|
|
||||||||
|
First published online June 20, 2008; 10.1104/pp.108.121335 Plant Physiology 147:2017-2029 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Glycerol-3-Phosphate Levels Are Associated with Basal Resistance to the Hemibiotrophic Fungus Colletotrichum higginsianum in Arabidopsis1,[W],[OA]Department of Plant Pathology (B.C., S.C.V., S.K., L.V., A.K., P.K.) and Department of Horticulture (B.D.), University of Kentucky, Lexington, Kentucky 40546; and United States Department of Agriculture-Agricultural Research Service, Washington State University, Prosser, Washington 99350 (D.A.N.)
Glycerol-3-phosphate (G3P) is an important component of carbohydrate and lipid metabolic processes. In this article, we provide evidence that G3P levels in plants are associated with defense to a hemibiotrophic fungal pathogen Colletotrichum higginsianum. Inoculation of Arabidopsis (Arabidopsis thaliana) with C. higginsianum was correlated with an increase in G3P levels and a concomitant decrease in glycerol levels in the host. Plants impaired in utilization of plastidial G3P (act1) accumulated elevated levels of pathogen-induced G3P and displayed enhanced resistance. Furthermore, overexpression of the host GLY1 gene, which encodes a G3P dehydrogenase (G3Pdh), conferred enhanced resistance. In contrast, the gly1 mutant accumulated reduced levels of G3P after pathogen inoculation and showed enhanced susceptibility to C. higginsianum. Unlike gly1, a mutation in a cytosolic isoform of G3Pdh did not alter basal resistance to C. higginsianum. Furthermore, act1 gly1 double-mutant plants were as susceptible as the gly1 plants. Increased resistance or susceptibility of act1 and gly1 plants to C. higginsianum, respectively, was not due to effects of these mutations on salicylic acid- or ethylene-mediated defense pathways. The act1 mutation restored a wild-type-like response in camalexin-deficient pad3 plants, which were hypersusceptible to C. higginsianum. These data suggest that G3P-associated resistance to C. higginsianum occurs independently or downstream of the camalexin pathway. Together, these results suggest a novel and specific link between G3P metabolism and plant defense.
Plants have evolved highly specific mechanisms to resist pathogens. The most studied of these involves deployment of resistance (R) proteins, which, in most cases, are effective against specific races of pathogens carrying corresponding avirulence genes (gene-for-gene interactions; Flor, 1971
The establishment and maintenance of a metabolic sink is a crucial aspect of plant pathogenesis that has received very little attention in comparison to signaling involved during initial recognition of a pathogen (Asahi et al., 1979
Recent evidence has suggested that components of primary metabolism can indeed act as signals regulating various aspects of plant defense (Schaaf et al., 1995
Glycerol, a polyalcohol produced during the breakdown of Glc, proteins, pyruvate, triacylglycerols, and other glycerolipids, is a common cellular metabolite present in a wide range of organisms. Glycerol metabolism is initiated upon its conversion to glycerol-3-P (G3P), which can be derived via the glycerol kinase (GK)-mediated phosphorylation of glycerol or via G3P dehydrogenase (G3Pdh)-mediated reduction of dihydroxyacetone phosphate (DHAP; see Fig. 1
). The fundamentally important role of glycerol metabolism is underscored by the high degree of sequence conservation among proteins catalyzing these reactions from evolutionary diverse organisms (Brisson et al., 2001
The hemibiotrophic fungus Colletotrichum higginsianum is pathogenic to Arabidopsis (Narusaka et al., 2004
Mutations in Arabidopsis G3P Synthesis Enzymes Are Associated with Enhanced Susceptibility to Colletotrichum
In vitro growth experiments showed that Glc and glycerol supported similar growth of C. higginsianum (data not shown), suggesting that the fungus was capable of using glycerol as a sole source of carbon. To determine whether high endogenous glycerol levels in the host also supported more growth of the pathogen, we evaluated the response of gli1 plants, which are unable to convert glycerol to G3P (Fig. 1) and, consequently, accumulate approximately 6-fold higher levels of glycerol (Fig. 2A
). In comparison to wild type, the gli1 plants showed increased susceptibility to the pathogen (Fig. 2, B and C). Although this and the in vitro data suggested that high levels of glycerol in gli1 might be responsible for enhanced susceptibility, an alternative possibility was that it was the reduced G3P levels in gli1 that were important. To address this, we determined glycerol levels and pathogen response in gly1 plants, which are impaired in conversion of DHAP to G3P (Fig. 1; Kachroo et al., 2004
We next determined levels of glycerol in Arabidopsis plants inoculated with C. higginsianum and found that the glycerol levels were reduced to approximately 35% at 4 d postinoculation (dpi) in comparison to controls (Fig. 3A ). A similar phenomenon observed in C. gloesporioides-inoculated round-leaved mallow plants was interpreted as pathogen utilization of host glycerol (Wei et al., 2004
Increased G3P Levels Are Associated with Enhanced Resistance to C. higginsianum
We further tested the possibility that the observed increase in G3P, rather than the decrease in glycerol, was important for basal resistance of Arabidopsis to C. higginsianum by evaluating the response of act1 plants to pathogen inoculations. ACT1 (At1g32200) catalyzes the acylation of oleic acid (18:1) on the G3P backbone (Fig. 1; Kunst et al., 1988
To test whether the observed effect was due to some other function of ACT1 independent of G3P levels, we generated act1 gly1 double-mutant plants and inoculated them with C. higginsianum. Because the G3P utilized by the ACT1-catalyzed reaction is derived via GLY1 (Miquel et al., 1998 We found that, in addition to G3P, the levels of Glc and Fru also increased significantly in C. higginsianum-inoculated wild-type plants (Fig. 4G). In contrast, Suc levels decreased, whereas sorbitol levels increased only marginally, and Gal levels did not change significantly. We compared the levels of these sugars in water- and pathogen-treated wild-type, gly1, and act1 genotypes to evaluate whether they were also associated with the pathogen response, like G3P. Pathogen-inoculated leaves of wild-type, gly1, and act1 plants accumulated similar amounts of Fru and Gal (Supplemental Fig. S1A) and varying levels of Glc, Suc, and sorbitol (Supplemental Fig. S1B). However, unlike G3P, the levels of Glc, Suc, and sorbitol did not correlate with the increased susceptibility and resistance of the gly1 and act1 plants, respectively. Together, these data provide further evidence that induced increases in levels of G3P are specifically associated with increased resistance to the pathogen.
To address the question of whether the relative changes in G3P levels in act1 and gly1 plants were a result versus a cause of the final disease outcome, we used a pharmacological approach. In comparison to water treatment, exogenous application of G3P in wild-type plants resulted in enhanced resistance to C. higginsianum (Fig. 5A
). Because exogenous application of glycerol also increases endogenous G3P levels (Aubert et al., 1994
Overexpression of GLY1 Confers Enhanced Resistance to C. higginsianum As a further test of the hypothesis that increased G3P levels enhance resistance to C. higginsianum, we overexpressed GLY1 in wild-type (Columbia [Col-0] ecotype) plants under the control of the cauliflower mosaic virus 35S promoter. Transgenic plants overexpressing GLY1 were morphologically similar to wild-type plants and different lines showed low, moderate, or high expression levels of the transgene (data not shown). Pathogen inoculations showed that the T2 plants overexpressing high levels of GLY1 were resistant, but lines expressing low or moderate levels were as susceptible as wild type (Fig. 6 ; data not shown). Spot inoculation of leaves of the 35S-GLY1 plants expressing high levels of GLY1 transcript resulted in smaller lesions in comparison with inoculated wild-type plants (Fig. 6, A–C). Fungal mycelia did not proliferate beyond the site of inoculation on 35S-GLY1 plants, whereas wild-type plants supported extensive colonization that continued to spread beyond the initial inoculation site (Fig. 6D).
To test whether overexpression of GLY1 would enhance resistance in the absence of GLI1 function, we mobilized the gli1 mutation into the 35S-GLY1 background and analyzed gli1 35S-GLY1 plants for their response to C. higginsianum. The gli1 35S-GLY1 plants were significantly more resistant than the gli1 plants, but more susceptible than 35S-GLY1 (Fig. 6C). This suggests that the GLY1- and GLI1-catalyzed reactions have additive effects, but that GLY1 is the more important player. Based on all of the evidence together, we concluded that the accumulation of G3P or of a G3P-derived metabolite has an important role in basal resistance to C. higginsianum in Arabidopsis.
In addition to GLY1, the Arabidopsis genome encodes four other G3Pdh isoforms that are predicted to localize to cytosol (At2g41540, At3g07690), mitochondria (At3g10370), or plastids (At5g40610; Wei et al., 2001
The act1 Mutation Overcomes Enhanced Susceptibility Conferred by a Deficiency in Camalexin
To determine whether G3P-associated resistance in act1 plants overlapped with known defense pathways, we assessed the effect of the act1 mutation in pad3 plants, which are deficient in camalexin and show enhanced susceptibility to C. higginsianum (Narusaka et al., 2004
Enhanced Susceptibility of gly1 Plants Is Not Due to a Defect in SA or Ethylene Pathways
Because a mutation in sid2 results in enhanced susceptibility to C. higginsianum (Liu et al., 2007
Because a mutation in the ethylene defense signaling pathway also leads to enhanced susceptibility of C. higginsianum (Liu et al., 2007
Increased sensitivity to reactive oxygen species (ROS) has been associated with enhanced susceptibility to some necrotrophic pathogens (Mengiste et al., 2003
The pathosystem involving Arabidopsis and the hemibiotrophic pathogen C. higginsianum offers an exciting opportunity to investigate corresponding mechanisms of pathogenicity and defense in these two experimentally amenable organisms. Based on the evidence described here, we suggest that levels of host G3P, or of G3P-derived metabolites, are important for basal resistance to C. higginsianum. A mutation in GKGLI1 or G3PdhGLY1 conferred enhanced susceptibility to C. higginsianum, and overexpression of G3PdhGLY1 increased resistance to the pathogen. Resistance was correlated with the endogenous G3P levels in the host. Although inoculation with C. higginsianum also led to an increase in hexose sugars in the plant tissues, this increase did not correlate with the enhanced susceptibility or resistance phenotypes seen in the gly1 and act1 plants, respectively. An increase in hexose sugars also occurs in compatible interactions involving biotrophic pathogens and is believed to result from decreased photosynthesis and/or increased respiration and invertase activity (Berger et al., 2007
In Arabidopsis, G3P can be synthesized via the GK-mediated phosphorylation of glycerol or the G3Pdh-mediated reduction of DHAP. The Arabidopsis genome encodes a single GK and multiple isoforms of G3Pdh. The relative contributions of these proteins, in generating the Arabidopsis G3P pool, probably differ in different cellular compartments and during various cellular processes. For example, even though GK is one of the key enzymes contributing to G3P biosynthesis, a mutation in GK (gli1) does not alter the plastidial 16:3 levels (Kachroo et al., 2005
GLY1-overexpressing plants and act1 plants are both resistant to C. higginsianum in contrast with the wild type, which is susceptible to the pathogen. Both act1 and GLY1-overexpressing plants accumulated significantly higher G3P in response to pathogen infection. This suggests that an ability to accumulate G3P upon inoculation is important for expression of high levels of resistance. Although the basal G3P levels in act1 were marginally higher than wild type, GLY1-overexpressing plants had wild-type-like basal levels. One possibility is that substrate (DHAP) levels limit the accumulation of G3P in 35S-GLY1 plants in spite of increased availability of the enzyme and that pathogen inoculation may increase the levels of DHAP. Indeed, substrate limitations also affect activities of other enzymes participating in glycerol metabolism, including GK (S.C. Venugopal, A. Kachroo, and P. Kachroo, unpublished data) and ACT1 (Kachroo et al., 2004
Because mutations in act1 and gly1 do not influence the resistance response to a nonfungal pathogen (Chandra-Shekara et al., 2007
Increased catalysis by ACT1 also results in a concomitant decrease in 18:1 levels, which in turn can induce a novel broad-spectrum resistance-conferring pathway in Arabidopsis (Kachroo et al., 2004
Recent evidence suggests that, in addition to synthesis of G3P, cytosolic G3Pdh participates in a mitochondrial G3P shuttle, impairment of which results in increased basal levels of ROS (Shen et al., 2006 Based on these data, we propose a novel role for glycerol metabolism in basal resistance. Future research will focus on understanding the flux of glycerol metabolic intermediates during pathogenesis in the host.
Plant and Fungal Growth Conditions, Genetic Analyses, and Pathogen Inoculations Plants were grown in MTPS 144 Conviron walk-in chambers at 22°C, 65% relative humidity, and a 14-h photoperiod. Crosses were performed by pollinating emasculated flowers of gly1 or gli1 plants with pollen from act1 or 35S-GLY1 plants, respectively. act1 pad3 plants were obtained from act1 x pad3 cross. All these genotypes were in the Col-0 ecotype background. Genotypes were determined by conducting cleaved amplified polymorphic sequence analysis. A KO mutation in G3Pdhcyt (At2g41540) was identified by screening SALK insertional line 020444. The KO plants were screened using gene-specific (GATGTGAAACTACCCCTTCCC, CTGTGGAGCTGCTAAATGGAG) and gene-specific and a T-DNA left-border primer (GCGTGGACCGCTTGCTGCAACT). Colletotrichum higginsianum Sacc. (IMI 349063) was obtained from CABI Bioscience. The fungus was maintained on potato dextrose agar. Four-week-old Arabidopsis (Arabidopsis thaliana) plants were used for both spray and spot inoculations. Spore suspensions at concentrations of 104 to 106 spores/mL were used for various experiments. For spot inoculations, 10 µL of spore suspension was used to inoculate Arabidopsis leaves. After inoculations, the plants were transferred to a PGV36 Conviron walk-in chamber and covered with a plastic dome to maintain high humidity. Disease symptoms were scored between 4 to 11 dpi. A digital Vernier caliper was used to measure lesion size in spot-inoculated leaves. Each experiment was repeated at least twice and each included 30 to 50 individual plants. Statistical significance was determined using Student's t test.
Small-scale extraction of RNA was performed using the TRIzol reagent (Invitrogen) following the manufacturer's instructions. RNA quality and concentration were determined by gel electrophoresis and determination of A260. Northern-blot analysis and synthesis of random-primed probes was carried out as described earlier (Kachroo et al., 2003
Plant transformation was carried out using the floral-dip method (Clough and Bent, 1998
FA analysis was done by placing leaf tissue in 2 mL of 3% H2SO4 in methanol. After a 30-min incubation at 80°C, 1 mL of hexane with 0.001% butylated hydroxytoluene was added. The hexane phase was then transferred to vials for gas chromatography (GC). One-microliter samples were analyzed by GC on a Varian FAME 0.25 mm x 50 m column and quantified with flame ionization detection. Ion chromatography (BioLC or ICS3000; Dionex Inc.) was used to quantify glycerol, G3P, and neutral sugars levels from plants as described (Downie, 1994
Glycerol (Invitrogen) treatments were carried out by spraying 50 mM solution of glycerol prepared in sterile water. Treatments with G3P were carried out by spraying or injecting 25 or 50 mM solution of G3P (Sigma-Aldrich) prepared in sterile water. Paraquat was prepared in sterile water and 5-µL droplets from 5, 15, 25, 50, and 100 µM solutions were spot inoculated on the leaves.
SA and SAG were extracted and measured from approximately 0.3 g of fresh-weight leaf tissue, as described previously (Chandra-Shekara et al., 2004
For H2O2 determination, leaves were homogenized in 40 mM Tris-HCl, pH 7.0, and to this 20 µM 2',7'-dichlorofluorescein was added. The samples were incubated for 1 h in dark and the H2O2 levels were measured using a spectrofluorimeter. The concentration of H2O2 was determined as µmol/mg protein by extrapolating from the standard H2O2 curve.
In planta infection assays were carried out on Arabidopsis petioles. Attached petioles were inoculated with 10-µL droplets of spore suspensions (5 x 104 spores/mL) and, after incubating for 48 h, the inoculated leaves were detached and the petioles were gently shaved from the back (abaxial) surface with a single-edged razor blade until only a thin layer of the adaxial epidermis remained. After shaving, each section was placed on a microscope slide in water and the number of primary hyphae was counted as a percentage of the total number of appressoria formed.
Leaf samples were taken from mock- and pathogen-inoculated plants and stained as described before (Chandra-Shekara et al., 2006
The following materials are available in the online version of this article.
We would like to thank Ludmila Lapchyk and Etta Nuckles for excellent technical help, Amy Crume for managing the plant growth facility, John Johnson for help with gas chromatography, as well as Thomas Muse and Lev Orlov for help with genotyping. We thank Jane Glazebrook for providing the camalexin standard and John Browse and Jin-Ma Zhou for providing gly1 and gli1 (nho1) seeds, respectively. We thank David Smith for critical comments on this manuscript. Received April 18, 2008; accepted June 10, 2008; published June 20, 2008.
1 This work was supported by the National Science Foundation (grant nos. MCB 0421914 and IOS 0749731), the U.S. Department of Agriculture National Research Initiative (2004–03287), and the Kentucky Science and Engineering Foundation (820–RDE–005). This study is publication 08–12–082 of the Kentucky Agricultural Experiment Station. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Pradeep Kachroo (pk62{at}uky.edu).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.108.121335 * Corresponding author; e-mail pk62{at}uky.edu.
AbuQamar S, Chen X, Dhawan R, Bluhm B, Salmeron J, Lam S, Dietrich RA, Mengiste T (2006) Expression profiling and mutant analysis reveals complex regulatory networks involved in Arabidopsis response to Botrytis infection. Plant J 48: 28–44[CrossRef][Web of Science][Medline] Ahn IP, Kim S, Lee YH (2005) Vitamin B1 functions as an activator of plant disease resistance. Plant Physiol 138: 1505–1515 Asahi T, Kojima M, Kosuge T (1979) The energetics of parasitism, pathogenism, and resistance in plant disease. In JG Horsfall, EB Cowling, eds, Plant Disease: An Advanced Treatise, Vol 4. Academic Press, New York, pp 47–74 Aubert S, Gout E, Bligny R, Douce R (1994) Multiple effects of glycerol on plant cell metabolism. J Biol Chem 269: 21420–21427 Berger S, Sinha AK, Roitsch T (2007) Plant physiology meets phytopathology: plant primary metabolism and plant-pathogen interactions. J Exp Bot 58: 4019–4026 Bessire M, Chassot C, Jacquat AC, Humphry M, Borel S, Petétot JM, Métraux JP, Nawrath C (2007) A permeable cuticle in Arabidopsis leads to a strong resistance to Botrytis cinerea. EMBO J 26: 2158–2168[CrossRef][Medline] Brisson D, Vohl M-C, St-Pierre J, Hudson T, Gaudet D (2001) Glycerol: a neglected variable in metabolic processes? Bioessays 23: 534–542[CrossRef][Web of Science][Medline] Chandra-Shekara AC, Gupte M, Navarre DA, Raina S, Raina R, Klessig D, Kachroo P (2006) Light-dependent hypersensitive response and resistance signaling to turnip crinkle virus in Arabidopsis. Plant J 45: 320–335[CrossRef][Web of Science][Medline] Chandra-Shekara AC, Navarre D, Kachroo A, Kang H-G, Klessig DF, Kachroo P (2004) Signaling requirements and role of salicylic acid in HRT- and rrt-mediated resistance to turnip crinkle virus in Arabidopsis. Plant J 40: 647–659[CrossRef][Web of Science][Medline] Chandra-Shekara AC, Venugopal SC, Barman SR, Kachroo A, Kachroo P (2007) Plastidial fatty acid levels regulate resistance gene-dependent defense signaling in Arabidopsis. Proc Natl Acad Sci USA 104: 7277–7282 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline] Dong X (2004) NPR1, all things considered. Curr Opin Plant Biol 7: 547–552[CrossRef][Web of Science][Medline] Downie B (1994) Sugar content and endo-beta-mannanase activity in white spruce (Picea glauca [Moench.] Voss.) seeds during germination. PhD thesis. University of Guelph, Guelph, Ontario, Canada Durrant WE, Dong X (2004) Systemic acquired resistance. Annu Rev Phytopathol 42: 185–209[CrossRef][Web of Science][Medline] Eastmond PJ (2004) Glycerol-insensitive Arabidopsis mutants: gli1 seedlings lack glycerol kinase, accumulate glycerol and are more resistant to abiotic stress. Plant J 37: 617–625[CrossRef][Web of Science][Medline] Ehness R, Ecker M, Godt DE, Roitsch T (1997) Glucose and stress independently regulate source and sink metabolism and defense mechanisms via signal transduction pathways involving protein phosphorylation. Plant Cell 9: 1825–1841[Abstract] Feys BJ, Parker JE (2000) Interplay of signaling pathways in plant disease resistance. Trends Genet 16: 449–455[CrossRef][Web of Science][Medline] Flor H (1971) Current status of gene-for-gene concept. Annu Rev Phytopathol 9: 275–296[CrossRef][Web of Science] Glazebrook J (2001) Genes controlling expression of defense responses in Arabidopsis—2001 status. Curr Opin Plant Biol 4: 301–308[CrossRef][Web of Science][Medline] Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 43: 205–227[CrossRef][Web of Science][Medline] Gomez-Ariza J, Campo S, Rufat M, Estopa M, Messequer J, San Sequndo B, Coca M (2007) Sucrose-mediated priming of plant defense responses and broad-spectrum disease resistance by overexpression of the maize pathogenesis-related PRms proteins in rice plant. Mol Plant Microbe Interact 20: 832–842[CrossRef][Web of Science][Medline] Gorvin EM, Levine A (2000) The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Curr Biol 10: 751–757[CrossRef][Web of Science][Medline] Hancock JG, Huisman OC (1981) Nutrient movement in host-pathogen systems. Annu Rev Phytopathol 19: 309–331[CrossRef][Web of Science] Huckelhoven R (2007) Cell wall-associated mechanisms of disease resistance and susceptibility. Annu Rev Phytopathol 45: 2.1–2.27 Kachroo A, Daqi F, Havens W, Navarre D, Kachroo P, Ghabrial S (2008) An oleic acid–mediated pathway induces constitutive defense signaling and enhanced resistance to multiple pathogens in soybean. Mol Plant Microbe Interact 21: 564–575[CrossRef][Web of Science][Medline] Kachroo A, Kachroo P (2007) Salicylic acid-, jasmonic acid- and ethylene-mediated regulation of plant defense signaling. In J Setlow, ed, Genetic Regulation of Plant Defense Mechanisms. Springer, New York, pp 55–83 Kachroo A, Lapchyk L, Fukushigae H, Hildebrand D, Klessig D, Kachroo P (2003) Plastidial fatty acid signaling modulates salicylic acid- and jasmonic acid-mediated defense pathways in the Arabidopsis ssi2 mutant. Plant Cell 15: 2952–2965 Kachroo A, Venugopal SC, Lapchyk L, Falcone D, Hildebrand D, Kachroo P (2004) Oleic acid levels regulated by glycerolipid metabolism modulate defense gene expression in Arabidopsis. Proc Natl Acad Sci USA 101: 5152–5157 Kachroo P, Venugopal SC, Navarre DA, Lapchyk L, Kachroo A (2005) Role of salicylic acid and fatty acid desaturation pathways in ssi2-mediated signaling. Plant Physiol 139: 1717–1735 Kang L, Li J, Zhao T, Xiao F, Tang X, Thilmony R, He SY, Zhou J-M (2003) Interplay of the Arabidopsis nonhost resistance gene NHO1 with bacterial virulence. Proc Natl Acad Sci USA 100: 3915–3924 Kotchoni SO, Gachomo EW (2006) The reactive oxygen species network pathways: an essential prerequisite for perception of pathogen attack and the acquired disease resistance in plants. J Biosci 31: 389–404[CrossRef][Web of Science][Medline] Kunst L, Browse J, Somerville C (1988) Altered regulation of lipid biosynthesis in a mutant of Arabidopsis deficient in chloroplast glycerol-3-phosphate acyltransferase activity. Proc Natl Acad Sci USA 85: 4143–4147 Lipka V, Dittgen J, Bednarek P, Bhat R, Wiermer M, Stein M, Landtag J, Brandt W, Rosahl S, Scheel D, et al (2005) Pre- and postinvasion defenses both contribute to nonhost resistance in Arabidopsis. Science 310: 1180–1183 Liu G, Kennedy R, Greenshields DL, Peng G, Forseille L, Selvaraj G, Wei Y (2007) Detached and attached Arabidopsis leaf assays reveal distinctive defense responses against hemibiotrophic Colletotrichum spp. Mol Plant Microbe Interact 20: 1308–1319[CrossRef][Web of Science][Medline] Mengiste T, Chen X, Salmeron J, Dietrich R (2003) The BOS1 gene encodes an R2R3MYB transcription factor protein that is required for biotic and abiotic stress responses in Arabidopsis. Plant Cell 15: 2551–2565 Miquel M, Cassagne C, Browse J (1998) A new class of Arabidopsis mutants with reduced hexadecatrienoic acid fatty acid levels. Plant Physiol 117: 923–930 Nandi A, Welti R, Shah J (2004) The Arabidopsis thaliana dihydroxyacetone phosphate reductase gene SUPPRESSOR OF FATTY ACID DESATURASE DEFICIENCY1 is required for glycerolipid metabolism and for the activation of systemic acquired resistance. Plant Cell 16: 465–477 Narusaka Y, Narusaka M, Park P, Kubo Y, Hirayama T, Seki M, Shiraishi T, Ishida J, Nakashima M, Enju A, et al (2004) RCH1, a locus in Arabidopsis that confers resistance to the hemibiotrophic fungal pathogen Colletotrichum higginsianum. Mol Plant Microbe Interact 17: 749–762[CrossRef][Web of Science][Medline] O'Connell R, Herbert C, Sreenivasaprasad S, Khatib M, Esquerre-Tugaye M-T, Dumas B (2004) A novel Arabidopsis-Colletotrichum pathosystem for the molecular dissection of plant-fungal interactions. Mol Plant Microbe Interact 17: 272–282[Web of Science][Medline] Oliver RP, Ipcho SVS (2004) Arabidopsis pathology breathes new life into the necrotrophs-vs.-biotrophs classification of fungal pathogens. Mol Plant Pathol 5: 347–352[CrossRef] Penninckx IA, Thomma BP, Buchala A, Metraux JP, Broekaert WF (1998) Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103–2113 Pennypacker BW (2000) Differential impact of carbon assimilation on the expression of quantitative and qualitative resistance in alfalfa (Medicago sativa). Physiol Mol Plant Pathol 57: 87–93[CrossRef] Perfect SE, Hughes HB, O'Connell RJ, Green JR (1999) Collectrichum: a model genus for studies on pathology, fungal-plant interactions. Fungal Genet Biol 27: 186–198[CrossRef][Web of Science][Medline] Price J, Li TC, Kang SG, Na JK, Jang JC (2003) Mechanisms of glucose signaling during germination of Arabidopsis. Plant Physiol 132: 1424–1438 Rolland F, Moore B, Sheen J (2002) Sugar sensing and signaling in plants. Plant Cell (Suppl) 14: S185–S205 Schaaf J, Walter MH, Hess D (1995) Primary metabolism in plant defense. Plant Physiol 108: 949–960[Abstract] Schaarschmidt S, Kopka J, Ludwig-Muller J, Hause B (2007) Regulation of arbuscular mycorrhization by apoplastic invertases: enhanced invertase activity in the leaf apoplast affects the symbiotic interaction. Plant J 51: 390–405[CrossRef][Web of Science][Medline] Scheideler M, Schlaich NL, Fellenberg K, Beissbarth T, Hauser NC, Vingron M, Slusarenko AJ, Hoheisel JD (2002) Monitoring the switch from housekeeping to pathogen defense metabolisms in Arabidopsis thaliana using cDNA arrays. J Biol Chem 277: 10555–10561 Schulze-Lefert P, Panstruga R (2003) Establishment of biotrophy by parasitic fungi and reprogramming of host cells for disease resistance. Annu Rev Phytopathol 41: 641–667[CrossRef][Web of Science][Medline] Shen W, Wei Y, Dauk M, Zheng Z, Zou J (2003) Identification of a mitochondrial glycerol-3-phosphate dehydrogenase from Arabidopsis thaliana: evidence for a mitochondrial glycerol-3-phosphate shuttle in plants. FEBS Lett 536: 92–96[CrossRef][Web of Science][Medline] Shen W, Wei Y, Dauk M, Zheng Z, Zou J (2006) Involvement of a glycerol-3-phosphate dehydrogenase in modulating the NADH/NAD ratio provides evidence of a mitochondrial glycerol-3-phosphate shuttle in Arabidopsis. Plant Cell 18: 422–441 Solomon PS, Tan KC, Oliver RP (2003) The nutrient supply of pathogenic fungi; a fertile field for study. Mol Plant Pathol 4: 203–210[CrossRef] Taiz L, Zeiger E (2006) Respiration and lipid metabolism. In L Taiz, E Zeiger, eds, Plant Physiology. Sinauer Associates, Sunderland, MA, pp 253–288 Tang D, Simonich MT, Innes RW (2007) Mutations in LACS2, a long-chain acyl-coenzyme A synthetase, enhance susceptibility to avirulent Pseudomonas syringae but confer resistance to Botrytis cinerea in Arabidopsis. Plant Physiol 144: 1093–1103 Thomma BP, Penninckx IA, Broekaert WF, Cammue BP (2001) The complexity of disease signaling in Arabidopsis. Curr Opin Immunol 13: 63–68[CrossRef][Web of Science][Medline] Wei Y, Periappuram C, Datla R, Selvaraj G, Zou J (2001) Molecular and biochemical characterization of a plastidic glycerol-3-phosphate dehydrogenase from Arabidopsis. Plant Physiol Biochem 39: 841–848[CrossRef][Web of Science] Wei Y, Shen W, Dauk M, Wang F, Selvaraj G, Zou J (2004) Targeted gene disruption of glycerol-3-phosphate dehydrogenase in Colletotrichum gloeosporioides reveals evidence that glycerol is a significant transferred nutrient from host plant to fungal pathogen. J Biol Chem 279: 429–435 Williams PH (1979) How fungi induce disease. In JG Horsfall, EB Cowling, eds, Plant Disease: An Advanced Treatise, Vol 4. Academic Press, New York, pp 163–179 Yoder OC, Turgeon BG (2001) Fungal genomics and pathogenicity. Curr Opin Plant Biol 4: 315–321[CrossRef][Web of Science][Medline] Zhou N, Tootle TL, Tsui F, Klessig DF, Glazebrook J (1998) PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell 10: 1021–1030
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|