Louie et al., 2004Go) but also in peripheral clusters able to capture growing microtubule ends and thus to contribute to the organization of microtubule networks in mammalian cells (Barth et al., 2002Go; Reilein and Nelson, 2005Go). An interaction of MP with similar complexes may be involved in the MP-induced formation of protrusions on the surface of infected protoplasts (Heinlein et al., 1998aGo), of fibrous structures in the cavities of PD in MP-transgenic plants (Ding et al., 1992Go; Moore et al., 1992Go; Lapidot et al., 1993Go), or of cytoskeletal fibers through the septa that connect adjacent cells in MP-transgenic cyanobacteria (Heinlein et al., 1998bGo). Finally, in other organisms, EB1 proteins were shown to interact with microtubule motor proteins (Korinek et al., 2000Go; Browning et al., 2003Go). Thus, MP could interact with EB1 to gain access to microtubule motor-mediated trafficking during early stages of infection.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Material

The in planta observations were made in Nicotiana benthamiana using either wild-type plants or plants that express the Arabidopsis (Arabidopsis thaliana) TUA6 gene fused to GFP (tua-GFP) and produce GFP-labeled microtubules (Gillespie et al., 2002Go). Wild-type and transgenic plants were grown from seeds and maintained in approximately 70% humidity at 23°C with a 16-h photoperiod. Three- to 4-week-old plants were used for infiltration assays and inoculation experiments.


Constructs

The construction of infectious clones encoding TMV-MPP81S:GFP and TMV-MP:RFP and conditions for the inoculation of plants are described elsewhere (Boyko et al., 2002Go; Ashby et al., 2006Go). Also, the expression of His6-tagged MP (MP:His6) from expression vector pQE60 (QIAGEN) is described elsewhere (Boyko et al., 2002Go).

Binary vectors pB7-MP:GFP and pB7-MP:RFP expressing the MP of TMV fused C terminally to fluorescent protein under control of the 35S promoter were created by Gateway cloning. The full-length MP sequence was amplified from TMV-U1-encoding plasmid pU3/12 (Holt and Beachy, 1991Go), using primers containing attB1 and attB2 sites (forward primer, GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGCTCTAGTTGTTAAAGGAAAAGTG; reverse primer, GGGGACCACTTTGTACAAGAAAGCTGGGTAAAACGAATCCGATTCGGCGACAGTAGCC) and recombined into pDonR/Zeo (Invitrogen). Following sequence confirmation, this entry clone was used for recombination with destination vectors pB7FWG2 or pB7RWG2, respectively (Karimi et al., 2002Go). A binary pBIN-GWC vector encoding AtEB1a:GFP (Chan et al., 2003Go) was kindly provided by Dr. Jordi Chan and Professor Clive Lloyd (John Innes Centre, Norwich, UK). Binary vectors encoding G/RFP:MAP4-MBD and AtMAP65-5:GFP, respectively, were previously described (Van Damme et al., 2004Go) and supplied by Danny Geelen and Dirk Inzé (Ghent University, Belgium). Plasmid pBinGFP, a binary vector encoding GFP under control of the 35S promoter, was kindly provided by Olivier Voinnet (Institut de Biologie Moléculaire des Plantes, Strasbourg, France).


Agroinfiltration

Transformed agrobacteria (GV3101) were grown at 28°C in 5 mL Luria-Bertani medium containing selective antibiotics. Upon harvest (OD600 = 0.5) by centrifugation, the volume of bacteria was resuspended in the same volume of water and infiltrated with the help of a syringe into leaves. For coinfiltration, the suspensions were mixed equally (1:1) just before infiltration. At 36 to 46 h postinfiltration, the infiltrated leaf regions were analyzed by fluorescence microscopy.


Infection of BY-2 Cells

Protoplasts of tobacco (Nicotiana tabacum) BY-2 cells transgenic for AtEB1a:GFP (Van Damme et al., 2004Go) were prepared and inoculated by electroporation with infectious transcripts according to procedures described previously (Heinlein et al., 1998aGo).


Fluorescence Microscopy and Image Processing

Plant tissues as well as protoplasts were observed with a Nikon TE2000 inverted microscope equipped for real-time imaging with a Roper CoolSnap digital CCD camera, a piezo-driven Z-focus, and a 60x 1.45 NA TIRF objective. Excitation/emission wavelengths were 460 to 500 nm/510 to 560 nm for GFP and 550 to 600 nm/615 to 665 nm for RFP. For simultaneous dual color acquisitions, a Dual-View beam splitter was used. The beam splitter was equipped with GFP-mRFP1 exciter and mirror as well as with emission filters HQ510/30m for GFP and HQ650/75m for RFP. To reduce red background emission fluorescence caused by chlorophyll, an e640sp short pass filter (Chroma) was inserted between the beam splitter and the CCD. Metamorph (6.2r6) and ImageJ (1.32j) software was used for image acquisition, analysis, and processing. Images showing dynamic movie pixels were created by projecting pixel differences between movie frames using an Image J macro available at http://rsb.info.nih.gov/ij/macros/Slice-to-Slice%20Difference.txt.

BY-2 protoplasts settled on a poly-L-Lys-coated coverslip and mounted into an Attofluor cell chamber (Invitrogen) were observed with a Zeiss LSM510 laser scanning microscope using a C-Apo-chromat (63x; v1.2 W Korr) water objective lens under multitrack mode. Excitation/emission wavelengths were 488 nm/505 to 545 nm for GFP and 543 nm/long pass 560 nm for mRFP. Confocal images were processed using LSM510 version 2.8 (Zeiss), ImageJ (1.32j), and Adobe Photoshop v7.0.


FLIM

Time-correlated single-photon counting FLIM measurements were performed on a home-built two-photon system based on an Olympus IX70 inverted microscope with an Olympus 60x 1.2NA water immersion objective, as previously described (Azoulay et al., 2003Go; Clamme et al., 2003Go). Two-photon excitation was provided by a mode-locked titanium:sapphire laser (Tsunami; Spectra Physics), which was tuned to an emission wavelength of 900 nm. For FLIM, the laser power was adjusted to give counting rates with peaks up to a few 106 photons s–1 so that the pile-up effect can be neglected. Imaging was realized by a laser scanning system using two fast galvo mirrors (model 6210; Cambridge Technology) operating in the descanned fluorescence collection mode.

Photons were collected using a two-photon short pass filter with a cut-off wavelength of 680 nm (F75-680; AHF), and a band-pass filter 520 ± 17 nm (F37-520; AHF). Fluorescence was directed to a fiber-coupled avalanche photodiode (SPCM-AQR-14-FC; Perkin Elmer), which was connected to a time-correlated single photon-counting module (SPC830; Becker and Hickl), which operates in the reversed start-stop mode.

Typically, the samples were scanned continuously for about 30 s to achieve appropriate photon statistics for the fluorescence decays. Data were analyzed using a commercial software package (SPCImage V2.8; Becker and Hickl), which uses an iterative reconvolution method to recover the lifetimes from the fluorescence decays.

In FRET experiments, when coexpressing donor and acceptor proteins, the FRET efficiency reflecting the distance between the two chromophores was calculated according to:

Formula
where R0 is the Förster radius, R the distance between donor and acceptor, {tau}fret is the lifetime of the donor in the presence of the acceptor, and {tau}free the lifetime of the donor in the absence of acceptor.


Homogenization of BY-2 Cells

BY-2 cells were harvested by filtration with a vacuum pump. The vacuum-dry pellet was shock-frozen in liquid nitrogen. Frozen cells were powdered with a micro-dismembrator (Satorius) for 2 min at 3,000 rpm. Then 1 g of the powdered cells was resuspended in 2 mL of pulldown buffer I (PDB-I: 50 mM HEPES, pH 7, 25 mM imidazole, 250 mM NaCl, 2 mM dithiothreitol [DTT], 2 mM MgCl2, 10% glycerol, 0.5% Triton X-100, 2 mm phenylmethylsulfonyl fluoride, 1x protease inhibitor cocktail [Roche]) and thawed on ice. To obtain a homogenous suspension, the lysed cells were passed five times through a 26G needle. The soluble protein fraction ("total fraction") was obtained by centrifugation of the lysate at 20,000g for 10 min at 4°C and subsequent centrifugation of the supernatant at 100,000g for 1 h at 4°C.


Pulldown Assay

Recombinant MP:His6 and mutant MP (MPP81S:His6) were prepared from Escherichia coli as described (Boyko et al., 2002Go), except that the renaturation of MP:His6 was performed by resuspension of the MP:His6- or MPP81S:His6-complexed NiNTA Sepharose beads in PDB-I by incubation for 1 h at 4°C. For in vitro binding studies, each soluble protein sample was preincubated with NiNTA Sepharose for 1 h at 4°C to reduce the amount of nonspecific binding to the beads. Subsequently, each of the samples was divided into two aliquots, one of which was rotated for 2 h at 4°C with equally MP:His6- or MPP81S:His6-complexed NiNTA beads, whereas the other was incubated under the same conditions with empty NiNTA beads as control. Subsequently, the samples were centrifuged at 1000 rpm at 4°C for 2 min and washed 10 times in PDB-II (50 mM HEPES, pH 7, 25 mM imidazole, 250 mM NaCl, 2 mM DTT, 2 mM MgCl2, 10% glycerol, 0.25% Triton X-100, 2 mm phenylmethylsulfonyl fluoride, 1x protease inhibitor cocktail). Following elution by incubation in elution buffer (500 mM NaCl, 50 mM HEPES, 500 mM imidazole, pH 7.5), proteins were separated by 12.5% SDS-PAGE and blotted onto membrane for detection with GFP-specific rabbit anti-GFP-IV antiserum (kindly provided by D. Gilmer, IBMP, Strasbourg), monoclonal anti-acetylated {alpha}-tubulin antibody (Sigma), or polyclonal anti-AtEB1b antibody (Sigma).


Far Western

Wild-type BY-2 cells and cells expressing AtEB1a:GFP were resuspended in SDS sample buffer (1% SDS, 10% glycerol, 25 mM Tris-HCl, pH 6.8, 1 mM EDTA, 0.7 M mercaptoethanol) to obtain a final protein concentration of 100 µg/µL. The cells were lysed by vortexing and heating for 3 min at 95°C, and 300 µg of total protein was subjected to SDS-PAGE. Upon separation by electrophoresis, the proteins was blotted onto polyvinylidene fluoride membrane using wet transfer and a transfer buffer (25 mM Tris, 192 mM Glycin) without methanol and SDS to ease protein renaturation. The proteins were denatured in buffer A (20 mM Tris-HCl, pH 7.5, 1 mM EDTA, 100 mM NaCl, 1x Denhart solution [0.02% Ficoll, 0.02% BSA, 0.02% PVP-K90]) containing 6 M guanidine-HCl for 15 min and renatured by consecutively washing the membrane at 4°C with a buffer A series with decreasing concentrations of guanidine-HCl, i.e. buffer A containing 3 M guanidine-HCl for 10 min, buffer A containing 1.5 M guanidine-HCl for 10 min, buffer A containing 0.75 M guanidine-HCl for 10 min, buffer A containing 0.375 M guanidine-HCl for 10 min, twice with buffer A without guanidine-HCl for 30 min, and finally again with buffer A for 2 h. Subsequently, the membrane was incubated with blocking solution (20 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 10% glycerol, 100 mM NaCl, 0.1% Tween 20) containing 5% skimmed milk powder for 1 h at 4°C, and after washing twice with blocking solution, the membrane was incubated overnight at 4°C with 50 µg of purified MP:His6 in blocking solution supplemented with 1 mM DTT, 2% skimmed milk powder, and 0.5% BSA. Subsequently, the membrane was washed for 1 h at 4°C in blocking solution containing 5% skimmed milk powder and incubated with anti-MP-C (reactive against MP residues 209–222) antibody for 2 h at 4°C. Bound MP antibody was detected by incubation with anti-rabbit IgG antibody-horseradish peroxidase conjugate (Sigma) followed by a chemiluminescence reaction using ECL Plus western blotting detection reagent (GE Healthcare).


Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Colocalization of MP:RFP and AtEB1a:GFP to microtubule-associated spots.
Supplemental Figure S2. Localization of MP:RFP to microtubule junctions and intersections.
Supplemental Figure S3. Coexpression of AtEB1a:GFP with MAPs.
Supplemental Figure S4. Microtubule and AtEB1a:GFP dynamics in BY-2 cells.
Supplemental Movie S1. AtEB1a:GFP forms comets in N. benthamiana epidermal cells.
Supplemental Movie S2. Microtubules in AtEB1a:GFP-expressing cells are dynamic outside TMV-MP:RFP infection site.
Supplemental Movie S3. Microtubules in AtEB1a:GFP-expressing cells are not dynamic inside TMV-MP:RFP infection site.
Supplemental Movie S4. Nondynamic microtubules in AtEB1a:GFP-expressing cells at the infection front.
Supplemental Movie S5. Patterns of AtEB1a:GFP in cells near the infection front.
Supplemental Movie S6. Confocal movie showing the loss of AtEB1a:GFP dynamics in a cell at the infection front.
Supplemental Movie S7. Dynamic pattern of AtEB1a:GFP in a tua:GFP transgenic plant.
Supplemental Movie S8. Nondynamic pattern of AtEB1a:GFP and MP:RFP in cotransfected epidermal cells.
Supplemental Movie S9. Pattern of AtEB1a:GFP in a cell also expressing RFP:MAP4-MBD.
Supplemental Movie S10. Pattern of AtEB1a:GFP in a cell also transiently expressing microtubule-stabilizing AtMAP65-5:GFP.
Supplemental Movie S11. AtEB1a:GFP-expressing BY-2 cell protoplast infected with TMV-MPP81S:GFP.


    ACKNOWLEDGMENTS
 
We thank the Functional Genomics Division of the Department of Plant Systems Biology at the VIB-Ghent University for providing plasmids pB7FWG2 and pB7RWG2, Professors Clive Lloyd, Dr. Jordi Chan, the John Innes Centre, and the Biotechnology and Biological Sciences Research Council for providing binary vector encoding AtEB1a:GFP, Professor David Gilmer (IBMP, Strasbourg) for providing antibody against GFP, and Dr. Danny Geelen (Ghent University) for providing the AtEB1a:GFP-expressing BY-2 cell line as well as binary plasmids for expression of AtMAP65-5:GFP and G/RFP:MAP4-MBD. We also are grateful to Richard Wagner and Chantal Fitterer for raising plants and maintaining BY-2 cultures, Jéròme Mutterer for assistance in fluorescence microscopy, and Antonio Serrato for general technical support.

Received February 8, 2008; accepted April 1, 2008; published April 11, 2008.


    FOOTNOTES
 
1 This work was supported by the Deutscher Akademischer Austauschdienst, Germany (postdoctoral fellowship grant to K.B.), the Generalidad Valenciana, Spain (postdoctoral fellowship grants CTBPDC/2204/015 and BPOSTDOC06/072 to A.S.), le ministère délégué à la recherche, France (grant no. ACI BCMS187 to M.H.), and the CNRS, France. The fluorescence lifetime imaging microscopy setup was supported by the Association pour la Recherche contre le Cancer, France, the Association Française contre les Myopathies, the Fondation pour la Recherche Médicale, France, Sidaction, the program Physique-Chimie du Vivant of the CNRS, and the Réseau Technologique en microscopie photonique, France, through the Missions, Ressources et Compétences Technologiques of the CNRS. Back

2 These authors contributed equally to the article. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Manfred Heinlein (manfred.heinlein{at}ibmp-ulp.u-strasbg.fr).

[W] The online version of this article contains Web-only data. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.108.117481

* Corresponding author; e-mail manfred.heinlein{at}ibmp-ulp.u-strasbg.fr.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Akhmanova A, Steinmetz MO (2008) Tracking the ends: a dynamic protein network controls the fate of microtubule tips. Nat Rev Mol Cell Biol 9: 309–322[CrossRef][Web of Science][Medline]

Ashby J, Boutant E, Seemanpillai M, Groner A, Sambade A, Ritzenthaler C, Heinlein M (2006) Tobacco mosaic virus movement protein functions as a structural microtubule-associated protein. J Virol 80: 8329–8344[Abstract/Free Full Text]

Askham JM, Vaughan KT, Goodson HV, Morrison EE (2002) Evidence that an interaction between EB1 and p150(Glued) is required for the formation and maintenance of a radial microtubule array anchored at the centrosome. Mol Biol Cell 13: 3627–3645[Abstract/Free Full Text]

Asurmendi S, Berg RH, Koo JC, Beachy RN (2004) Coat protein regulates formation of replication complexes during Tobacco mosaic virus infection. Proc Natl Acad Sci USA 101: 1415–1420[Abstract/Free Full Text]

Azoulay J, Clamme JP, Darlix JL, Roques BP, Mely Y (2003) Destabilization of the HIV-1 complementary sequence of TAR by the nucleocapsid protein through activation of conformational fluctuations. J Mol Biol 326: 691–700[CrossRef][Web of Science][Medline]

Barth AI, Siemers KA, Nelson WJ (2002) Dissecting interactions between EB1, microtubules and APC in cortical clusters at the plasma membrane. J Cell Sci 115: 1583–1590[Abstract/Free Full Text]

Bastiaens PI, Pepperkok R (2000) Observing proteins in their natural habitat: the living cell. Trends Biochem Sci 25: 631–637[CrossRef][Web of Science][Medline]

Bastiaens PI, Squire A (1999) Fluorescence lifetime imaging microscopy: spatial resolution of biochemical processes in the cell. Trends Cell Biol 9: 48–52[CrossRef][Web of Science][Medline]

Bisgrove SR, Hable WE, Kropf DL (2004) +TIPs and microtubule regulation. The beginning of the plus end in plants. Plant Physiol 136: 3855–3863[Free Full Text]

Boyko V, Ashby JA, Suslova E, Ferralli J, Sterthaus O, Deom CM, Heinlein M (2002) Intramolecular complementing mutations in Tobacco mosaic virus movement protein confirm a role for microtubule association in viral RNA transport. J Virol 76: 3974–3980[Abstract/Free Full Text]

Boyko V, Ferralli J, Ashby J, Schellenbaum P, Heinlein M (2000a) Function of microtubules in intercellular transport of plant virus RNA. Nat Cell Biol 2: 826–832[CrossRef][Web of Science][Medline]

Boyko V, Ferralli J, Heinlein M (2000b) Cell-to-cell movement of TMV RNA is temperature-dependent and corresponds to the association of movement protein with microtubules. Plant J 22: 315–325[CrossRef][Web of Science][Medline]

Boyko V, Hu Q, Seemanpillai M, Ashby J, Heinlein M (2007) Validation of microtubule-associated Tobacco mosaic virus RNA movement and involvement of microtubule-aligned particle trafficking. Plant J 51: 589–603[CrossRef][Web of Science][Medline]

Boyko V, van der Laak J, Ferralli J, Suslova E, Kwon MO, Heinlein M (2000c) Cellular targets of functional and dysfunctional mutants of Tobacco mosaic virus movement protein fused to GFP. J Virol 74: 11339–11346[Abstract/Free Full Text]

Browning H, Hackney DD, Nurse P (2003) Targeted movement of cell end factors in fission yeast. Nat Cell Biol 5: 812–818[CrossRef][Web of Science][Medline]

Chan J, Calder GM, Doonan JH, Lloyd CW (2003) EB1 reveals mobile microtubule nucleation sites in Arabidopsis. Nat Cell Biol 5: 967–971[CrossRef][Web of Science][Medline]

Citovsky V, Knorr D, Schuster G, Zambryski P (1990) The P30 movement protein of Tobacco mosaic virus is a single-stranded nucleic acid binding protein. Cell 60: 637–647[CrossRef][Web of Science][Medline]

Clamme JP, Azoulay J, Mely Y (2003) Monitoring of the formation and dissociation of polyethylenimine/DNA complexes by two photon fluorescence correlation spectroscopy. Biophys J 84: 1960–1968[Web of Science][Medline]

Curin M, Ojangu EL, Trutnyeva K, Ilau B, Truve E, Waigmann E (2007) MPB2C, a microtubule-associated plant factor, is required for microtubular accumulation of Tobacco mosaic virus movement protein in plants. Plant Physiol 143: 801–811[Abstract/Free Full Text]

Dawson WO, Bubrick P, Grantham GL (1988) Modifications of the Tobacco mosaic virus coat protein gene affecting replication, movement, and symptomatology. Phytopathology 78: 783–789[CrossRef][Web of Science]

Deom CM, Oliver MJ, Beachy RN (1987) The 30-kilodalton gene product of Tobacco mosaic virus potentiates virus movement. Science 237: 384–389[Abstract/Free Full Text]

Ding B, Haudenshield JS, Hull RJ, Wolf S, Beachy RN, Lucas WJ (1992) Secondary plasmodesmata are specific sites of localization of the Tobacco mosaic virus movement protein in transgenic tobacco plants. Plant Cell 4: 915–928[Abstract/Free Full Text]

Dixit R, Chang E, Cyr R (2006) Establishment of polarity during organization of the acentrosomal plant cortical microtubule array. Mol Biol Cell 17: 1298–1305[Abstract/Free Full Text]

Dorokhov YL, Alexandrov NM, Miroshnichenko NA, Atabekov JG (1983) Isolation and analysis of virus-specific ribonucleoprotein of Tobacco mosaic virus-infected tobacco. Virology 127: 237–252[CrossRef][Web of Science][Medline]

Dorokhov YL, Alexandrova NM, Miroshnichenko NA, Atabekov JG (1984) The informosome-like virus-specific ribonucleoprotein (vRNP) may be involved in the transport of Tobacco mosaic virus infection. Virology 137: 127–134[CrossRef][Web of Science][Medline]

Ferralli J, Ashby J, Fasler M, Boyko V, Heinlein M (2006) Disruption of microtubule organization and centrosome function by expression of Tobacco mosaic virus movement protein. J Virol 80: 5807–5821[Abstract/Free Full Text]

Gillespie T, Boevink P, Haupt S, Roberts AG, Toth R, Vantine T, Chapman S, Oparka KJ (2002) Functional analysis of a DNA shuffled movement protein reveals that microtubules are dispensable for the cell-to-cell movement of Tobacco mosaic virus. Plant Cell 14: 1207–1222[Abstract/Free Full Text]

Heinlein M (2002) Plasmodesmata:dynamic regulation and role in macromolecular cell-to-cell signalling. Curr Opin Plant Biol 5: 543–552[CrossRef][Web of Science][Medline]

Heinlein M, Epel BL (2004) Macromolecular transport and signaling through plasmodesmata. Int Rev Cytol 235: 93–164[Web of Science][Medline]

Heinlein M, Epel BL, Padgett HS, Beachy RN (1995) Interaction of tobamovirus movement proteins with the plant cytoskeleton. Science 270: 1983–1985[Abstract/Free Full Text]

Heinlein M, Padgett HS, Gens JS, Pickard BG, Casper SJ, Epel BL, Beachy RN (1998a) Changing patterns of localization of the Tobacco mosaic virus movement protein and replicase to the endoplasmic reticulum and microtubules during infection. Plant Cell 10: 1107–1120[Abstract/Free Full Text]

Heinlein M, Wood MR, Thiel T, Beachy RN (1998b) Targeting and modification of prokaryotic cell-cell junctions by Tobacco mosaic virus cell-to-cell movement protein. Plant J 14: 345–351[CrossRef][Web of Science][Medline]

Hepler PK, Palevitz BA, Lancelle SA, McCauley MM, Lichtscheidl I (1990) Cortical endoplasmic reticulum in plants. J Cell Sci 96: 355–373[Abstract/Free Full Text]

Hink MA, Bisselin T, Visser AJ (2002) Imaging protein-protein interactions in living cells. Plant Mol Biol 50: 871–883[CrossRef][Web of Science][Medline]

Holt CA, Beachy RN (1991) In vivo complementation of infectious transcripts from mutant Tobacco mosaic virus cDNAs in transgenic plants. Virology 181: 109–117[CrossRef][Web of Science][Medline]

Jakobs S, Subramaniam V, Schonle A, Jovin TM, Hell SW (2000) EFGP and DsRed expressing cultures of Escherichia coli imaged by confocal, two-photon and fluorescence lifetime microscopy. FEBS Lett 479: 131–135[CrossRef][Web of Science][Medline]

Kahn TW, Lapidot M, Heinlein M, Reichel C, Cooper B, Gafny R, Beachy RN (1998) Domains of the TMV movement protein involved in subcellular localization. Plant J 15: 15–25[CrossRef][Web of Science][Medline]

Karimi M, Inze D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7: 193–195[CrossRef][Web of Science][Medline]

Korinek WS, Copeland MJ, Chaudhuri A, Chant J (2000) Molecular linkage underlying microtubule orientation toward cortical sites in yeast. Science 287: 2257–2259[Abstract/Free Full Text]

Kotlizky G, Katz A, van der Laak J, Boyko V, Lapidot M, Beachy RN, Heinlein M, Epel BL (2001) A dysfunctional movement protein of Tobacco mosaic virus interferes with targeting of wild type movement protein to microtubules. Mol Plant Microbe Interact 7: 895–904

Kragler F, Curin M, Trutnyeva K, Gansch A, Waigmann E (2003) MPB2C, a microtubule-associated plant protein binds to and interferes with cell-to-cell transport of Tobacco mosaic virus movement protein. Plant Physiol 132: 1870–1883[Abstract/Free Full Text]

Lancelle SA, Cresti M, Hepler PK (1987) Ultrastructure of the cytoskeleton in freeze-substituted pollen tubes of Nicotiana alata. Protoplasma 140: 141–150[CrossRef][Web of Science]

Lansbergen G, Akhmanova A (2006) Microtubule plus end: a hub of cellular activities. Traffic 7: 499–507[CrossRef][Web of Science][Medline]

Lapidot M, Gafny R, Ding B, Wolf S, Lucas WJ, Beachy RN (1993) A dysfunctional movement protein of Tobacco mosaic virus that partially modifies the plasmodesmata and limits spread in transgenic plants. Plant J 4: 959–970[CrossRef][Web of Science]

Lichtscheidl I, Hepler PK (1996) Endoplasmic reticulum in the cortex of plant cells. In M Smallwood, JP Knox, DJ Bowles, eds, Membranes: Special Functions in Plants. BIOS Scientific Publishers, Oxford, pp 383–402

Louie RK, Bahmanyar S, Siemers KA, Votin V, Chang P, Stearns T, Nelson WJ, Barth AI (2004) Adenomatous polyposis coli and EB1 localize in close proximity of the mother centriole and EB1 is a functional component of centrosomes. J Cell Sci 117: 1117–1128[Abstract/Free Full Text]

Más P, Beachy RN (1999) Replication of Tobacco mosaic virus on endoplasmic reticulum and role of the cytoskeleton and virus movement in intracellular distribution of viral RNA. J Cell Biol 147: 945–958[Abstract/Free Full Text]

Mathur J, Mathur N, Kernebeck B, Srinivas BP, Hulskamp M (2003) A novel localization pattern for an EB1-like protein links microtubule dynamics to endomembrane organization. Curr Biol 13: 1991–1997[CrossRef][Web of Science][Medline]

McLean BG, Zupan J, Zambryski PC (1995) Tobacco mosaic virus movement protein associates with the cytoskeleton in tobacco plants. Plant Cell 7: 2101–2114[Abstract]

Moore P, Fenczik CA, Deom CM, Beachy RN (1992) Developmental changes in plasmodesmata in transgenic tobacco expressing the movement protein of Tobacco mosaic virus. Protoplasma 170: 115–127[CrossRef][Web of Science]

Murata T, Sonobe S, Baskin TI, Hyodo S, Hasezawa S, Nagata T, Horio T, Hasebe M (2005) Microtubule-dependent microtubule nucleation based on recruitment of gamma-tubulin in higher plants. Nat Cell Biol 7: 961–968[CrossRef][Web of Science][Medline]

Nogales E, Whittaker M, Milligan RA, Downing KH (1999) High-resolution model of the microtubule. Cell 96: 70–88

Oparka KJ, Prior DAM, Santa Cruz S, Padgett HS, Beachy RN (1997) Gating of epidermal plasmodesmata is restricted to the leading edge of expanding infection sites of Tobacco mosaic virus. Plant J 12: 781–789[CrossRef][Web of Science][Medline]

Rehberg M, Graf R (2002) Dictyostelium EB1 is a genuine centrosomal component required for proper spindle formation. Mol Biol Cell 13: 2301–2310[Abstract/Free Full Text]

Reichel C, Beachy RN (1998) Tobacco mosaic virus infection induces severe morphological changes of the endoplasmic reticulum. Proc Natl Acad Sci USA 95: 11169–11174[Abstract/Free Full Text]

Reilein A, Nelson WJ (2005) APC is a component of an organizing template for cortical microtubule networks. Nat Cell Biol 7: 463–473[CrossRef][Web of Science][Medline]

Rogers SL, Rogers GC, Sharp DJ, Vale RD (2002) Drosophila EB1 is important for proper assembly, dynamics, and positioning of the mitotic spindle. J Cell Biol 158: 873–884[Abstract/Free Full Text]

Seemanpillai M, Elamawi R, Ritzenthaler C, Heinlein M (2006) Challenging the role of microtubules in Tobacco mosaic virus movement by drug treatments is disputable. J Virol 80: 6712–6715[Abstract/Free Full Text]

Treanor B, Lanigan PM, Suhling K, Schreiber T, Munro I, Neil MA, Phillips D, Davis DM, French PM (2005) Imaging fluorescence lifetime heterogeneity applied to GFP-tagged MHC protein at an immunological synapse. J Microsc 217: 36–43[Web of Science][Medline]

Van Damme D, Van Poucke K, Boutant E, Ritzenthaler C, Inze D, Geelen D (2004) In vivo dynamics and differential microtubule-binding activities of MAP65 proteins. Plant Physiol 136: 3956–3967[Abstract/Free Full Text]

Vaughan KT (2005) TIP maker and TIP marker; EB1 as a master controller of microtubule plus ends. J Cell Biol 171: 197–200[Abstract/Free Full Text]

Vogler H, Kwon MO, Dang V, Sambade A, Fasler M, Ashby J, Heinlein M (2008) Tobacco mosaic virus movement protein enhances the spread of RNA silencing. PLoS Pathog 4: e1000038[CrossRef][Medline]

Wright KM, Wood NT, Roberts AG, Chapman S, Boevink P, Mackenzie KM, Oparka KJ (2007) Targeting of TMV movement protein to plasmodesmata requires the actin/ER network; evidence from FRAP. Traffic 8: 21–31[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Plant Physiol.Home page
C. Hofmann, A. Niehl, A. Sambade, A. Steinmetz, and M. Heinlein
Inhibition of Tobacco Mosaic Virus Movement by Expression of an Actin-Binding Protein
Plant Physiology, April 1, 2009; 149(4): 1810 - 1823.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
P. Ruggenthaler, D. Fichtenbauer, J. Krasensky, C. Jonak, and E. Waigmann
Microtubule-Associated Protein AtMPB2C Plays a Role in Organization of Cortical Microtubules, Stomata Patterning, and Tobamovirus Infectivity
Plant Physiology, March 1, 2009; 149(3): 1354 - 1365.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
G. Ben-Nissan, W. Cui, D.-J. Kim, Y. Yang, B.-C. Yoo, and J.-Y. Lee
Arabidopsis Casein Kinase 1-Like 6 Contains a Microtubule-Binding Domain and Affects the Organization of Cortical Microtubules
Plant Physiology, December 1, 2008; 148(4): 1897 - 1907.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
147/2/611    most recent
pp.108.117481v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brandner, K.
Right arrow Articles by Heinlein, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brandner, K.
Right arrow Articles by Heinlein, M.
Agricola
Right arrow Articles by Brandner, K.
Right arrow Articles by Heinlein, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2008 by the American Society of Plant Biologists