|
|
||||||||
|
First published online June 26, 2008; 10.1104/pp.108.123802 Plant Physiology 147:1845-1857 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Bridging the Gap between Plant and Mammalian Polyamine Catabolism: A Novel Peroxisomal Polyamine Oxidase Responsible for a Full Back-Conversion Pathway in Arabidopsis1,[W],[OA]Department of Biology, University of Crete, 71409 Heraklion, Greece (P.N.M., A.H.A., K.A.R.-A.); and Centro Nacional de Biotecnologia-Consejo Superior de Investigaciones Científicas, Universidad Autonoma de Madrid, 28049 Madrid, Spain (M.S., E.R., J.J.S.-S.)
In contrast to animals, where polyamine (PA) catabolism efficiently converts spermine (Spm) to putrescine (Put), plants have been considered to possess a PA catabolic pathway producing 1,3-diaminopropane, 1-pyrroline, the corresponding aldehyde, and hydrogen peroxide but unable to back-convert Spm to Put. Arabidopsis (Arabidopsis thaliana) genome contains at least five putative PA oxidase (PAO) members with yet-unknown localization and physiological role(s). AtPAO1 was recently identified as an enzyme similar to the mammalian Spm oxidase, which converts Spm to spermidine (Spd). In this work, we have performed in silico analysis of the five Arabidopsis genes and have identified PAO3 (AtPAO3) as a nontypical PAO, in terms of homology, compared to other known PAOs. We have expressed the gene AtPAO3 and have purified a protein corresponding to it using the inducible heterologous expression system of Escherichia coli. AtPAO3 catalyzed the sequential conversion/oxidation of Spm to Spd, and of Spd to Put, thus exhibiting functional homology to the mammalian PAOs. The best substrate for this pathway was Spd, whereas the N1-acetyl-derivatives of Spm and Spd were oxidized less efficiently. On the other hand, no activity was detected when diamines (agmatine, cadaverine, and Put) were used as substrates. Moreover, although AtPAO3 does not exhibit significant similarity to the other known PAOs, it is efficiently inhibited by guazatine, a potent PAO inhibitor. AtPAO3 contains a peroxisomal targeting motif at the C terminus, and it targets green fluorescence protein to peroxisomes when fused at the N terminus but not at the C terminus. These results reveal that AtPAO3 is a peroxisomal protein and that the C terminus of the protein contains the sorting information. The overall data reinforce the view that plants and mammals possess a similar PA oxidation system, concerning both the subcellular localization and the mode of its action.
Polyamines (PAs) are well-known, low-molecular-mass organic compounds, and the most abundant ones, putrescine (Put), spermidine (Spd), and spermine (Spm), exert a multifunctional role in plant development and defense (Thomas and Thomas, 2001
Oxidation is the main catabolic pathway of PAs. PA oxidation in mammals is exerted by multiple enzymatic activities with PA oxidase (PAO; EC 1.5.3.11), mainly localized in peroxisomes, and converting Spm to Put, via Spd producing hydrogen peroxide (H2O2; Schrader and Fahimi, 2004
Biochemical evidence for the existence of a back-conversion pathway in plants was presented by Del Duca et al. (1995)
In contrast to their mammalian counterparts, a correlation with PA oxidation has not been established yet for plant peroxisomes (Hayashi and Nishimura, 2006
In this work, an in silico analysis of the Arabidopsis genome for putative PAO genes was performed, which revealed that AtPAO3 is a putative peroxisomal protein. To further explore this finding, heterologous expression of the gene encoding for AtPAO3 and purification of the respective protein was performed. Transient expression of the AtPAO3 protein fused to the C terminus of the GFP protein revealed that AtPAO3 is localized in organelles. The peroxisomal localization of the AtPAO3 was further documented by colocalization experiments in Nicotiana benthamiana leaves. Finally, its novel back-converting enzymatic activity able to convert Spm to Spd and Spd to Put was established. This is the second enzyme characterized so far that possesses back-converting activity, while the first was that reported by Tavladoraki et al. (2006)
PAO3 Cloning and Sequence Comparison
In silico analysis of the Arabidopsis genome showed that it contains five putative PAOs, AtPAO1 (At5g13700; GenBank accession no. NM_121373), AtPAO2 (At2g43020; GenBank accession no. AF364952), AtPAO3 (At3g59050; GenBank accession no. AY143905), AtPAO4 (At1g65840; GenBank accession no. AF364953), and AtPAO5 (At4g29720; GenBank accession no. AK118203), all of which encode proteins with a single amine oxidase domain (Tavladoraki et al., 2006
In mammals, PAOs able to back-convert PAs are localized in peroxisomes (Pledgie et al., 2005 The coding region of the AtPAO3 cDNA was obtained by performing PCR on a pUNI 51 vector containing the AtPAO3 cDNA (Arabidopsis Biological Resource Center [ABRC] Stock Center, clone no. U21196). The size of the AtPAO3 coding region is 1,467 bp. In addition, we checked the expression of the gene in both leaves and roots using reverse transcription (RT)-PCR and detected that the gene is mostly expressed in the leaves (Supplemental Fig. S1).
AtPAO3 encodes for a 488-amino acid protein, with a calculated molecular mass of 54.1 kD and pI 5.81. To overexpress the AtPAO3 protein in a heterologous system, the AtPAO3 cDNA containing the complete open reading frame was introduced into the pDEST-TH1 vector, to fuse AtPAO3 to the maltose-binding protein (MBP; MBP:PAO3) under the inducible tac promoter (fusion of the trp and lac promoters; Fig. 3A ). This construct was introduced into Escherichia coli BL21 cells and induced with isopropyl β-D-thiogalactopyranoside (IPTG) for protein expression (Fig. 3B). AtPAO3 protein was detected at high levels in total cell lysates as soon as 1 h after induction (Fig. 3B). At 37°C, the accumulation of the MBP:PAO3 protein was found mostly in the pellet fraction of cell lysates, as indicated using an anti-MBP-specific polyclonal antibody (Fig. 3C). After decreasing the culture temperature from 37°C to 18°C and the inductive IPTG concentration from 1 mM to 0.05 mM, higher MBP:PAO3 protein accumulation was detected in the soluble fraction (Fig. 3C). Lower temperatures or IPTG concentrations did not have any significant effect on the amount of MBP:PAO3 protein accumulation (data not shown).
To purify the MBP:PAO3 protein, supernatants from cell lysates from induced cultures were passed through an amylose resin to bind the MBP tag, and AtPAO3 protein was purified to >80% (Fig. 3D). Furthermore, digestion of the MBP:PAO3 fusion with the Xa factor, a protease that specifically cleaves the junction between the MBP and PAO3 in the Ile-Leu-Glu-Gly-Arg sequence, resulted in two separate proteins, MBP with a molecular mass of 42 kD and AtPAO3 with a molecular mass of 54 kD (Fig. 3E). The MBP:PAO3 protein was further purified using gel filtration (Fig. 3F). More specifically, the MBP:PAO3 protein sample was applied again to an amylose resin and subsequently to a Sephadex gel filtration column equilibrated with MBP buffer, pH 7.0. Elution was performed with the same buffer, collecting fractions of 3.0 mL. The procedure was repeated twice, and the MBP:PAO3 protein was dialyzed in MBP buffer. More than 3 mg of recombinant MBP:PAO3 L–1 culture could be obtained after the gel filtration step at 18°C and inductive IPTG 0.05 mM (Fig. 3F). The AtPAO3 protein was further purified from the MBP tag after digestion with the Xa factor by applying it to an amylose resin to rebind the MBP. The Xa factor was removed through a hydroxyapatite column, resulting in a single band corresponding to the AtPAO3 protein (Fig. 3F). The final purified protein was subsequently used for the following experiments.
PAO proteins characterized so far are flavoproteins, able to bind via noncovalent bond(s) FAD molecule(s) that act as electron donors to molecular oxygen, necessary for PAO-oxidizing activity (Tavladoraki et al., 2006
Reaction Catalyzed by AtPAO3
In plants, most characterized proteins encoded by PAO genes are responsible for the terminal catabolism of Spd and Spm. Only recently was the Arabidopsis gene AtPAO1 shown to encode for a FAD-binding PAO protein that exhibits a single step back-conversion activity, converting Spm to Spd (Tavladoraki et al., 2006
The previous results prompted us to identify the reaction products of AtPAO3-oxidizing activity. To this end, an in vitro assay and HPLC were combined (Fig. 5B). Analysis of the reaction products revealed that both Spm (retention time, approximately 15 min) and Spd (retention time, approximately 10.9 min) are oxidized by AtPAO3, giving rise to Spd and Put, or Put alone, respectively, without any concomitant production of 1,3-diaminopropane (Fig. 5B). Production of Put from Spm could be detected after approximately 15 min in the in vitro assay using 2 µg of AtPAO3 protein, while when Spd was used as substrate, significantly higher amounts of Put at the same time points could be observed (Fig. 5B). These results reinforce the view that AtPAO3 encodes for an enzyme with PA-oxidizing activity, able to back-convert Spm and Spd to the final product Put in a two-step reaction producing H2O2 as end-product.
The pH optimum for the oxidation of the substrates was found to be 7.5 (Fig. 5C), similar to AtPAO1 (pH = 8; Tavladoraki et al., 2006
The optimum temperature was found to be 37°C, similar to the Homo sapiens peroxisomal PAO (Wang et al., 2003 To further confirm the back-converting activity of AtPAO3, a radiometric method was employed using radiolabeled PAs as substrates, and the conversion efficiency to each product was estimated as a fraction of time (Fig. 6 ). Thus, 80% of the initial Spd was converted to Put within 1 h, while 65% of initial Spm was converted to Spd and Put at the same time point (Fig. 6; Spd and Spm, respectively). On the contrary, radiolabeled Put was not recognized as substrate by AtPAO3.
Kinetic Parameters of AtPAO3
Because the known mammalian PAOs oxidize N1-acetyl derivatives with higher affinity than the nonacetylated ones (Wang et al., 2003
In addition, the inhibition constants of two well-known PAO inhibitors, guazatine and aminoguanidine, were determined using Spd as substrate (Bacchi et al., 2004
In silico protein localization prediction software failed to identify AtPAO3 as a putative peroxisomal protein. However, AtPAO3 contains a peroxisomal targeting signal 1, consisting of a Ser, an Arg, and a Met residue (SRM sequence; amino acids 486–488) at the C-terminal end of the protein, which has been shown to target proteins to peroxisomes in plants (Reumann et al., 2004
To determine where AtPAO3 is localized, we performed a colocalization experiment using yellow fluorescent protein (YFP) and Cherry markers of compartments that resembled the spots observed in 35S:GFP:PAO3 (d35S:YFP:SKL, d35S:mCherry:SKL for peroxisomal and d35S:mYFP for mitochondrial localization; SKL represents the motif Ser-Lys-Leu responsible for peroxisomal localization; Nelson et al., 2007
Because peroxisomes are organelles involved in various stress responses (Nyathi and Baker, 2006
Among the various treatments performed, abscisic acid (ABA) induced AtPAO2 and AtPAO3 mRNA accumulation 1 h posttreatment, while induction of AtPAO4 took longer (6 h). On the other hand, AtPAO5 mRNA abundance was slightly reduced upon ABA treatment. Interestingly, AtPAO3 mRNA returned to basal levels after 24 h in ABA-treated plants (Fig. 8, ABA). JA-treated seedlings showed a marked and transient increase in AtPAO3 mRNA, constantly accumulated up to 6 h to later decrease at 24 h, while AtPAO2 mRNA accumulated only 1 h posttreatment. Treatment with JA did not provoke any significant increase of AtPAO4 or AtPAO5 mRNAs at all time points examined (Fig. 8; JA). SA treatment clearly induced AtPAO3 and AtPAO4 mRNA accumulation 6 h posttreatment, while AtPAO2 showed a slight increase 24 h posttreatment. Interestingly, AtPAO5 significantly accumulated after 24 h, at 0.1 mM SA (Fig. 8, SA). AtPAO2, AtPAO3, and AtPAO4 mRNA rapidly accumulated in wounded plants 1 h after wounding and returned to almost basal levels 6 h thereafter. In addition, seedlings treated with flagellin 22, a pathogen elicitor that activates the plant basal defense, exhibited AtPAO2 and AtPAO3 induction after the 6-h time point, with constant increase up to 24 h, while AtPAO4 was induced 1 h posttreatment returning to basal levels 24 h thereafter (Fig. 8, flagellin). On the other hand, AtPAO5 mRNA abundance showed a significant decrease in seedlings treated with flagellin.
PA oxidation has been considered to be a divergent process giving the notion that this pathway evolved separately in plants and animals, in contrast to PA biosynthesis, which is a conserved process among these kingdoms (Kaur-Sawhney et al., 2003
In an attempt to bridge the gap in our knowledge of PA oxidation between plants and animals, we strived to search the Arabidopsis genome with the scope to identify putative genes that could be functionally similar to the mammalian PAOs in terms of specific activity and localization. Using data obtained from combinatorial in silico analysis and the expression patterns of pao genes, and taking into account the possible localization predicted by AraPerox database (Reumann et al., 2004
More specifically, in mammals, Spd/Spm N1-acetyltransferase (SSAT) is the responsible enzyme for the acetylation of Spd and Spm, and the corresponding acetylated derivatives are orientated toward the catabolic pathway in peroxisomes, where di-acetyl-Spm and N1-acetyl-Spd serve as the optimum substrate for PAOs (SSAT-dependent PA catabolism). In contrast, AtPAO3 exhibits strong preference for nonacetylated Spd and Spm, indicating that AtPAO3 probably does not depend upon a yet-unrecognized SSAT activity (SSAT-independent catabolism; Table I). Moreover, AtPAO1 also showed preference for Spm and not its acetylated derivatives, suggesting that it is also SSAT independent (Tavladoraki et al., 2006
Interestingly, AtPAO1 and AtPAO3 exhibit a significant difference in their respective mRNA abundance in plant cells. More specifically, AtPAO3 is a rather constitutively expressed mRNA at relatively high levels in plant tissues (Supplemental Fig. S1), whereas AtPAO1 could only be detected using nested RT-PCR (Tavladoraki et al., 2006 Most known animal PAOs are localized in peroxisomes; AtPAO3 is so far the second organellar PAO recognized in plants in addition to PAO from barley, which is sorted to vacuoles (Cervelli et al., 2004). The localization of AtPAO3 in peroxisomes gives direct evidence for the implication of this organelle in PA oxidation and back-conversion in plant tissues (Fig. 7). This compartmentalization could be of physiological importance considering the oxidative nature of PAO, because the produced H2O2 could be efficiently scavenged through the abundant peroxisomal catalase. Moreover, the apparent nonorganellar localization of AtPAO1, which functionally resembles the mammalian SMO and the AtPAO3 sorting to peroxisomes, could suggest a similar system to the mammalian oxidation system but lacking the SSAT.
The strong induction of the AtPAO3 by JA (early), wounding (early), SA (middle to late), and flagellin (constant; Fig. 8) suggests the relevance of the enzyme to stress defense responses (Alvarez et al., 1998 Our overall results support that AtPAO3 is a peroxisomal PAO, able to back-convert Spm to Spd and subsequently Spd to Put, and provides plant peroxisomes with a new role in PA oxidation/back-conversion. Moreover, the correlation of AtPAO3 with stress responses involving oxidative burst gives evidence for a PA-peroxisomal interplay under (a)biotic stress conditions.
Chemicals All chemicals were purchased from Sigma unless stated otherwise, while radiolabeled PAs were purchased from Amersham.
For the multiple protein alignment and the phylogenetic tree construction, the Expasy Database tools were used (http://au.expasy.org/tools/). For motif and domain scan, the Simple Modular Architecture Research Tool database was used (http://smart.embl.de). The cDNA encoding for the AtPAO3 (clone no. U21196) was provided by the ABRC stock center (http://www.arabidopsis.org).
Seeds of Arabidopsis (Arabidopsis thaliana) ecotype Columbia-0 were surface sterilized and sown in 24-well (10 seeds per well) tissue culture clusters, containing 1 mL/well of sterile Murashige and Skoog medium (Murashige and Skoog salts; Duchefa) supplemented with 0.5% Suc and grown with shaking (150 rpm) in a culture room under 16-h-d (26°C)/8-h night (22°C) diurnal cycles. Fresh medium, 500 µL/well, was added 9 d after sowing, and experiments were conducted 1 d later. Prior to treatment initiation, the medium remaining in the wells was removed and 1 mL of fresh medium with the different compounds tested was added.
For the AtPAO3 cDNA cloning into vector pDONR207, the primer pairs GGGGACAAGTTTGTACAAAAAAGCAGGCTTGATGGAGTCCGGAGGCAAC (PAO3-FOR) and GGGGACCACTTTGTACAAGAAAGCTGGGTATTACATACGGGAGATCAGAAG (PAO3-REV) were used, and inserts were cloned into the pDEST-TH1 (Hammrastrom et al., 2002 PCR amplifications were performed using a thermal PTC-200 PCR cycler and the Pfu (Promega) or Taq (Minotech) polymerase following standard PCR protocols.
Escherichia coli strain BL21 cells were transformed with standard transformation protocols and were induced for protein expression by adding 0.05 to 1 mM IPTG in the Luria Nutrient Broth culture media supplemented with 100 µg mL–1 ampicillin and 2 g L–1 Glc after reaching OD600 = 0.5. The cells were harvested at 2,500g for 20 min at RT and frozen overnight at –80°C. Cells were dissolved in 10 mL of MBP buffer (20 mM Tris, pH 7.4, 400 mM NaCl, and 1 mM EDTA, 0.5 mM PMSF) and lysed at 4°C in a sonicator using four cycles of 15 to 20 s. Cell debris (pellet fraction) was removed after a centrifugation step at 10,000g at 4°C, and supernatant was filtrated using Miracloth and passed through an amylose resin (Biolabs) at 4°C. Protein was eluted using MBP buffer supplemented with 20 mM maltose, and collected fractions were electrophoretically resolved. Protein fusion was digested using the protease Xa factor as described by the manufacturer (Biolabs). The Xa factor was removed using a hydroxyapatite column as described by the manufacturer (Biolabs).
In vitro activity was determined using four different assays. To determine directly the H2O2 production, a modified method of luminol measurement was used. Thus, 2 µg of purified protein were incubated in a 690-µL H2O2 lumination buffer (10 mM Tris, pH 7.0, 1 mM CaCl2, 0.1 mM KCl) supplemented with 100 µL 2.5 mg mL–1 luminol, 10 µL of 0.1 unit mL–1 peroxidase, and 1 to 10 mM final concentration of Put 2HCl, Spd 3HCl, or Spm 4HCl. Counts were measured in a scintillation counter (Beckman) for 10 min, and values were taken in the linear part of the assay. For determination of the kinetic parameters, the method of the oxidation of 4-aminopterine was used (Tavladoraki et al., 2006
Standard calibration curves for N1-AcSpm, N1-AcSpd, and N8-AcSpd were additionally prepared. The
Proteins were extracted and treated as described in Papadakis and Roubelakis-Angelakis (2005) Templates for probes were obtained using the following primers and standard PCR conditions: for PAO1, GGTAGTGGTGAAGACAGAGG (PAO1-FOR) and AGCTTGTGCCTGAGATAAA (PAO1-REV); PAO2, ATGGAGTCCAGGAAAACTC (PAO2-FOR) and GAGACGAGATATAAGAAG (PAO2-REV); PAO3, GGGGACAAGTTTGTACAAAAAAGCAGGCTTGATGGAGTCCGGAGGCAAC (PAO3-FOR) and GGGGACCACTTTGTACAAGAAAGCTGGGTATTACATACGGGAGATCAGAAG (PAO3-REV); PAO4, GGTCACCAAACCCTTCATC (PAO4-FOR) and TTGAGCAAACGATGGAGAAG (PAO4-REV); PAO5 ATGGCGAAGAAAGCAAGA (PAO5-FOR) and AAAATTACATTTGTAAT (PAO5-REV).
For semiquantitative RT-PCR reactions, total mRNA from leaves and roots was extracted and subjected to DNase I RNase-free treatment (Invitrogen) for 45 min at 37°C. After checking the RNA in agarose gel, the samples were subjected to RT-PCR reactions using polyT as primer and the Super RT enzyme according to the manufacturer's instructions (HT Biotechnology). The samples were normalized according to actin and the primers TTGAGCACATTCTGGAAGAGGTG (forward PAO3) and ACACTTTGCCGAGATGGTTTCAG (reverse PAO3) were used for AtPAO3-specific 30 cycle (exponential phase) quantitative RT-PCR reactions. Reactions with samples treated with DNase I but not subjected to RT were also used as negative controls.
Agrobacterium tumefaciens strain C58C1 cells were transformed with the appropriate binary vectors using the freeze-thaw method and PCR confirmed. A. tumefaciens positive clones were grown in Luria-Bertani until OD600 = 0.6 and were pelleted after a centrifugation step at 3,000g for 20 min. Cells were resuspended in MMA (Murashige and Skoog salts, 10 mM MES, pH 5.7, 0.2 mM acetosyringone, 3% Suc) until OD600 = 0.5, incubated at RT for 1 h, and infiltrated in Nicotiana benthamiana leaves, using a 1-mL syringe. Leaves were analyzed after 48 h using a Leica TCS-NT confocal microscope, using the 40x objective. The excitation/emission wavelength was 480/508 nm for GFP, 513/527 nm for YFP, and 587/610 nm for mCherry. The YFP-PRX (PRX: peroxisomal) and mCherry-PRX constructs were purchased from the ABRC Stock Center (http://www.arabidopsis.org). Colocalization was performed by mixing the MMA-resuspended A. tumefaciens GFP:PAO3 with A. tumefaciens YFP-PRX or mCherry-PRX in a ratio 1.2:1 (v/v). Merge of the images was performed using the Leica Confocal software version 2.61. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers NM_121373 (AtPAO1), AF364952 (AtPAO2), NM_115767 (AtPAO3), AF364953 (AtPAO4), and AK118203 (AtPAO5).
The following materials are available in the online version of this article.
The authors are grateful to Dr. Helena Berglund (Karolinska Institute, Sweden) for the generous gift of the pDEST-TH1 vector. Received May 31, 2008; accepted June 18, 2008; published June 26, 2008.
1 This work was supported by the National and European resources (EPEAKII-Pythagoras), Greek-Spain Bilateral Agreement, and COST858, COST FA065 Actions; by the Consejo Superior de Investigaciones Científicas I3P Programme cofinanced by the European Social Fund (to M.S.); and by the Onassis Foundation (scholarship to A.H.A.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Kalliopi A. Roubelakis-Angelakis (poproube{at}biology.uoc.gr).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.108.123802 * Corresponding author; e-mail poproube{at}biology.uoc.gr.
Alvarez ME, Pennell RI, Meijer PJ, Ishikawa A, Dixon RA, Lamb C (1998) Reactive oxygen intermediates mediate a systemic signal network in the establishment of plant immunity. Cell 92: 773–784[CrossRef][Web of Science][Medline] Amendola R, Bellini A, Cervelli M, Degan P, Marcocci L, Martini F, Mariottini P (2005) Direct oxidative DNA damage, apoptosis and radio sensitivity by spermine oxidase activities in mouse neuroblastoma cells. Biochim Biophys Acta 1755: 15–24[Medline] Angelini R, Federico R, Bonfante P (1995) Maize polyamine oxidase: antibody production and ultrastructural localization. J Plant Physiol 145: 686–692[Web of Science] Asai T, Stone JM, Heard JE, Kovtun Y, Yorgey P, Sheen J, Ausubel FM (2000) Fumonisin B1-induced cell death in Arabidopsis protoplasts requires jasmonate-, ethylene-, and salicylate-dependent signaling pathways. Plant Cell 12: 1823–1835 Bacchi CJ, Rattendi D, Faciane E, Yarlett N, Weiss LM, Frydman B, Woster P, Wei B, Marton LJ, Wittner M (2004) Polyamine metabolism in a member of the phylum Microspora (Encephalitozoon cuniculi): effects of polyamine analogues. Microbiology 150: 1215–1224 Capell T, Bassie L, Christou P (2004) Modulation of the polyamine biosynthetic pathway in transgenic rice confers tolerance to drought stress. Proc Natl Acad Sci USA 101: 9909–9914 Cervelli M, Caro O, Penta A, Angelini R, Federico R, Vitale A, Mariottini P (2004) A novel C-terminal sequence from barley polyamine oxidase is a vacuolar sorting signal. Plant J 40: 410–418[CrossRef][Web of Science][Medline] Cona A, Moreno S, Cenci F, Federico R, Angelini R (2005) Cellular re-distribution of flavin-containing polyamine oxidase in differentiating root and mesocotyl of Zea mays L. seedlings. Planta 221: 265–276[CrossRef][Web of Science][Medline] Cona A, Rea G, Angelini R, Federico R, Tavladoraki P (2006) Functions of amine oxidases in plant development and defence. Trends Plant Sci 11: 80–88[CrossRef][Web of Science][Medline] Del Duca S, Beninati S, Serafini-Fracassini D (1995) Polyamines in chloroplasts: identification of their glutamyl and acetyl derivatives. Biochem J 305: 233–237[Web of Science][Medline] Flores HE, Galston AW (1982) Analysis of polyamines in higher plants by high performance liquid chromatography. Plant Physiol 69: 701–706 Ha HC, Woster PM, Yager JD, Casero RA (1997) The role of polyamine catabolism in polyamine analogue-induced programmed cell death. Proc Natl Acad Sci USA 94: 11557–11562 Hammarstrom M, Hellgren N, Van der Berg S, Berglund H, Hard T (2002) Rapid screening for improved solubility of small human proteins produced as fusion proteins in Escherichia coli. Protein Sci 11: 313–321[CrossRef][Web of Science][Medline] Hayashi M, Nishimura M (2006) Arabidopsis thaliana: a model organism to study plant peroxisomes. Biochim Biophys Acta 1763: 1382–1391[Medline] Kaur-Sawhney R, Tiburcio AF, Atabella T, Galston AW (2003) Polyamines in plants: an overview. J Cell Mol Biol 2: 1–12 Kotzabasis K, Christakis-Hampsas MD, Roubelakis-Angelakis KA (1993) A narrow bore HPLC method for the identification and quantitation of free, conjugated and bound polyamines. Anal Biochem 214: 484–487[CrossRef][Web of Science][Medline] Kusano T, Yamaguchi K, Berberich T, Takahashi Y (2007) Advances in polyamine research in 2007. J Plant Res 120: 345–350[CrossRef][Web of Science][Medline] Landry J, Sternglanz R (2003) Yeast Fms1 is a FAD-utilizing polyamine oxidase. Biochem Biophys Res Commun 303: 771–776[CrossRef][Web of Science][Medline] Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P (2006) SMART 5: domains in the context of genomes and networks. Nucleic Acids Res 34: D257–260 Mehta RA, Cassol T, Li N, Ali N, Handa AK, Mattoo AK (2002) Engineered polyamine accumulation in tomato enhances phytonutrient content, juice quality, and vine life. Nat Biotechnol 20: 613–618[CrossRef][Web of Science][Medline] Moschou P, Dellis I, Paschalidis K, Roubelakis-Angelakis KA (2008) Transgenic tobacco plants over-expressing polyamine oxidase are not able to cope with oxidative burst generated by abiotic factors. Physiol Plant 133: 140–156[CrossRef] Nelson BK, Cai X, Nebenführ A (2007) A multi-color set of in vivo organelle markers for colocalization studies in Arabidopsis and other plants. Plant J 51: 1126–1136[CrossRef][Web of Science][Medline] Nyathi Y, Baker A (2006) Plant peroxisomes as a source of signaling molecules. Biochim Biophys Acta 1763: 1478–1495[Medline] Orozco-Cardenas ML, Narvaez-Vasquez J, Ryan CA (2001) Hydrogen peroxide acts as a second messenger for the induction of defence genes in tomato plants in response to wounding, systemin and methyl jasmonate. Plant Cell 13: 179–191 Papadakis AK, Roubelakis-Angelakis KA (2005) Polyamines inhibit NADPH oxidase-mediated superoxide generation and putrescine prevents programmed cell death induced by polyamine oxidase-generated hydrogen peroxide. Planta 220: 826–837[CrossRef][Web of Science][Medline] Paschalidis KA, Roubelakis-Angelakis KA (2005a) Spatial and temporal distribution of polyamine levels and polyamine anabolism in different organs/tissues of the tobacco plant. Correlations with age, cell division/expansion, and differentiation. Plant Physiol 138: 142–152 Paschalidis KA, Roubelakis-Angelakis KA (2005b) Sites and regulation of polyamine catabolism in the tobacco plant. Correlations with cell division/expansion, cell cycle progression, and vascular development. Plant Physiol 138: 2174–2184 Perez-Amador MA, Leon J, Green PJ, Carbonell J (2002) Induction of the arginine decarboxylase ADC2 gene provides evidence for the involvement of polyamines in the wound response in Arabidopsis. Plant Physiol 130: 1454–1463 Pledgie A, Huang Y, Hacker A, Zhang Z, Woster PM, Davidson NE, Casero RA (2005) Spermine oxidase SMO (PAOh1), not N1-acetylpolyamine oxidase PAO, is the primary source of cytotoxic H2O2 in polyamine analogue-treated human breast cancer cell lines. J Biol Chem 280: 39843–39851 Rea G, de Pinto MC, Tavazza R, Biondi S, Gobbi V, Ferrante P, De Gara L, Federico R, Angelini R, Tavladoraki P (2004) Ectopic expression of maize polyamine oxidase and pea copper amine oxidase in the cell wall of tobacco plants. Plant Physiol 134: 1414–1426 Reumann S, Ma C, Lemke S, Babujee L (2004) AraPerox. A database of putative Arabidopsis proteins from plant peroxisomes. Plant Physiol 136: 2587–2608 Rojo E, Titarenko E, León J, Berger S, Vancanneyt G, Sánchez-Serrano JJ (1998) Reversible protein phosphorylation regulates jasmonic acid-dependent and -independent wound signal transduction pathways in Arabidopsis thaliana. Plant J 13: 153–165[CrossRef][Web of Science][Medline] Sasaki-Sekimoto Y, Taki N, Obayashi T, Aono M, Matsumoto F, Sakurai N, Suzuki H, Hirai MY, Noji M, Saito K, et al (2005) Coordinated activation of metabolic pathways for antioxidants and defence compounds by jasmonates and their roles in stress tolerance in Arabidopsis. Plant J 44: 653–668[CrossRef][Web of Science][Medline] Schrader M, Fahimi DH (2004) Mammalian peroxisomes and reactive oxygen species. Histochem Cell Biol 122: 383–393[CrossRef][Web of Science][Medline] Seiler N (1995) Polyamine oxidase, properties and functions. Prog Brain Res 106: 333–344[Web of Science][Medline] Skopelitis DS, Paranychianakis NV, Paschalidis KA, Pliakonis ED, Delis ID, Yakoumakis DI, Kouvarakis A, Papadakis AK, Stephanou EG, Roubelakis-Angelakis KA (2006) Abiotic stress generates ROS that signal expression of anionic glutamate dehydrogenases to form glutamate for proline synthesis in tobacco and grapevine. Plant Cell 18: 2767–2781 Takahashi Y, Uehara Y, Berberich T, Ito A, Saitoh H, Miyazaki A, Terauchi R, Kusano T (2004) A subset of hypersensitive response marker genes, including HSR203J, is the downstream target of a spermine signal transduction pathway in tobacco. Plant J 40: 586–595[CrossRef][Web of Science][Medline] Tassoni A, Van Buuren M, Franceschetti M, Fornale ÌS, Bagni N (2000) Polyamine content and metabolism in Arabidopsis thaliana and effect of spermidine on plant development. Plant Physiol Biochem 38: 383–393[CrossRef][Web of Science] Tavladoraki P, Rossi MN, Saccuti G, Perez-Amador MA, Polticelli F, Angelini R, Federico R (2006) Heterologous expression and biochemical characterization of a polyamine oxidase from Arabidopsis involved in polyamine back conversion. Plant Physiol 149: 1519–1532 Tavladoraki P, Schinina ME, Cecconi F, Di Agostino S, Manera F, Rea G, Mariottini P, Federico R, Angelini R (1998) Maize polyamine oxidase: primary structure from protein and cDNA sequencing. FEBS Lett 426: 62–66[CrossRef][Web of Science][Medline] Thomas T, Thomas TJ (2001) Polyamines in cell growth and cell death: molecular mechanism and therapeutic applications. Cell Mol Life Sci 58: 244–258[CrossRef][Web of Science][Medline] Tiburcio AF, Besford RT, Borrell A (1994) Posttranslational regulation of arginine decarboxylase synthesis by spermine in osmotically-stressed oat leaves. Biochem Soc Trans 22: 455S[Medline] Toninello A, Pietrangeli P, De Marchi U, Salvi M, MondovÌ B (2006) Amine oxidases in apoptosis and cancer. Biochim Biophys Acta 1765: 1–13[Medline] Vacca RA, de Pinto MC, Valenti D, Passarella S, Marra E, Gara DL (2004) Production of reactive oxygen species, alteration of cytosolic ascorbate peroxidase, and impairment of mitochondrial metabolism are early events in heat shochinduced programmed cell death in tobacco bright-yellow 2 cells. Plant Physiol 134: 1100–1112 Wang Y, Murray-Stewart T, Devereux W, Hacker A, Frydman B, Woster PM, Casero RA Jr (2003) Properties of purified human polyamine oxidase, PAOh1/SMO. Biochem Biophys Res Commun 304: 605–611[CrossRef][Web of Science][Medline] Wu T, Yankovskaya V, McIntire WS (2003) Cloning, sequencing, and heterologous expression of the murine peroxisomal flavoprotein N1-acetylated polyamine oxidase. J Biol Chem 278: 20514–20525 Yamaguchi K, Takahashi Y, Berberich T, Imai A, Miyazaki A, Takahashi T, Michael A, Kusano T (2006) The polyamine spermine protects against high salt stress in Arabidopsis thaliana. FEBS Lett 22: 6783–8 Yoda H, Hiroi Y, Sano H (2006) Polyamine oxidase is one of the key elements for oxidative burst to induce programmed cell death in tobacco cultured cells. Plant Physiol 142: 193–206 Yoda H, Yamaguchi Y, Sano H (2003) Induction of hypersensitive cell death by hydrogen peroxide produced through polyamine degradation in tobacco plants. Plant Physiol 132: 1973–1981 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|