| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
|
First published online July 3, 2008; 10.1104/pp.108.119404 Plant Physiology 148:259-268 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
AGL61 Interacts with AGL80 and Is Required for Central Cell Development in Arabidopsis1,[W],[OA]Department of Biology, University of Utah, Salt Lake City, Utah 84112–0840
The central cell of the female gametophyte plays a role in pollen tube guidance and in regulating the initiation of endosperm development. Following fertilization, the central cell gives rise to the seed's endosperm, which nourishes the developing embryo within the seed. The molecular mechanisms controlling specification and differentiation of the central cell are poorly understood. We identified AGL61 in a screen for transcription factor genes expressed in the female gametophyte. AGL61 encodes a Type I MADS domain protein, which likely functions as a transcription factor. Consistent with this, an AGL61-green fluorescent protein fusion protein is localized to the nucleus. In the context of the ovule and seed, AGL61 is expressed exclusively in the central cell and early endosperm. agl61 female gametophytes are affected in the central cell specifically. The morphological defects include an overall reduction in size of the central cell and a reduced or absent central cell vacuole. When fertilized with wild-type pollen, agl61 central cells fail to give rise to endosperm. In addition, synergid- and antipodal-expressed genes are ectopically expressed in agl61 central cells. The expression pattern and mutant phenotype of AGL61 are similar to those of AGL80, suggesting that AGL61 may function as a heterodimer with AGL80 within the central cell; consistent with this, AGL61 and AGL80 interact in yeast two-hybrid assays. Together, these data suggest that AGL61 functions as a transcription factor and controls the expression of downstream genes during central cell development.
The central cell of the female gametophyte is critical for several steps of the angiosperm fertilization process. During the late stages of pollen tube growth, a pollen tube grows along the carpel's placental surface, onto the ovule's funiculus, and finally into the ovule's micropyle to reach the female gametophyte. Soon after entering the female gametophyte, the pollen tube releases its two sperm cells to effect double fertilization of the egg cell and central cell, which give rise to the seed's embryo and endosperm, respectively. Endosperm is an important component of the seed because it provides nutrients and other factors to the embryo during seed development and/or to the developing seedling following germination (for review, see Drews and Yadegari, 2002  ; Yadegari and Drews, 2004).
The central cell is required for pollen tube guidance. Mutations in the Arabidopsis (Arabidopsis thaliana) CENTRAL CELL GUIDANCE (CCG) gene affect the female gametophyte. ccg mutants undergo normal female gametophyte development but are defective in pollen tube guidance. CCG is expressed specifically in the central cell and encodes a protein with similarity to TFIIB. Although the role of CCG in pollen tube guidance is unclear, its expression pattern and mutant phenotype suggest that the central cell plays a critical role in pollen tube guidance (Chen et al., 2007
The central cell also plays a role in controlling the initiation of endosperm development. The central cell expresses a set of genes that represses endosperm development in the absence of fertilization. These genes are collectively referred to as the FERTILIZATION INDEPENDENT SEED (FIS)-class genes and include FERTILIZATION-INDEPENDENT ENDOSPERM (FIE; Ohad et al., 1999
The central cell forms during megagametogenesis. Most species including Arabidopsis and cereals undergo the Polygonum pattern of megagametogenesis. During Polygonum-type megagametogenesis, a one-nucleate megaspore undergoes two rounds of mitosis, producing a four-nucleate cell. During a third round of mitosis, phragmoplasts and cell plates form between nuclei, initiating the cellularization process. Ultimately, the nuclei become completely surrounded by cell walls, resulting in formation of a seven-celled female gametophyte consisting of one central cell, one egg cell, two synergid cells, and three antipodal cells. The central cell inherits two nuclei, the polar nuclei. In Arabidopsis and many other species, the polar nuclei fuse to form the diploid central cell nucleus (secondary nucleus; for review, see Willemse and van Went, 1984
Little is known about the regulatory processes controlling central cell development and few transcriptional regulators functioning in this cell have been identified. Those identified include the FIS genes discussed above, as well as AGL80 (Portereiko et al., 2006 To identify additional transcriptional regulators functioning in the central cell and female gametophyte, we performed a sensitive differential expression screen to identify such genes. Here, we report the identification of AGL61, which encodes a Type I MADS domain protein. We show that (1) AGL61 is expressed exclusively in the central cell and endosperm during ovule and seed development, (2) agl61 mutants have central cell defects similar to those of agl80, and (3) AGL61 interacts with AGL80 in yeast (Saccharomyces cerevisiae). Together, these results suggest that an AGL61-AGL80 heterodimer functions in the central cell to control the expression of downstream genes that are critical for central cell and endosperm development.
AGL61 Is Expressed in the Central Cell
We performed a screen to identify MADS box genes expressed in the female gametophyte. We harvested ovaries from male sterility1 (ms1; Thorlby et al., 1997 These assays identified a gene, AGL61, exhibiting reduced expression in dif1 ovaries relative to wild-type ovaries. The structure of AGL61 is summarized in Figure 1 and the real-time RT-PCR data are provided in Figure 2A .
To determine which cells within the female gametophyte express AGL61, we generated and analyzed transgenic Arabidopsis plants containing a protein-fusion construct, AGL61-GFP, comprising the AGL61 promoter and the entire AGL61 coding region fused with a GFP coding sequence. Figure 3, A to C , show AGL61-GFP expression during female gametophyte development (female gametophyte stages are described in Christensen et al. [1997] ). AGL61-GFP expression was first detected in the two polar nuclei just before fusion (late stage FG5; Fig. 3A). AGL61-GFP expression was not detected at earlier developmental stages. Expression in the central cell continued through stage FG6 (Fig. 3B) and into the mature stage (stage FG7; Fig. 3C). During all of these stages, the AGL61-GFP fusion protein was localized to the nucleus, consistent with a predicted function in transcriptional regulation.
To determine whether AGL61 is also expressed in developing seeds, we analyzed AGL61-GFP expression at 12 to 48 h after pollination. During this period, AGL61-GFP expression was detected exclusively in the endosperm (Fig. 3D). During endosperm development, AGL61-GFP expression was strongest immediately after fertilization, diminished gradually at progressively older stages, and was not detected after the eight-nucleate stage (stage IV) of endosperm development (endosperm stages are described in Boisnard-Lorig et al. [2001] ). In reciprocal crosses with plants homozygous for the AGL61-GFP construct and wild type, expression was detected only when the reporter construct was present in the female parent. We also analyzed expression of an AGL61 promoter-fusion construct, ProAGL61:GFP. As with AGL61-GFP, ProAGL61:GFP was expressed exclusively in the central cell (Fig. 3E) and endosperm (Fig. 3F) during female gametophyte and seed development. In contrast to AGL61-GFP, ProAGL61:GFP expression persisted until the 16-nucleate stage (stage V) of endosperm development. To determine whether AGL61 is expressed elsewhere in the plant, we performed real-time RT-PCR with RNA from various organs. The results from these assays are shown in Figure 2B. Consistent with expression of AGL61-GFP and ProAGL61:GFP in the female gametophyte, strong AGL61 expression was detected in ovaries. In addition, weak expression was detected in siliques, which correlates with limited AGL61-GFP and ProAGL61:GFP expression during seed development, and in stems and anthers. Expression was not detected by real-time RT-PCR in roots, leaves, and young flowers (Fig. 2B). In summary, during ovule and seed development, AGL61 is expressed exclusively in the central cell and endosperm, from late stage FG5 (just after central cell cellularization and before the polar nuclei fuse) of female gametophyte development to stage IV (eight-nucleate stage) or V (16-nucleate stage) of endosperm development. Elsewhere in the plant, AGL61 expression is extremely low or is not detected.
To determine whether mutations in AGL61 affect the female gametophyte, we analyzed lines containing T-DNA insertions in this gene. We analyzed two T-DNA alleles, agl61-1 (SALK_009008) and agl61-2 (GABI-Kat 642H10), which were obtained from the Arabidopsis SIGnAL (Alonso et al., 2003 To determine whether the agl61 mutations affect the female gametophyte, we crossed heterozygous mutant plants as females with wild-type males and scored the number of AGL61/AGL61 and agl61/AGL61 progeny. Table I shows that both mutations exhibited reduced transmission through the female gametophyte, indicating that they affect the female gametophyte (Supplemental Fig. S1).
To determine whether the agl61 mutations also affect the male gametophyte, we crossed heterozygous mutant plants as male parents with wild-type females and scored the number of AGL61/AGL61 and agl61/AGL61 progeny. With both alleles, homozygous wild-type and heterozygous progeny were present in approximately equal proportions (Table I), indicating that these mutations do not affect the male gametophyte (Supplemental Fig. S1). Table I shows that the agl61 mutations transmit through the female gametophyte at low frequency. Based on the observed gametophytic transmission frequencies (Table I), homozygous mutants should be present at a frequency of 1.1% to 2.5%. However, homozygous mutants were not identified in >800 plants screened for each allele. These results along with the AGL61 expression pattern suggest that the agl61 mutations affect seed development.
To confirm that the female gametophyte defect is due to disruption of AGL61, we introduced a wild-type copy of this gene into the agl61-1 mutant. We identified plants heterozygous for the agl61-1 allele and hemizygous for the rescue construct; these plants contained 25% aborted seeds, as compared to 50% aborted seeds for agl61-1 plants lacking the rescue construct. In the subsequent generation, we identified plants heterozygous for the agl61-1 allele and homozygous for the rescue construct; these plants had full seed set. Together, these data indicate that disruption of the AGL61 gene is responsible for the female gametophyte defect in agl61-1 mutants.
To determine whether the agl61 mutations affect megagametogenesis, we analyzed agl61-1 and agl61-2 female gametophytes using confocal laser scanning microscopy (CLSM; Christensen et al., 1997
We first analyzed female gametophytes at the terminal developmental stage (stage FG7). We emasculated agl61-1/AGL61 flowers at stage 12c (Christensen et al., 1997
To determine whether agl61-1 female gametophytes are affected at earlier developmental stages, we analyzed female gametophytes (n = 59) within stage 12c flowers, which contain embryo sacs at stages FG4 to FG6 (Christensen et al., 1997 ). In flowers at this stage, abnormal female gametophytes were not observed, suggesting that agl61-1 female gametophytes do not exhibit defects at these earlier stages. To characterize endosperm derived from fertilization of agl61 central cells, we pollinated agl61-1/AGL61 flowers with wild-type pollen, waited 24 h, and fixed seed tissue for confocal analysis. In the siliques resulting from this cross, approximately 50% (51/95) of the seeds were normal and approximately 50% (44/95) were abnormal, suggesting that that the abnormal seeds resulted from fertilization of agl61-1 embryo sacs. In wild-type seeds at 24 h after pollination, one of the synergid cells is degenerated, the embryo is a single-celled zygote, and the endosperm typically consists of four to eight nuclei (Fig. 4D). In most (84%, 37/44) of the abnormal seeds, the embryo sac chamber was filled with highly autofluorescent material (Fig. 4E). A minority (16%, 7/44) of abnormal seeds had a few endosperm nuclei at abnormal positions (Fig. 4F) and a zygote-like structure (Fig. 4G). To further characterize the defects in agl61-1, we used fluorescence microscopy to analyze development of GFP-marked central cells and endosperm. We analyzed plants heterozygous for the agl61-1 mutation and hemizygous for ProAGL61:GFP, which is expressed in agl61-1 central cells and endosperm (discussed below). In mature female gametophytes (stage FG7), defective central cells were readily apparent. Of the female gametophytes expressing GFP, approximately 50% (31/63) contained abnormal central cells that resembled those described above: the central cell vacuole was reduced in size or absent and the overall size of the central cell was dramatically reduced (Fig. 3G). At 24 h after pollination with wild-type pollen, approximately 50% (51/108) of the seeds were defective and most of these had no endosperm (Fig. 3H). In summary, agl61 female gametophytes are defective in central cell development. agl61 central cells are reduced in size and have collapsed vacuoles, but appear to be viable, based on expression of a central cell marker. Fertilization of agl61 female gametophytes with wild-type sperm leads to aberrant endosperm development and eventually seed abortion.
The CLSM analysis discussed above suggests that the egg cell, synergid cells, and antipodal cells are not affected in agl61 female gametophytes. To investigate this issue further, we analyzed expression of markers for these cell types in agl61 embryo sacs. We analyzed expression of ProDD1:GFP, which is expressed exclusively in the antipodal cells (Fig. 3I), and ProDD3:GFP, which is expressed strongly in the synergid cells and weakly in the egg cell and central cell (Fig. 3K; Steffen et al., 2007 In agl61-1 female gametophytes, ProDD1:GFP was expressed in the antipodal cells (Fig. 3J) and ProDD3:GFP was expressed strongly in the synergid cells and weakly in the egg cell (Fig. 3L). These results suggest that the antipodal, synergid, and egg cells are normal in agl61-1 embryo sacs. However, in contrast to the wild type, ProDD1:GFP was also expressed in the central cell of agl61-1 embryo sacs (Fig. 3J). Similarly, ProDD3:GFP, which was expressed weakly in wild-type central cells (Fig. 3K), was expressed strongly in agl61-1 central cells (Fig. 3L). These data indicate that AGL61 is required for suppression of DD1 and DD3 expression in the central cell and that an additional aspect of the agl61 phenotype is misexpression of antipodal- and synergid-expressed genes.
Analysis of the ccg mutant suggests that the central cell is required for pollen tube guidance by the female gametophyte (Chen et al., 2007 We pollinated wild-type and agl61-1/AGL61 pistils with ProLAT52:GFP pollen and analyzed the resulting seeds at 24 h after pollination. In the wild-type pollinations, approximately 98% (112/114) of the seeds contained a pollen tube in the micropyle and a GFP bolus in the embryo sac. Similarly, in the agl61-1/AGL61 pollinations, approximately 97% (115/119) of the seeds contained a pollen tube in the micropyle and a GFP bolus in the embryo sac, indicating that agl61-1 female gametophytes can attract pollen tubes. To verify these observations, we performed a similar analysis with central cells expressing ProAGL61:GFP, which allowed us to directly observe mutant embryo sacs (discussed above). At 24 h after pollination with ProLAT52:GFP pollen, 100% (35/35) of agl61-1 female gametophytes had a pollen tube in its micropyle and a GFP bolus in the embryo sac (Fig. 3N). Together, these data indicate that agl61 female gametophytes are not defective in pollen tube guidance.
Autoregulation is a common feature of MADS box genes (de Folter and Angenent, 2006
The phenotype of agl61 female gametophytes resembles that of agl80 female gametophytes and the two genes are expressed in a similar pattern (Portereiko et al., 2006
AGL61 Encodes a Type I MADS Domain Protein
ALG61 is a Type I MADS domain protein (Parenicova et al., 2003
During ovule development, AGL61 is expressed exclusively in the central cell (Fig. 3, A to C). This expression pattern is consistent with the phenotype of agl61 mutants. Based on both CLSM analysis of agl61 female gametophytes (Fig. 4, A to C) and on analysis of antipodal-, egg-, and synergid-expressed genes in agl61 embryo sacs (Fig. 3, I to L), agl61 affects the central cell but not the other cells of the embryo sac. Thus, the expression and phenotypic data suggest very strongly that agl61 female gametophytes are affected in the central cell specifically.
The central cell defects include an overall reduction in size and a reduced or absent vacuole (Figs. 3G and 4, B and C). The vacuole in plant cells is known to generate turgor (Marty, 1999 An additional aspect of the agl61 central cell phenotype is ectopic expression of synergid- and antipodal-expressed genes (Fig. 3, J and L). These observations indicate that AGL61 is required to suppress the expression of genes in the central cell. Of two genes tested, both are misexpressed, suggesting that additional genes are misexpressed in agl61 central cells. The expression of AGL61-GFP (Fig. 3D) and ProAGL61:GFP (Fig. 3F) in the endosperm suggests that AGL61 plays a role during endosperm development. Consistent with this, an agl61 homozygote was not identified despite a small percentage of transmission through the female gametophyte (Table I). Furthermore, seeds resulting from fertilization of agl61 female gametophytes with wild-type pollen undergo abnormal endosperm development (Fig. 4, E to G). However, the failure of endosperm development in this cross may be attributable to defects earlier during central cell development.
Despite the strong morphological defects in the central cell, agl61 female gametophytes are able to attract pollen tubes (Fig. 3N). This is also true of agl80 female gametophytes (Portereiko et al., 2006
MADS-domain proteins generally function as homodimers and/or as heterodimers with other MADS-domain proteins (de Folter and Angenent, 2006
Our results suggest that an AGL61-AGL80 heterodimer functions in the central cell. Consistent with this, AGL61 and AGL80 (Portereiko et al., 2006
Plant Material and Plasmids
agl61-1 (SALK_009008) was obtained from the Salk Institute Genomic Analysis Laboratory collection (Alonso et al., 2003
Seeds were sterilized in chlorine gas and germinated on plates containing 0.5x Murashige and Skoog salts (M-9274; Sigma), 0.05% 2-(N-morpholino)-ethane-sulfonic acid, 0.5% Suc, and 0.8% Phytagar (Life Technologies). Ten-day-old seedlings were transferred to Sunshine Mix Number 2 and grown under 24-h illumination.
T-DNA constructs were introduced into Agrobacterium strain LBA4404 by electroporation. Arabidopsis (Arabidopsis thaliana) plants (ecotype Columbia) were transformed using a modified floral dip procedure (Clough and Bent, 1998
For plant-wide real-time RT-PCR, we carried out the experiments and analysis as described in Steffen et al. (2007)
We identified the 5' and 3' untranslated sequences with RACE using the First Choice RLM-RACE kit (Ambion). For 5' RACE, the gene-specific outer primer was AGL61raceR9 (5'-ATCTCTTCCATCGCTTGACCCT-3') and the gene-specific inner primer was AGL61raceR8 (5'-TCAACACTTGGATGTCCGAATGA-3'). For 3' RACE, the gene-specific outer primer was 61-3RACEGSO1 (5'-TCAAGCGATGGAAGAGATGAGA-3') and the gene-specific inner primer was 61-3RACEGSI1 (5'-AGCCAGTAGAGGAGATGAATATGG-3'). This analysis showed that AGL61 contains 5' and 3' untranslated regions of 49 bp and 139 bp, respectively. To amplify a cDNA encompassing the entire open reading frame of AGL61, we used the RLM-RACE kit outer primer and AGL61 cDNA R (5'-AATCAGAAACAACCATTTCCA-3'). The cDNA was cloned into the pCRII-TOPO vector using the TOPO TA cloning kit (Invitrogen) resulting in plasmid pCRII-cAGL61.
We used PROSITE (http://ca.expasy.org/prosite) to identify predicted functional domains of AGL61 protein. This prediction tool identified the MADS domain but no other domains. We used PSORT (http://psort.nibb.ac.jp/form.html), WoLF PSORT (http://wolfpsort.org/), and PredictNLS (http://cubic.bioc.columbia.edu/predictNLS) to identify a nuclear localization signal (NLS) in AGL61 protein; no putative NLS was predicted.
The AGL61-GFP construct includes a 2,662-bp fragment containing 2,032 bp of sequence upstream of the predicted translational start codon and 630 bp of AGL61 genomic coding sequence, excluding the stop codon. This genomic region was obtained by PCR amplification from genomic DNA using the primers 61ProtF (5'-TGATTACGCCGTCGACACTTCTTGGGTTCCGGGCCGA-3') and 61ProtR (5'-TGCTCACCATGGATCCGAAACAACCATTTCCATTGGCAAAA-3'). These primers introduced SalI and BamHI sites at the 5' and 3' ends, respectively. The resulting PCR product was cloned into pBI-GFP(S65T) (Yadegari et al., 2000
The ProAGL61:GFP construct includes 1,935 bp upstream of the predicted translational start codon. This genomic region was obtained by PCR amplification from genomic DNA using the primers AGL61Prom-F (5'-TGATTACGCCCTGCAGATGATTTTAGAGTCTCCCGC-3') and AGL61Prom-R (5'-TGCTCACCATGGATCCTGTAACATACATTTGTAATTACTCG-3'). These primers introduced PstI and BamHI sites at the 5' and 3' ends, respectively. The resulting PCR product was cloned into pBI-GFP(S65T) (Yadegari et al., 2000 These constructs were introduced into Arabidopsis plants as described above and transformed plants were selected by germinating T1 seeds on growth medium containing 30 µg/mL kanamycin. The expression patterns reported in "Results" are derived from the analysis of at least 10 transgenic lines.
For analysis of mature female gametophytes, we emasculated flowers at stage 12c (Christensen et al., 1997
For both alleles, the left-border and right-border T-DNA junctions were determined by PCR using T-DNA-specific and genomic-specific primers. For agl61-1, the left-border junction was determined using the T-DNA primer pBinProK2-RB1 (5'-TCAGTTCCAAACGTAAAACGGC-3') combined with the genomic primer AGL61-1LP (5'-GCCTAGGCTTGTAAGGTCCAG-3') and the right-border junction was determined using T-DNA primer LBa1 (5'-TGGTTCACGTAGTGGGCCATCG-3') and genomic primer AGL61-1RP (5'-CGTCCGATGCTTTCTTTCTTC-3'). For agl61-2, the left-border junction was determined using the T-DNA primer TDNA1 (5'-CCCATTTGGACGTGAATGTAGACAC-3') combined with the genomic primer AGL61-2LP (5'-GCCTCACACTCTCTTTTCTCATCT-3') and the right-border junction was determined using the T-DNA primer TDNA3 (5'-CGCCAGGGTTTTCCCAGTCACGACG-3') combined with the genomic primer AGL61-2RP CCTAGGCTTGTAAGGTCCAGTTT (5'-CCTAGGCTTGTAAGGTCCAGTTT-3'). The T-DNA in agl61-1 is inserted 81 nucleotides upstream of the transcriptional start site, which is 130 nucleotides upstream of the predicted start codon, and is associated with a 17-nucleotide deletion (nucleotides –71 to –65 relative to the transcriptional start site deleted). The T-DNA in agl61-2 is inserted 48 nucleotides downstream of the transcriptional start site, which is immediately upstream of the predicted start codon, and is associated with a 235-nucleotide insertion of unknown origin.
For self-cross analysis, heterozygous plants were allowed to self-pollinate and progeny seed was collected. For reciprocal cross analysis, heterozygous plants were crossed with wild-type plants as outlined in Table I. In both cases, the progeny F1 seed was germinated on growth medium containing no antibiotics and progeny seedlings were genotyped and scored using PCR. Plants segregating the agl61-1 allele were genotyped using primers LBa1, AGL61-1LP, and AGL61-1RP (see above). Plants segregating the agl61-2 allele were genotyped using primers TDNA1, AGL61-1LP, and AGL61-2RP (see above). Heterozygous plants, identified by PCR were used in the segregation analysis described below. Table I shows that the agl61 mutations transmit through the female gametophyte at low frequency. Based on the observed transmission frequencies, homozygotes should be present at a frequency of 1.1% to 2.5%. To identify homozygotes, for both mutants, we screened the siliques of >800 progeny from self-pollinated heterozygous plants. In addition, for both mutants, we genotyped >200 of these plants using PCR with primers LBa1, AGL61-1LP, and AGL61-1RP (see above). With both methods, plants homozygous for the agl1-1 and agl61-2 alleles were not identified.
Molecular complementation was performed using a 3,662-bp DNA fragment containing the AGL61 coding sequence (633 bp) along with 2,084 bp of sequence upstream of the predicted translational start codon and 945 bp of sequence downstream of the stop codon. This DNA fragment was amplified by PCR from genomic DNA using the primers AGL61-ResF GATGATTTTAGAGTCTCCCGC (5'-CCATGATTACGAATTCGATGATTTTAGAGTCTCCCGC-3') and AGL61-ResR (5'-ATGCCTGCAGGTCGACAAAATTCCTTCAAGTATTTTC-3'). These primers introduced EcoRI and SalI sites at each end, respectively. The resulting PCR product was cloned into pCAMBIA1300 (CAMBIA, Canberra, Australia) using the EcoRI and SalI sites, producing plasmid pCAMBIA1300:AGL61-Res. pCAMBIA1300 contains a marker gene conferring resistance to hygromycin. pCAMBIA1300:AGL61-Res was introduced into Arabidopsis plants as described above and transformed plants were selected by germinating seeds on growth medium containing 15 µg/mL hygromycin. Hygromycin-resistant plants also containing the agl61-1 allele were identified by PCR by using primers LBa1 and AGL61-1RP (see above). To verify that hygromycin-resistant plants had the rescue construct, we performed PCR using primers pCAMLacZR (5'-CCAGCTGGCGAAAGGGGGAT-3') and AGL61ATG800R (5'-CCGCATCGTTTATAACAAAGTGTTAACAGTG-3'). These plants had 25% aborted seeds. Four T1 plants identified above were allowed to self-pollinate. In the T2 generation, plants containing the agl61-1 allele (either heterozygous or homozygous) and the rescue construct (either hemizygous or homozygous) were identified by PCR using primers LBa1, AGL61-1RP, pCAMLacZR, and AGL61ATG800R (see above). These plants were screened for siliques containing full seed set. Plants with full seed set putatively were homozygous for the rescue construct; to verify this, we collected seed from these plants and scored progeny seedlings for the presence of the rescue construct by PCR using primers pCAMLacZR, and AGL61ATG800R (see above).
We used the CLONTECH Matchmaker GAL4 Two-Hybrid System 3 for the yeast (Saccharomyces cerevisiae) two-hybrid analysis. The AGL80 and AGL61 open reading frames (without introns) were fused to the GAL4 activation domain and GAL4 DNA-binding domain in pGAD-T7 and pGBK-T7. Yeast strain AH109 was cotransformed with combinations of pGAD-T7 and pGBK-T7 constructs (AGL80 plus AGL61 or controls containing one or both empty vectors) and selected on synthetic dropout (SD) medium lacking Leu and Trp (SD-LW). Cotransformants were then assayed for interaction and activation of the His and adenine reporter genes on SD medium lacking Leu, Trp, His, and adenine (SD-LWHA). For this, fresh colonies were grown in SD-LW at 30°C overnight to an OD of 1 to 2, the cells were pelleted and resuspended in 0.5 M sorbitol to an OD of 0.5, and 3 µL of each cell suspension was spotted on SD-LWHA plates using a multichannel pipetor and grown at 30°C for 2 to 3 d. In this analysis, the second ATG (at position +49 relative to the transcriptional start site) was used as the start codon.
agl61-1/AGL61 plants were crossed as males with plants homozygous for the promoter:reporter constructs. To identify F1 plants containing the agl61-1 T-DNA allele, PCR was performed with primers LBa1 and AGL61-1RP (see above). F1 seed was plated on growth medium containing 30 µg/mL kanamycin to identify seedlings containing the promoter:reporter constructs. Plants heterozygous for the agl61-1 mutation and hemizygous for the promoter:reporter construct were allowed to self-cross. Progeny from the self-cross were then scored for the agl61-1 T-DNA insertion by PCR, as described above. One-quarter of these plants should also be homozygous for the promoter:reporter construct. To identify these plants, we made use of the fact that all promoter:reporter constructs were inserted into vectors conferring kanamycin resistance. Offspring containing the agl61-1 T-DNA allele were then allowed to self-cross. Seed from this cross was plated on media containing 30 µg/mL kanamycin and the ratio of kanamycin-sensitive to kanamycin-resistant seedlings was scored. Plants that produced 100% kanamycin-resistant progeny were determined to be homozygous for the reporter construct. The GenBank accession number for the AGL61 mRNA sequence is EU836691.
The following materials are available in the online version of this article.
We thank members of the Drews lab for critical review of this manuscript. We thank Ed King and the Department of Biology Microscopy facility for guidance with the microscopic analysis. Received March 21, 2008; accepted June 19, 2008; published July 3, 2008.
1 This work was supported by a National Science Foundation grant (grant no. IOB–0520008) to G.N.D. and a National Institutes of Health Developmental Biology Training Grant appointment (5T32HD007491–12) to J.G.S. 
2 Present address: Department of Plant Sciences, University of Arizona, Tucson, AZ 85721.
3 Present address: Ceres, Inc., 1535 Rancho Conejo Blvd., Thousand Oaks, CA 91320. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Gary N. Drews (drews{at}bioscience.utah.edu).
[W] The online version of this article contains Web-only data.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.108.119404 * Corresponding author; e-mail drews{at}bioscience.utah.edu.
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657 Bai X, Peirson BN, Dong F, Xue C, Makaroff CA (1999) Isolation and characterization of SYN1, a RAD21-like gene essential for meiosis in Arabidopsis. Plant Cell 11: 417–430 Bhatt AM, Lister C, Page T, Fransz P, Findlay K, Jones GH, Dickinson HG, Dean C (1999) The DIF1 gene of Arabidopsis is required for meiotic chromosome segregation and belongs to the REC8/RAD21 cohesin gene family. Plant J 19: 463–472[CrossRef][Web of Science][Medline] Boisnard-Lorig C, Colon-Carmona A, Bauch M, Hodge S, Doerner P, Bancharel E, Dumas C, Haseloff J, Berger F (2001) Dynamic analyses of the expression of the HISTONE:YFP fusion protein in Arabidopsis show that syncytial endosperm is divided in mitotic domains. Plant Cell 13: 495–509 Cai X, Dong F, Edelmann RE, Makaroff CA (2003) The Arabidopsis SYN1 cohesin protein is required for sister chromatid arm cohesion and homologous chromosome pairing. J Cell Sci 116: 2999–3007 Chen YH, Li HJ, Shi DQ, Yuan L, Liu J, Sreenivasan R, Baskar R, Grossniklaus U, Yang WC (2007) The central cell plays a critical role in pollen tube guidance in Arabidopsis. Plant Cell 19: 3563–3577 Choi Y, Gehring M, Johnson L, Hannon M, Harada JJ, Goldberg RB, Jacobsen SE, Fischer RL (2002) DEMETER, a DNA glycosylase domain protein, is required for endosperm gene imprinting and seed viability in Arabidopsis. Cell 110: 33–42[CrossRef][Web of Science][Medline] Christensen CA, King EJ, Jordan JR, Drews GN (1997) Megagametogenesis in Arabidopsis wild type and the Gf mutant. Sex Plant Reprod 10: 49–64[CrossRef] Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline] Colombo M, Masiero S, Vanzulli S, Lardelli P, Kater MM, Colombo L (2008) AGL23, a type I MADS-box gene that controls female gametophyte and embryo development in Arabidopsis. Plant J 54: 1037–1048[CrossRef][Web of Science] Curtis MD, Grossniklaus U (2008) Molecular control of autonomous embryo and endosperm development. Sex Plant Reprod 21: 79–88[CrossRef] de Folter S, Angenent GC (2006) trans meets cis in MADS science. Trends Plant Sci 11: 224–231[CrossRef][Web of Science][Medline] de Folter S, Immink RG, Kieffer M, Parenicova L, Henz SR, Weigel D, Busscher M, Kooiker M, Colombo L, Kater MM, et al (2005) Comprehensive interaction map of the Arabidopsis MADS Box transcription factors. Plant Cell 17: 1424–1433 Drews GN, Yadegari R (2002) Development and function of the angiosperm female gametophyte. Annu Rev Genet 36: 99–124[CrossRef][Web of Science][Medline] Grossniklaus U, Vielle-Calzada JP, Hoeppner MA, Gagliano WB (1998) Maternal control of embryogenesis by MEDEA, a polycomb group gene in Arabidopsis. Science 280: 446–450 Guitton AE, Page DR, Chambrier P, Lionnet C, Faure JE, Grossniklaus U, Berger F (2004) Identification of new members of Fertilisation Independent Seed Polycomb Group pathway involved in the control of seed development in Arabidopsis thaliana. Development 131: 2971–2981 Huang BQ, Russell SD (1992) Female germ unit: organization, isolation, and function. Int Rev Cytol 140: 233–292[CrossRef][Web of Science] Ito T, Shinozaki K (2002) The MALE STERILITY1 gene of Arabidopsis, encoding a nuclear protein with a PHD-finger motif, is expressed in tapetal cells and is required for pollen maturation. Plant Cell Physiol 43: 1285–1292 Jullien PE, Kinoshita T, Ohad N, Berger F (2006) Maintenance of DNA methylation during the Arabidopsis life cycle is essential for parental imprinting. Plant Cell 18: 1360–1372 Kang IH, Steffen JG, Portereiko MF, Lloyd A, Drews GN (2008) The AGL62 MADS domain protein regulates cellularization during endosperm development in Arabidopsis. Plant Cell 20: 635–647 Kiyosue T, Ohad N, Yadegari R, Hannon M, Dinneny J, Wells D, Katz A, Margossian L, Harada JJ, Goldberg RB, et al (1999) Control of fertilization-independent endosperm development by the MEDEA polycomb gene in Arabidopsis. Proc Natl Acad Sci USA 96: 4186–4191 Kohler C, Hennig L, Bouveret R, Gheyselinck J, Grossniklaus U, Gruissem W (2003a) Arabidopsis MSI1 is a component of the MEA/FIE Polycomb group complex and required for seed development. EMBO J 22: 4804–4814[CrossRef][Web of Science][Medline] Kohler C, Hennig L, Spillane C, Pien S, Gruissem W, Grossniklaus U (2003b) The Polycomb-group protein MEDEA regulates seed development by controlling expression of the MADS-box gene PHERES1. Genes Dev 17: 1540–1553 Kozak M (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem 266: 19867–19870 Luo M, Bilodeau P, Koltunow A, Dennis ES, Peacock WJ, Chaudhury AM (1999) Genes controlling fertilization-independent seed development in Arabidopsis thaliana. Proc Natl Acad Sci USA 96: 296–301 Marty F (1999) Plant vacuoles. Plant Cell 11: 587–600 Ohad N, Yadegari R, Margossian L, Hannon M, Michaeli D, Harada JJ, Goldberg RB, Fischer RL (1999) Mutations in FIE, a WD polycomb group gene, allow endosperm development without fertilization. Plant Cell 11: 407–416 Palanivelu R, Preuss D (2006) Distinct short-range ovule signals attract or repel Arabidopsis thaliana pollen tubes in vitro. BMC Plant Biol 6: 7[CrossRef][Medline] Parenicova L, de Folter S, Kieffer M, Horner DS, Favalli C, Busscher J, Cook HE, Ingram RM, Kater MM, Davies B, et al (2003) Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world. Plant Cell 15: 1538–1551 Portereiko MF, Lloyd A, Steffen JG, Punwani JA, Otsuga D, Drews GN (2006) AGL80 is required for central cell and endosperm development in Arabidopsis. Plant Cell 18: 1862–1872 Rosso MG, Li Y, Strizhov N, Reiss B, Dekker K, Weisshaar B (2003) An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53: 247–259[CrossRef][Web of Science][Medline] Sandaklie-Nikolova L, Palanivelu R, King EJ, Copenhaver GP, Drews GN (2007) Synergid cell death in Arabidopsis is triggered following direct interaction with the pollen tube. Plant Physiol 144: 1753–1762 Smyth DR, Bowman JL, Meyerowitz EM (1990) Early flower development in Arabidopsis. Plant Cell 2: 755–767 Steffen JG, Kang I-H, Macfarlane J, Drews GN (2007) Identification of genes expressed in the Arabidopsis female gametophyte. Plant J 51: 281–292[CrossRef][Web of Science][Medline] Thorlby GJ, Shlumukov L, Vizir IY, Yang CY, Mulligan BJ, Wilson ZA (1997) Fine-scale molecular genetic (RFLP) and physical mapping of a 8.9 cM region on the top arm of Arabidopsis chromosome 5 encompassing the male sterility gene, ms1. Plant J 12: 471–479[CrossRef][Web of Science][Medline] Wang D, Tyson MD, Jackson SS, Yadegari R (2006) Partially redundant functions of two SET-domain polycomb-group proteins in controlling initiation of seed development in Arabidopsis. Proc Natl Acad Sci USA 103: 13244–13249 Willemse MTM, van Went JL (1984) The female gametophyte. In BM Johri, ed, Embryology of Angiosperms. Springer-Verlag, Berlin, pp 159–196 Wilson ZA, Morroll SM, Dawson J, Swarup R, Tighe PJ (2001) The Arabidopsis MALE STERILITY1 (MS1) gene is a transcriptional regulator of male gametogenesis, with homology to the PHD-finger family of transcription factors. Plant J 28: 27–39[CrossRef][Web of Science][Medline] Yadegari R, Drews GN (2004) Female gametophyte development. Plant Cell 16(Suppl): S133–S141 Yadegari R, Kinoshita T, Lotan O, Cohen G, Katz A, Choi Y, Nakashima K, Harada JJ, Goldberg RB, Fischer RL, et al (2000) Mutations in the FIE and MEA genes that encode interacting polycomb proteins cause parent-of-origin effects on seed development by distinct mechanisms. Plant Cell 12: 2367–2381 Yoo SK, Lee JS, Ahn JH (2006) Overexpression of AGAMOUS-LIKE 28 (AGL28) promotes flowering by upregulating expression of floral promoters within the autonomous pathway. Biochem Biophys Res Commun 348: 929–936[CrossRef][Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|
TOP
ABSTRACT
RESULTS
CT = CT(AGL61) – CT(ACTIN2). We next calculated an average 
