OPEN ACCESS ARTICLE

This Article Free via Open Access: OA OA Abstract Full Text (PDF) Supplemental Data OA All Versions of this Article: 148/1/557    most recent pp.108.120709v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via ISI Web of Science (1) Citing Articles via Google Scholar Google Scholar Articles by Wang, D. Articles by Long, S. P. Search for Related Content PubMed PubMed Citation Articles by Wang, D. Articles by Long, S. P. Agricola Articles by Wang, D. Articles by Long, S. P.

BIOENERGETICS AND PHOTOSYNTHESIS

Cool C₄ Photosynthesis: Pyruvate P_i Dikinase Expression and Activity Corresponds to the Exceptional Cold Tolerance of Carbon Assimilation in Miscanthus x giganteus^1,2,[W],[OA]

Institute for Genomic Biology (D.W., S.P.L.), Department of Plant Biology (D.W., A.R.P., S.P.L.), and Department of Crop Sciences (A.R.P., S.P.M., S.P.L.), University of Illinois, Urbana, Illinois 61801; and United States Department of Agriculture, Photosynthesis Research Unit, Agricultural Research Service, Urbana Illinois 61801 (A.R.P.)

	ABSTRACT

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 
The bioenergy feedstock grass Miscanthus x giganteus is exceptional among C₄ species for its high productivity in cold climates. It can maintain photosynthetically active leaves at temperatures 6°C below the minimum for maize (Zea mays), which allows it a longer growing season in cool climates. Understanding the basis for this difference between these two closely related plants may be critical in adapting maize to colder weather. When M. x giganteus and maize grown at 25°C were transferred to 14°C, light-saturated CO₂ assimilation and quantum yield of photosystem II declined by 30% and 40%, respectively, in the first 48 h in these two species. The decline continued in maize but arrested and then recovered partially in M. x giganteus. Within 24 h of the temperature transition, the pyruvate phosphate dikinase (PPDK) protein content per leaf area transiently declined in M. x giganteus but then steadily increased, such that after 7 d the enzyme content was significantly higher than in leaves growing in 25°C. By contrast it declined throughout the chilling period in maize leaves. Rubisco levels remained constant in M. x giganteus but declined in maize. Consistent with increased PPDK protein content, the extractable PPDK activity per unit leaf area (V_max,ppdk) in cold-grown M. x giganteus leaves was higher than in warm-grown leaves, while V_max,ppdk was lower in cold-grown than in warm-grown maize. The rate of light activation of PPDK was also slower in cold-grown maize than M. x giganteus. The energy of activation (E_a) of extracted PPDK was lower in cold-grown than warm-grown M. x giganteus but not in maize. The specific activities and E_a of purified recombinant PPDK from M. x giganteus and maize cloned into Escherichia coli were similar. The increase in PPDK protein in the M. x giganteus leaves corresponded to an increase in PPDK mRNA level. These results indicate that of the two enzymes known to limit C₄ photosynthesis, increase of PPDK, not Rubisco content, corresponds to the recovery and maintenance of photosynthetic capacity. Functionally, increased enzyme concentration is shown to increase stability of M. x giganteus PPDK at low temperature. The results suggest that increases in either PPDK RNA transcription and/or the stability of this RNA are important for the increase in PPDK protein content and activity in M. x giganteus under chilling conditions relative to maize.

An exception among C₄ grasses is the bioenergy crop Miscanthus x giganteus, a rhizomatous perennial of the Andropogoneae, which is highly productive in cool climates (Beale and Long, 1995; Bullard et al., 1995; Beale et al., 1996; Heaton et al., 2004). M. x giganteus is closely related to sugar cane (Saccharum officinarum), sorghum (Sorghum bicolor), and maize. Like these crop species, M. x giganteus uses the NADP-malic enzyme pathway of C₄ photosynthesis, while sequences of its photosynthetic genes share >99% sequence identity with sugar cane (Naidu et al., 2003; Wang et al., 2008). When grown in the cool temperate climate of southern England (52°N), M. x giganteus produced 30 tons of dry matter per ha per year, one of the highest dry matter yields recorded for the United Kingdom. In marked contrast to maize grown at the same location, it showed no loss of maximum photosynthetic efficiency during cold spring weather (Baker et al., 1989; Beale and Long, 1995; Beale et al., 1996). Growing maize at 14°C results in a more than 90% reduction of maximum photosynthetic rate relative to leaves grown at 25°C, whereas M. x giganteus grown at 14°C or 10°C shows little loss of photosynthetic capacity (Nie et al., 1992; Naidu and Long, 2004; Farage et al., 2006). Understanding how this is achieved may be critical to adapting maize and other C₄ crops to colder climates or in extending the growing season into cooler periods of the year so allowing greater use of the available solar radiation.

The molecular mechanism by which M. x giganteus is able to maintain high photosynthetic rates at low temperatures remains unclear. In saturating light and chilling temperatures (<15°C), CO₂ assimilation for chilling-intolerant C₄ species is severely reduced, and in turn utilization of observed excitation energy leads to photoinhibition and photooxidation (Long, 1983; Baker et al., 1989; Long et al., 1994). M. x giganteus avoids this damage both by maintaining a high rate of CO₂ uptake, to increase utilization of absorbed light (Beale et al., 1996), and by increased nonphotochemical quenching, which correlates with a large increase in xanthophyll content and its de-epoxidation (Farage et al., 2006). Chilling-induced decreases in the leaf photosynthetic rate of CO₂ uptake of C₄ species have been correlated with decreases in: carboxylation efficiency via PEPc (Kingston-Smith et al., 1997; Chinthapalli et al., 2003), capacity for PEP regeneration via PPDK (Du et al., 1999a), Rubisco activity (Kingston-Smith et al., 1997; Du et al., 1999a; Pittermann and Sage, 2000; Pittermann and Sage, 2001; Chinthapalli et al., 2003), or by a combination of these. Analyses of flux control coefficients in transgenic plants of the C₄ dicot Flaveria bidentis suggest that Rubisco and PPDK share control and limit light-saturated C₄ photosynthesis (Furbank et al., 1997). This applies at saturating intercellular mesophyll CO₂ concentration, a condition that is met in the current atmosphere in both cold- and warm-grown M. x giganteus (Naidu and Long, 2004).

In warm-grown F. bidentis, transformed with antisense Rubisco small subunit gene constructs, in vitro activities of Rubisco matched the in vivo photosynthetic rates at low temperature, which suggested that Rubisco content controlled the C₄ photosynthetic rate at low temperature (Kubien et al., 2003). In addition, for each of the chilling-tolerant C₄ species Bouteloua gracilis, Muhlenbergia glomerata, and Amaranthus retroflexus, in vivo photosynthetic rates below 20°C showed the same pattern of decline as maximum activities of Rubisco in crude extracts (Pittermann and Sage, 2000; Sage, 2002; Kubien and Sage, 2004). These findings led Sage and McKown (2006) to propose that because Kranz anatomy limits the enzyme to the bundle sheath, C₄ plants are inherently more prone to Rubisco limitation as the activity of the enzyme declines with temperature. When grown at 14°C and measured at 10°C, M. x giganteus achieves about twice the photosynthetic rate of the cold-tolerant C₄ species M. glomerata (Kubien and Sage, 2004; Naidu and Long, 2004). Yet in cold-grown M. x giganteus, Rubisco content remained unchanged relative to warm-grown plants, while it decreased in cold-grown maize (Naidu et al., 2003). Furthermore, the cold tolerance of C₄ photosynthesis in M. x giganteus could not be attributed to the catalytic properties of Rubisco, which showed no differences between cold- and warm-grown M. x giganteus nor with warm-grown maize (Wang et al., 2008).

Other studies have inferred that PPDK is the key limiting factor for C₄ photosynthesis at low temperature. Low extractable activities, often only just sufficient to support in vivo rates of photosynthesis, have been reported frequently (Long, 1983; Edwards et al., 1985). PPDK catalyzes the regeneration of PEP as the primary acceptor of atmospheric CO₂ from pyruvate, ATP, and phosphate in C₄ photosynthesis. PPDK undergoes diurnal dark/light regulation of activity, which is controlled by a bifunctional regulatory protein (Burnell and Hatch, 1984; Ashton et al., 1990; Chastain et al., 2008). The fully functional C₄ isoform of PPDK is a tetramer. The subunits dissociate between 10°C and 15°C, causing an increase in the energy of activation (E_a) and a loss of catalytic rate with further decline in temperature (Shirahashi et al., 1978; Ohta et al., 1996; Du et al., 1999b). In addition, the maximum extractable PPDK activity correlated well with cold tolerance in three Saccharum species (Du et al., 1999a) and across maize cultivars (Sugiyama and Boku, 1976). In contrast to the effects of temperature on the PPDK enzyme, there appears to be no correlation between thermal properties of other C₄ photosynthetic enzymes and differences in cold sensitivity of plant ecotypes (Du et al., 1999b; Hamel and Simon, 2000). Furthermore, an analysis of transgenic F. bidentis with antisense PPDK gene constructs showed that PPDK shares control of C₄ photosynthetic rate with Rubisco under ambient CO₂ and high light (Furbank et al., 1997). A key role for PPDK in low temperature tolerance is also inferred in two chilling-tolerant PEP carboxykinase type C₄ species, which apparently maintain photosynthetic rates at low temperature by bypassing PPDK in PEP synthesis, via PEP carboxykinase (Smith and Woolhouse, 1983; Matsuba et al., 1997). Although analysis of the cDNA sequences for PPDK in M. x giganteus and maize have failed to reveal any differences in putative amino acids sequences that could confer cold tolerance, the amount of PPDK was reported to increase significantly in M. x giganteus when grown at low temperature. This was in sharp contrast to the PPDK decreases observed in maize (Naidu et al., 2003). If PPDK is a limitation at low temperature, then low temperature-adapted species might be expected either to up-regulate expression of the enzyme in response to chilling or possess an isoform with a higher specific activity at low temperatures.

Here, the hypothesis that an increase in PPDK content, but not kinetics properties of PPDK, corresponds to the ability of M. x giganteus to maintain photosynthetic capacity when transferred to low temperature is examined. CO₂ assimilation rate and quantum yield of PSII (PSII) were measured in parallel with protein and transcript levels of PPDK in the leaves of M. x giganteus and maize during a transition of growth conditions from warm to cold temperature. The catalytic rates, E_a, and light activation kinetics of PPDK in both crude leaf extracts and in purified recombinant PPDK were compared between M. x giganteus and maize, as was the effect of enzyme concentration on the cold stability of PPDK.

	RESULTS

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 

Influence of Chilling Temperature on Chlorophyll Content, CO₂ Assimilation Rate, and PSII

Following transition from a 25°C (warm) to a 14°C (chilling) growth temperature, CO₂ assimilation rate (A) and _PSII measured on existing fully expanded maize leaves declined progressively over 9 d to about 38% and 30%, respectively, of prechilling levels (Fig. 1 ). A similar decline occurred in fully expanded M. x giganteus leaves for the first 2 d, but was followed by a recovery stabilizing at about 88% of the preexposure level for A and 73% for PSII by day 9 (Fig. 1).

View larger version (12K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 1. Change in leaf CO2 uptake rate and PSII following transfer of plants from 25°C to 14°C. Means (±1 SE) for five plants are expressed as a percentage of rate observed immediately on transfer to 14°C, which were 14.8 ± 0.6 µmol m–2 s–1 and 0.12 ± 0.02 for maize and 16.2 ± 0.9 µmol m–2 s–1 and 0.14 ± 0.03 for M. x giganteus.

Changes in Protein and Transcript Contents of PPDK in M. x giganteus and Maize

M. x giganteus leaves developed at 25°C and then transferred to 14°C after completion of expansion accumulated PPDK protein, while maize mature leaves given the same treatment lost PPDK (Fig. 2A ). In parallel with the kinetics of the response of A to transfer to 14°C, PPDK protein declined slightly in M. x giganteus on the first day at low temperature, but then accumulated above the original level by day 3 and the amount was nearly doubled (calculated from band density) by day 7 (Fig. 2A). When quantified in absolute terms, PPDK content in 25°C grown M. x giganteus leaves was 0.30 g/m² and increased to 0.56 g/m² after 14 d at 14°C (Supplemental Fig. S1). However, for Rubisco, M. x giganteus mature leaves developed at 25°C and then transferred to 14°C showed no significant loss of Rubisco, in contrast to a marked decline in maize leaves (Fig. 2B).

View larger version (40K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 2. PPDK (A) and Rubisco (B) protein contents in M. x giganteus and maize for the leaves of Figure 1 following transfer from 25°C/20°C to 14°C/12°C (day/night). Prior to transfer, these plants had been grown continuously at 25°C/20°C. In addition, the lane marked "25C" shows protein contents immediately prior to the transfer. The lane marked "14C" is for leaves of the same developmental stage of plants that were grown and developed entirely at 14°C/12°C (day/night), this is included for comparison. For each lane, protein was extracted from 1.9 cm2 of leaf area into 500 µL of extraction buffer, of which 20 µL was loaded and separated by 10% SDS-PAGE. Western blots used polyclonal primary antibodies against maize PPDK and spinach Rubisco, respectively. The bands on Figure 2, A and B, were quantified in relative terms by densitometry (Odyssey V1.2 application software; C). Means (±1 SE) for three plants' Rubisco and PPDK protein contents, expressed as a percentage of the amount present immediately prior to the transfer to 14°C/12°C; i.e. the first lane of A and B. The amounts of M. x giganteus PPDK were also quantified from a standard curve, generated from known quantities of recombinant PPDK (Supplemental Fig. S1) and shown via the right-hand axis of the lower segment.

View larger version (30K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 3. Quantitative real-time RT-PCR analysis of PPDK expression in leaves of M. x giganteus and maize. The leaf samples were collected 1, 3, 5, 7, and 14 d after transfer from 25°C to 14°C or collected from plants grown continuously at 25°C (25C) and 14°C (14C), respectively. The total RNAs were isolated and quantitative real-time RT-PCR in triplicate was conducted using a pair of primers specific for PPDK genes. The expression of PPDK from plants continuously grown at 25°C (25C) was used as control and set as 1.0. The changes in expression of PPDK were determined relative to the control. Bars are the means (+1 SE) of three replicate plants, relative to the level immediately prior to transfer to 14°C.

The extractable activity of PPDK 14 d after transfer to 14°C corresponded closely to A in these leaves, 5.3 versus 5.6 µmol m^–2 s^–1, respectively, for maize, and 18.3 versus 14.1 µmol m^–2 s^–1 for M. x giganteus (Table I ; Fig. 1). The apparent E_a was calculated separately for a low (6°C –18°C; E_a,6–18) and a high (18°C–28°C; E_a,18–28) temperature range (Fig. 4, A and B ). For the control plants grown at 25°C, the E_a,6–18 was about 1.5-fold of E_a,18–28 for PPDK from M. x giganteus, and was slightly and significantly greater at 1.8-fold for PPDK from maize (Table I). For plants exposed to 14°C for 14 d, the E_a,6–18 was about 1.4-fold of E_a,18–28 for PPDK from M. x giganteus and again higher at 2.0-fold for PPDK from maize (Table I). For M. x giganteus, the E_a,6–18 of PPDK extracted from leaves exposed to 14°C was 15% lower than that of the control plant, indicating some acclamatory effect, while no significant difference was observed for E_a,18–28 (Table I). In sharp contrast to M. x giganteus, the E_a,6–18 and E_a,18–28 of PPDK activity from maize leaves exposed to 14°C was 37% and 24% higher than that of the control plant, respectively (Table I).

View larger version (18K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 4. Maximum rates of PPDK-catalyzed PEP synthesis expressed on a leaf area basis versus assay temperature, transformed to provide Arrhenius plots for M. x giganteus (A) and maize (B) grown at 25°C () and transferred to 14°C () for 14 d. PPDK was extracted from leaves of M. x giganteus and maize. Values are the means (±1 SE) of five plants. The inset shows the linear regression fitted to the Arrhenius plots for low (6°C–18°C) measuring temperatures.

To test if the lower E_a of PPDK in crude extracts from M. x giganteus at low temperature is due to any inherent difference in the protein and related gene sequence differences, C₄ PPDK genes from both species were cloned and expressed in Escherichia coli so that the two enzymes could be synthesized and extracted from a common background. The specific activities of purified His-tagged recombinant PPDK of M. x giganteus and maize increased with temperature from 6°C to 28°C but showed no significant difference across this range (Fig. 5A ). For example, the specific activities of PPDK of M. x giganteus and maize at 25°C were 7.3 ± 0.5 and 7.6 ± 0.4 µmol min^–1 mg^–1, respectively, and 3.3 ± 0.4 and 3.1 ± 0.3 µmol min^–1 mg^–1, respectively, at 15°C. In contrast to crude extracts, the Arrhenius plots of V_max,ppdk showed no significant difference between M. x giganteus and maize across all measuring temperatures (Fig. 5B; Table I). An apparent break-point in the Arrhenius plot was observed at 15°C for both M. x giganteus and maize PPDK (Fig. 5B). A shift in the slopes of the fitted lines at high (18°C–28°C) and low (6°C–15°C) temperature was observed (Fig. 5B). Therefore, the apparent E_a of the PPDK was calculated separately for these two regions of the plot. The E_a at low measuring temperatures was 2.2-fold of that above 15°C for PPDK activity from both M. x giganteus and maize (Table I). No significant difference in the E_a in either temperature range was observed between recombinant PPDK from two species. The lack of difference between the two recombinant PPDKs suggests that differences observed in leaf extracts are a result of posttranslational differences or differences within the stromal environments and not differences between the gene sequences coding for the two polypeptides.

View larger version (11K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 5. Maximum rates of PPDK-catalyzed PEP synthesis per unit protein versus assay temperatures (A) and transformed to provide Arrhenius plots (B) for purified recombinant His-tagged PPDK of M. x giganteus () and maize () cloned in E. coli. The linear regressions in the Arrhenius plot are for low (6°C–15°C) and high (18°C–28°C) measuring temperatures. Values are the means (±1 SE) of three different transformation events. The arrow indicates the apparent break point in Arrhenius plot for both M x giganteus and maize PPDKs at 15°C.

To examine the relationship between cold inactivation of PPDK activity and enzyme concentration, the specific PPDK activity at varying protein concentrations (0.1–2 mg/mL) was measured following 10, 20, 40, and 60 min of incubation at 0°C (Fig. 6 ). The initial PPDK activities immediately before 0°C incubation (at time 0) were very similar and about 6.9 µmol mg^–1 min^–1 at all enzyme concentrations. The PPDK activities decreased during the cold treatment at all PPDK concentrations, but the decreases were much slower at higher enzyme concentration. The half-time when PPDK activity falls to 50% of the initial value (t_1/2) at a protein concentration of 0.1 mg/mL was 9.2 min, while t_1/2 at a concentration of 2 mg/mL was 22.6 min (Fig. 6). By the end of 10 min incubation at 0°C, the PPDK activity at the concentration of 0.1 mg/mL was only 36% of the control, while the PPDK activity at the concentration of 2 mg/mL was 73% of the control (Fig. 6).

View larger version (16K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 6. Cold inactivation of M. x giganteus recombinant PPDK at varying enzyme concentrations. The purified recombinant M. x giganteus PPDKs were diluted to varying protein concentrations and incubated at 0°C for the time indicated. The specific PPDK activities immediately before the cold treatment at time 0 were assigned as 100%. The data were fitted to a first-order exponential decay (Origin-Pro 7.5, OriginLab). The t1/2 (the time points at which PPDK activity fell to 50% of the initial value) at the different protein concentrations are shown.

Activity of the C₄ PPDK is known to be tightly regulated by the light/dark cycle. To examine the influence of chilling, the activation kinetics of PPDK from warm-grown and chilling-exposed M. x giganteus and maize were compared by measuring maximum activities of PPDK during the dark to light transition. The PPDK polypeptide contents showed no significant changes within 1 h following the dark to light transition in either species or in either temperature (Supplemental Fig. S2). However, acclimation to 14°C reduced the rate of activation of PPDK in both species, but to a much greater extent in maize (Fig. 7 ; Table II ). The time required to reach 50% of the maximum PPDK activity from chilling-acclimated plants increased to 2.6-fold (M. x giganteus) and 4.7-fold (maize) in comparison to that for warm-grown plants (Fig. 7; Table II). However, on completion of activation, the activity in cold-grown leaves of M. x giganteus was about 20% higher than in warm-grown leaves, in sharp contrast to maize (Table II).

View larger version (16K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 7. Activation kinetics of PPDK in leaf crude extract from M. x giganteus (MG) and maize (ZM) grown continuously at 25°C (25) or grown at 25°C and then at 14°C (14) for 14 d. The leaves were dark adapted for 10 h in their respective growth environments. The leaf discs were collected into liquid N2 immediately before illumination and then at time points following illumination time points. The maximum activities of PPDK expressed on a leaf area basis were measured at 25°C as in Figure 4. Values are the means (±1 SE) of five plants.

View larger version (51K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 8. Changes in phosphorylation level of PPDK upon illumination from leaves of M. x giganteus (MG) and maize (ZM) grown continuously at 25°C (25) or grown at 25°C and then at 14°C (14) for 14 d. The leaf samples were collected as described in Figure 7. The phospho-PPDK was probed with an affinity-purified rabbit polyclonal antibodies raised against a synthetic phosphopeptide conjugate corresponding to the Thr-phosphorylation domain of maize C4 PPDK. A representative immunoblot is shown (A). The band density shown in Figure 8A was quantified by densitometry (Odyssey V1.2 application software). The changes in phosphorylation level of PPDK at illumination times were expressed as percentage of that from dark-adapted leaves at time 0 (B).

	DISCUSSION

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 
Exposure to chilling temperatures is a key limitation to the production of maize both in the early and late growing season, particularly near the high-latitude limits of current cultivation (Miedema, 1982; Allen and Ort, 2001). Chilling events can occur after planting or before completion of grain fill. These result in a loss of photosynthetic capacity, which is exacerbated by photoinhibition and photooxidation (Long et al., 1983, 1994; Baker et al., 1989). The chilling tolerance of M. x giganteus is shown by comparison here to an inbred maize line selected for the corn belt. This inbred line also parallels responses observed previously for hybrids selected for use at the cold temperature limit of maize cultivation in Europe (Miedema, 1982; Long et al., 1983; Nie et al., 1992). While M. x giganteus retains a high photosynthetic rate in leaves transferred to 14°C (18.3 µmol m^–2 s^–1), the rate in maize declined to almost one-quarter of that value (5.3 µmol m^–2 s^–1), even though these leaves had very similar rates of CO₂ uptake to those of M. x giganteus prior to being transferred to 14°C.

Both Rubisco and PPDK have been suggested as the potential control points limiting C₄ photosynthesis at chilling temperatures (Furbank et al., 1997; Kubien et al., 2003). Upon transfer of the chilling-tolerant NADP-malic enzyme C₄ grass M. x giganteus grown at 25°C to 14°C, mature leaves show a small transient loss of photosynthetic capacity. Their recovery and maintenance of a high photosynthetic rate under these cool conditions correlated with a marked increase in PPDK protein and mRNA. By contrast, Rubisco content remained constant during this treatment. Similarly, Naidu et al. (2003) showed that leaves of M. x giganteus developed at 14°C accumulated higher amounts of PPDK protein than leaves grown at 25°C but had similar levels of Rubisco as those grown at 25°C, in contrast to maize, where both PPDK and Rubisco declined. The dramatic increase of PPDK protein concentration in M. x giganteus leaves may be the mechanism by which PPDK activity in vivo is maintained in cool temperatures. Alteration of the stromal environment by concentrating this protein may enhance the level of active tetramer association (Hatch, 1979). This is supported by observations of increased cold stability of PPDK as protein concentrations are increased, as shown both here and in previous studies (Shirahashi et al., 1978; Salahas et al., 1990). Is there any evidence that increased expression of PPDK can increase photosynthetic rate in C₄ plants at chilling temperatures? Ohta et al. (2006) recently overexpressed PPDK from the moderately cold-tolerant C₄ species Flaveria brownii in maize and found that the transgenic plants could maintain a photosynthetic rate 23% greater than the untransformed line down to a leaf temperature of 8°C. This is consistent with the inference from the present study, where the ability to maintain photosynthetic rate during chilling correlates with increases in the amount of PPDK. In addition, a stress-induced (drought-induced and cold-induced) increase in PPDK expression has been shown in previous studies of other C4 species (Michalowski et al., 1989; Moons et al., 1998; Nogueira et al., 2003). For example, a RNA profile of cold-responsive genes using filter arrays showed that PPDK transcripts significantly increased on transfer of a sugar cane hybrid (Saccharum sp. ‘SP80-3280’) from 26°C to 4°C (Nogueira et al., 2003). In summary, these previous reports coupled with our findings suggest an important role for PPDK in acclimation to chilling in C4 species.

Not only is PPDK expression increased, but the apparent kinetics and activation of the enzyme are altered. In crude extracts, PPDK from M. x giganteus shows lower activation energy at low temperature and so shows less loss of activity as temperature is decreased. However, this does not appear to result from differences in the primary polypeptide, because when PPDK was cloned and expressed in E. coli, the recombinant-expressed protein from M. x giganteus showed no difference in activation energy to that from maize. This is consistent with the observation that there are few amino acid changes that distinguish C₄ PPDK sequences among M. x giganteus, maize, and cold-intolerant sugar cane (Naidu et al., 2003). Previous analyses of sugar cane lines with different cold sensitivity (Du et al., 1999a) and Echinochloa crus-galli ecotypes from contrasting climates (Simon, 1996) also concluded that cold tolerance in those species is not due to the intrinsic properties of PPDK. The difference in crude extracts is therefore the result of either posttranslational modification or the presence of activators or inhibitors that affect the activity of the enzyme in leaf extracts. Divalent cations (Mn²⁺, Mg²⁺, and Ca²⁺), PEP, polyols (glycerol and sorbitol), and free amino acids (Pro) or their derivatives have been shown to protect PPDK against cold inactivation, possibly by preventing the dissociation of tetrameric active enzyme (Krall et al., 1989; Salahas et al., 2002).

Low temperature decreased the activation of PPDK in both M. x giganteus and maize, which is consistent with previous reports on maize and E. crus-galli (Edwards et al., 1980; Simon and Hatch, 1994). Early analyses showed that activation of PPDK from the C₄ grass E. crus-galli subjected to cold treatment was faster in ecotypes from cool climates compared to those native to warmer climates (Simon and Hatch, 1994). Activation is also faster in M. x giganteus than maize. This may be critical in protecting the leaf against photoinhibition. When carbon metabolism is inhibited, utilization of absorbed light energy is decreased, which increases the potential for photoinhibition and photooxidative damage (Long et al., 1983; Powles and Bjorkman, 1983). Maize is particularly vulnerable to such damage on cool mornings with clear skies (Baker et al., 1989; Long et al., 1994). Slow induction of PPDK at low temperature could exacerbate this damage.

The findings presented here, coupled with those from the PPDK overexpressor transformants of maize (Ohta et al., 2006), provide strong evidence that this enzyme is critical to maintaining C₄ photosynthesis at low temperature. Rubisco has previously been suggested as the most likely candidate for limiting C4 photosynthesis at low temperatures (Sage, 2002; Kubien et al., 2003). However, Rubisco levels remained constant in M. x giganteus leaves at low temperature, whereas PPDK increased, which is consistent with the suggestion by Sage (2002) that C₄ leaves cannot physically accommodate more Rubisco. But restriction at Rubisco cannot explain the observed decline and recovery in leaf photosynthetic rates for M. x giganteus upon transfer to low temperature nor the increased photosynthetic rate measured at low temperature in transgenic maize that overexpresses PPDK.

One major difference in the C₄ photosynthetic pathway between M x giganteus and chilling-sensitive maize appears to be higher steady-state PPDK mRNA accumulation, which may result from either increased transcriptional activity of the C₄ PPDK gene or greater stability of its mRNA. The basis of this increase is unknownbut may reflect a pattern of acclimation to other stresses where one or more transcription factors are up-regulated (Thomashow et al., 2001). Discovering the regulatory network underlying increased C₄ PPDK expression will be critical to gaining a more complete picture of the mechanistic basis for successful acclimation of C₄ photosynthesis to low temperature, as realized in M. x giganteus.

	MATERIALS AND METHODS

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 

Plant Materials and Growth Conditions

Miscanthus x giganteus and maize (Zea mays) FR1064 (a commercial inbred line, Illinois Foundation Seeds) was grown in soil-less potting media (Sunshine Mix LC1²; Sun Gro Horticulture) following the procedure of Naidu and Long (2004). Plants were grown at 14°C/12°C (cold) or 25°C/20°C (warm) day/night temperature and 14-h-day/10-h-night cycle under 500 µmol photons m^–2 s^–1 in controlled-environment chambers equipped with a mixture of high-pressure mercury and sodium lamps (E-15H; Conviron). To examine the ability of leaves to maintain photosynthetic capacity on chilling, plants originally grown in a controlled-environment chamber with 25°C/20°C (warm) day/night temperature were transferred to an identical chamber but with 14°C/12°C (cold) day/night temperature, and all other environmental conditions were unchanged. Leaves that had just completed expansion, as judged by ligule emergence, were collected after 3 h of illumination for assays based on crude extracts or time specified for light activation assays. The leaf discs were cut from fully expanded leaves and immediately frozen into and then stored in liquid nitrogen. Light-saturated leaf CO₂ assimilation (A_CO2) and PSII were measured on fully expanded leaves that had been illuminated for 3 to 4 h.

RNA Extraction and Quantitative Real-Time RT-PCR

Total RNA from leaf samples was isolated using RNeasy kit (Qiagen) according to the manufacturer's instructions. First-strand cDNAs were synthesized from DNaseI-treated total RNA using RT (Superscript II RNase H–; Invitrogen). For real-time quantitative PCR, reaction mixes of 25 µL were prepared including 12.5 µL of the SYBR Green PCR MasterMix (Applied Biosystems), 0.4 pmol of a primer pair, and 1 µL of 10-fold diluted first-strand cDNA. PCR amplifications were carried out on a Cepheid Smart Cycler system. The reactions were started with a step of 50°C for 2 min and 95°C for 10 min to activate the polymerase, followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. Dissociation kinetics analysis of the amplification products were performed to ensure specific amplification. The PCR for ubiquitin gene was used as the internal control. The primer pairs for PPDK genes are: for M. x giganteus PPDK (accession no. AY262272), forward primer 5'-GCGCCGATTGCGACGAAAAAGAG-3' and reverse primer 5'-CCCAGCAGTTCCTTCATGCTCTTGT-3'; and for maize PPDK (accession no. J03901), forward primer 5'-CGCCGATACAGACGACCAAAAAGAGG-3' and reverse primer 5'-CCCAGCAGTTCCTTCATGGTCTTGT-3'. The primers of each pair contained the sequences of the ends of two contiguous exons to avoid amplification of genomic DNA. The primer pairs for the ubiquitin gene are: for M. x giganteus ubiquitin, forward primer 5'- CCTCTGACACCATCGACAATGTGAA-3' and reverse primer 5'- GCTGCTTGCCGGCGAAGATG-3'; and for maize ubiquitin, forward primer 5'- GCTCTGACACCATCGACAACGTGAA-3' and reverse primer 5'- GCTGCTTGCCGGCGAAGATC-3', respectively.

Expression and Purification of Recombinant His-Tagged PPDK

The cDNA of MgPPDK13 (Naidu et al., 2003) was cloned into BamHI and EcoRI sites of pRSETa (Invitrogen) with a pair of primers: forward primer TTGGATCCTCCGACGCCGGCGCGGGACGG and reverse primer ATGAATTCTCAGACAAGCACCTGAGCTGCAGC with the restriction sites BamHI and EcoRI underlined, respectively. The plasmid construction was confirmed by sequencing. The plasmid construction for maize PPDK cDNA (zmPPDK) was a gift from Dr. Chastain (Minnesota State University). The plasmids were transformed into BL21 (DE3) competent strains of Escherichia coli. The overexpression and purification of recombinant His-tagged PPDK were performed as described previously (Chastain et al., 1996).

Chlorophyll Contents, Chlorophyll Fluorescence, and Gas Exchange

Chlorophyll contents were measured and calculated according to Porra et al. (1989). The light-saturated CO₂ uptake and transpiration were measured simultaneously with modulated chlorophyll fluorescence on fully expanded attached leaves using a LI-COR 6400 portable photosynthesis system as described previously (Naidu and Long, 2004; Wang and Portis, 2007). All measurements were conducted in ambient air under 1,000 µmol m^–2 s^–1 of light illumination. Five replicate plants were measured for each measurement temperature and treatment combination. Actinic light was supplied by light-emitting diodes (90% red light, 630 nm; 10% blue light, 470 nm) to record the steady-state chlorophyll fluorescence level (F_s). A pulse-modulated measuring light (630 nm; 1 µmol photons m^–2 s^–1) was used to determine the minimum chlorophyll fluorescence at the open PSII center. An 800-ms saturating pulse of about 5,000 µmol m^–2 s^–1 was applied to measure the maximum chlorophyll fluorescence at the closed PSII center in the dark (F_m) or during actinic light illumination (F_m'). The PSII of illuminated leaves was calculated as (F_m' – F_s)/F_m' (Genty et al., 1989).

PPDK Extraction and Activity Assays

Extraction of PPDK followed the procedure of Crafts-Brandner and Salvucci (2002) with the following modifications. The extraction buffer contained 50 mM HEPES-NaOH, pH 8.0, 10 mM MgCl₂, 5 mM dithiothreitol, 1 mM EDTA, 1% (w/v) casein, 1% (w/v) polyvinylpyrrolidone, 0.05% (v/v) Triton X-100, 20 mM NaF (for phospho-PPDK immunoassays only), 2 µM orthovanadate (for phospho-PPDK immunoassays only), and one protease inhibitor cocktail tablet (EDTA-free) per 10 mL of extraction buffer (Roche Applied Science). Two leaf discs (1.1-cm diameter) were ground rapidly in 500 µL of extraction buffer using a Tenbroeck tissue homogenizer at room temperature. The extract was then centrifuged for 30 s at 15,000g.

The activity of PPDK was measured by coupling the production of PEP to NADH oxidation via PEPc and malate dehydrogenase modified from Ashton et al. (1990). Except where noted below, all enzymes and chemicals were obtained from Sigma-Aldrich. NADH oxidation was monitored for 1 min in a dual-beam UV/VIS spectrophotometer at a wavelength of 340 nm in temperature-controlled cuvettes (Cary I and Temperature Control Accessory; Varian). The measurement temperatures were 6°C, 8°C, 10°C, 12°C, 15°C, 18°C, 20°C, 25°C, and 28°C. A 20-µL aliquot of crude extract supernatant was added to the cuvette (pre-equilibrated at assay temperature in the spectrophotometer) containing 1 mL of assay buffer and was incubated for 5 min at each measuring temperature. The assay buffer consisted of 100 mM HEPES-NaOH, pH 8.0, 15 mM MgCl₂, 0.15 mM EDTA, 5 mM NaHCO₃, 0.3 mM NADH, 5 mM NH₄Cl, 2.5 mM K₂HPO₄, 5 mM dithiothreitol, 1 mM Glc-6-P, 1.5 mM ATP, and 10.5 units malate dehydrogenase. The reaction was initiated by the addition of pyruvate to 1.25 mM final concentration and 3 units of purified maize PEPCase (Bio-Research Products).

Immunoblot Analysis

Total soluble proteins on a leaf area basis were separated by 10% Tris-Gly SDS-PAGE and blotted onto the polyvinylidene difluoride membrane. PPDK and Rubisco proteins were detected with rabbit polyclonal antibodies raised against recombinant maize PPDK (Budde and Chollet, 1986) and native spinach (Spinacia oleracea) Rubisco. The phospho-PPDK was probed with the affinity-purified rabbit polyclonal antibodies raised against a synthetic phosphopeptide conjugate corresponding to the Thr-phosphorylation domain of maize C₄ PPDK (Chastain et al., 2000). The blots were incubated with fluorescent-conjugated rabbit secondary antibodies (IRdye; LI-COR). The polyvinylidene difluoride membranes were scanned by using an Odyssey Infrared Imaging system (LI-COR), and relative protein expression levels were quantified with the Odyssey V1.2 application software as described previously (Wang and Portis, 2006).

Calculations

PPDK activity was calculated from the change in absorbance and the extinction coefficient of NADH (6,221 µL µmol^–1 cm^–1), accounting for the stoichiometry of the reactions linking each enzyme from NADH to CO₂: i.e. 1 mol of PEP is consumed for each mol of NADH and 1 mol of bicarbonate for each of PEP. The maximum enzyme activity was reported as V_max for PEP formation. To calculate the E_a, Log V_max versus the inverse of the measuring temperature (K) times 1,000 was plotted (Arrhenius plot), and the slope of the line determined by linear regression (Origin 7.0). The slopes were determined separately at high (15°C–28°C or 18°C–28°C) and low (6°C–15°C or 6°C–15°C) temperature, because a break point, reflecting a shift in E_a for PPDK, was apparent at 15°C. Fitting two lines on either side of the break at 15°C accounted for significantly more residual variation than use of a single line (F, statistic). E_a was calculated as the product of the slope, 2.3 (to convert from log₁₀ to ln), and the ideal gas constant (R= 8.3143 J/mol K) to yield E_a in units of kJ/mol.

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Quantification of PPDK in crude leaf extract of M. x giganteus grown continuously at 25°C (25) and or grown at 25°C and then transferred to 14°C (14) for 14 d, before sampling.

Supplemental Figure S2. Changes in PPDK protein contents in leaves of M. x giganteus (MG) and maize (ZM) grown continuously at 25°C (25) and then at 14°C (14) for 14 d upon illumination.

	ACKNOWLEDGMENTS

 
We thank Dr. Shawna L. Naidu for development of PPDK activity assay, Bosola Oladeinde and Ayodele Gomih for technical assistance with plasmid construction of His-tagged M. x giganteus PPDK, and Dr. Chris Chastain for providing plasmid DNA constructs for His-tagged maize PPDK and antibodies for PPDK and phospho-PPDK.

Received April 10, 2008; accepted May 28, 2008; published June 6, 2008.

	FOOTNOTES

 
¹ This work was supported by the National Science Foundation (grant no. 0446018).

² Mention of a trademark, proprietary product, or vendor does not constitute a guarantee or warranty of the product by the U.S. Department of Agriculture and does not imply its approval to the exclusion of other products or vendors that may also be suitable.

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Stephen P. Long (stevel{at}life.uiuc.edu).

^[W] The online version of this article contains Web-only data.

^[OA] Open Access articles can be viewed online without a subscription.

www.plantphysiol.org/cgi/doi/10.1104/pp.108.120709

^* Corresponding author; e-mail stevel{at}life.uiuc.edu.

	LITERATURE CITED

TOP ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS LITERATURE CITED

 
Allen DJ, Ort DR (2001) Impacts of chilling temperatures on photosynthesis in warm-climate plants. Trends Plant Sci 6: 36–42[CrossRef][Web of Science][Medline]

Ashton AR, Burnell JN, Furbank RT, Jenkins CLD, Hatch MD (1990) Enzymes of C₄ photosynthesis. In PJ Lea, ed, Methods in Plant Biochemistry, Vol 3. Academic Press, New York, pp 39–72

Baker NR, Bradbury M, Farage PK, Ireland CR, Long SP (1989) Measurements of the quantum yield of carbon assimilation and chlorophyll fluorescence for assessment of photosynthetic performance of crops in the field. Philos Trans R Soc Lond B Biol Sci 323: 295–308[Abstract/Free Full Text]

Beale CV, Bint DA, Long SP (1996) Leaf photosynthesis in the C₄-grass Miscanthus x giganteus, growing in the cool temperate climate of southern England. J Exp Bot 47: 267–273[Abstract/Free Full Text]

Beale CV, Long SP (1995) Can perennial C₄ grasses attain high efficiencies of radiant energy conversion in cool climates? Plant Cell Environ 18: 641–650[CrossRef]

Budde RJA, Chollet R (1986) In vitro phosphorylation of maize leaf phosphoenolpyruvate carboxylase. Plant Physiol 82: 1107–1114[Abstract/Free Full Text]

Bullard MJ, Heath MC, Nixon PMI (1995) Shoot growth, radiation interception and dry matter production and partitioning during the establishment phase of Miscanthus sinensis ‘Giganteus’ grown at two densities in the U. K. Ann Appl Biol 126: 365–378[CrossRef][Web of Science]

Burnell JN, Hatch MD (1984) Dark-light regulation of pyruvate, Pi dikinase in C4 plants: evidence that the same protein catalyses activation and inactivation. Biochem Biophys Res Commun 111: 288–293[CrossRef][Web of Science]

Chastain CJ, Botschner M, Harrington GE, Thompson BJ, Mills SE, Sarath G, Chollet R (2000) Further analysis of maize C4 pyruvate, orthophosphate dikinase phosphorylation by its bifunctional regulatory protein using selective substitutions of the regulatory Thr-456 and catalytic His-458 residues. Arch Biochem Biophys 375: 165–170[CrossRef][Web of Science][Medline]

Chastain CJ, Thompson BJ, Chollet R (1996) Maize recombinant C₄-pyruvate, orthophosphate dikinase: expression in Escherichia coli, partial purification, and characterization of the phosphorylatable protein. Photosynth Res 49: 83–89[CrossRef][Web of Science]

Chastain CJ, Xu W, Parsley K, Sarath G, Hibberd JM, Chollet R (2008) The pyruvate, orthophosphate dikinase regulatory proteins of Arabidopsis possess a novel, unprecedented Ser/Thr protein kinase primary structure. Plant J 53: 854–863[CrossRef][Web of Science][Medline]

Chinthapalli B, Murmu J, Raghavendra AS (2003) Dramatic difference in the responses of phosphoenolpyruvate carboxylase to temperature in leaves of C₃ and C₄ plants. J Exp Bot 54: 707–714[Abstract/Free Full Text]

Crafts-Brandner SJ, Salvucci ME (2002) Sensitivity of photosynthesis in a C4 plant, maize, to heat stress. Plant Physiol 129: 1773–1780[Abstract/Free Full Text]

Du YC, Nose A, Wasano K (1999a) Effects of chilling temperature on photosynthetic rates, photosynthetic enzyme activities and metabolite levels in leaves of three sugarcane species. Plant Cell Environ 22: 317–324[CrossRef]

Du YC, Nose A, Wasano K (1999b) Thermal characteristics of C₄ photosynthetic enzymes from leaves of three sugarcane species differing in cold sensitivity. Plant Cell Physiol 40: 298–304[Abstract/Free Full Text]

Dunn R, Thomas SM, Keyss AJ, Long SP (1987) A comparison of the growth of the C4 grass spartina anglica with the C3 grass lolium perenne at different temperatures. J Exp Bot 38: 433–441[Abstract/Free Full Text]

Edwards G, Ujihira M, Sugiyama T (1980) Light and temperature dependence of the rate and degree of activation of pyruvate, Pi dikinase in vivo in maize. Photosynth Res 1: 199–207[CrossRef]

Edwards GE, Nakamoto H, Burnell JN, Hatch MD (1985) Pyruvate, P_i dikinase and NADP-malate dehydrogenase in C₄ photosytnthesis: properties and mechanism of light/dark regulation. Annu Rev Plant Physiol 36: 255–286[CrossRef][Web of Science]

Farage PK, Blowers DA, Long SP, Baker NR (2006) Low growth temperatures modify the efficiency of light use by photosystem II for CO2 assimilation in leaves of two chilling-tolerant C4 species, Cyperus longus L. and Miscanthus x giganteus. Plant Cell Environ 29: 720–728[CrossRef][Medline]

Furbank RT, Chitty JA, Jenkins CLD, Taylor WC, Trevanion SJ, von Caemmerer S, Ashton AR (1997) Genetic manipulation of key photosynthetic enzymes in the C₄ plant Flaveria bidentis. Aust J Plant Physiol 24: 477–485[Web of Science]

Genty B, Briantais JM, Baker NR (1989) The relationship between the quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence. Biochim Biophys Acta 990: 87–92

Hamel N, Simon JP (2000) Molecular forms and kinetic properties of phosphoenolpyruvate carboxylase from barnyard grass (Echinochloa crus-galli (L.) Beauv.: Poaceae). Can J Bot 78: 619–628[CrossRef]

Hatch MD (1979) Regulation of C4 photosynthesis: factors affecting cold-mediated inactivation and reactivation of pyruvate, Pi-dikinase. Aust J Plant Physiol 6: 607–619[Web of Science]

Heaton E, Clifton-Brown JC, Voigt T, Jones M, Long SP (2004) Miscanthus for renewable energy generation: European Union esperience and projections for Illinois. Mitig Adapt Strategies Glob Change 9: 433–451[CrossRef]

Kingston-Smith AH, Harbinson J, Williams J, Foyer CH (1997) Effect of chilling on carbon assimilation, enzyme activation, and photosynthetic electron transport in the absence of photoinhibition in maize leaves. Plant Physiol 114: 1039–1046[Abstract]

Krall JP, Edwards GE, Andreo CS (1989) Protection of pyruvate,Pi dikinase from maize against cold lability by compatible solutes. Plant Physiol 89: 280–285[Abstract/Free Full Text]

Kubien DS, Sage RF (2004) Low-temperature photosynthetic performance of a C₄ grass and a co-occurring C₃ grass native to high latitudes. Plant Cell Environ 27: 907–916[CrossRef]

Kubien DS, von Caemmerer S, Furbank RT, Sage R (2003) C₄ photosynthesis at low temperature. A study using transgenic plants with reduced amounts of Rubisco. Plant Physiol 132: 1577–1585[Abstract/Free Full Text]

Long SP (1983) C₄ photosynthesis at low temperatures. Plant Cell Environ 6: 345–363

Long SP (1999) Environmental responses. In RF Sage, RK Monson, eds, C₄ Plant Biology. Academic Press, San Diego, pp 215–249

Long SP, East TM, Baker NR (1983) Chilling damage to photosynthesis in young Zea mays. 1. Effects of light and temperature-variation on photosynthetic CO₂ assimilation. J Exp Bot 34: 177–188[Abstract/Free Full Text]

Long SP, Humphries S, Falkowski PG (1994) Photoinhibition of photosynthesis in nature. Annu Rev Plant Physiol Plant Mol Biol 45: 633–662[CrossRef][Web of Science]

Matsuba K, Imaizumi N, Kaneko S, Samejima M, Oshugi R (1997) Photosynthetic responses to temperature of phosphoenolpyruvate carboxykinase type C₄ species differing in cold sensitivity. Plant Cell Environ 20: 268–274[CrossRef]

Michalowski CB, Olson SW, Piepenbrock M, Schmitt JM, Bohnert HJ (1989) Time course of mRNA induction elicited by salt stress in the common ice plant (Mesembryanthemum crystallinum). Plant Physiol 89: 811–816[Abstract/Free Full Text]

Miedema P (1982) The effects of low temperature on Zea mays. Adv Agron 35: 93–128[CrossRef]

Moons A, Valcke R, Van Montagu M (1998) Low-oxygen stress and water deficit induce cytosolic pyruvate orthophosphate dikinase (PPDK) expression in roots of rice, a C3 plant. Plant J 15: 89–98[CrossRef][Web of Science][Medline]

Naidu SL, Long SP (2004) Potential mechanisms of low-temperature tolerance of C₄ photosynthesis in Miscanthus x giganteus: an in vivo analysis. Planta 220: 145–155[CrossRef][Web of Science][Medline]

Naidu SL, Moose SP, Al-Shoaibi AK, Raines CA, Long SP (2003) Cold tolerance of C4 photosynthesis in Miscanthus x giganteus: adaptation in amounts and sequence of C4 photosynthetic enzymes. Plant Physiol 132: 1688–1697[Abstract/Free Full Text]

Nie GY, Long SP, Baker NR (1992) The effects of development at suboptimal growth temperatures on photosynthetic capacity and susceptibility to chilling-dependent photoinhibition in Zea mays. Physiol Plant 85: 554–560[CrossRef]

Nogueira FTS, De Rosa VE Jr, Menossi M, Ulian EC, Arruda P (2003) RNA expression profiles and data mining of sugarcane response to low temperature. Plant Physiol 132: 1811–1824[Abstract/Free Full Text]

Ohta S, Ishida Y, Usami S (2006) High-level expression of cold-tolerant pyruvate, orthophosphate dikinase from a genomic clone with site-directed mutations in transgenic maize. Mol Breed 18: 29–38[CrossRef]

Ohta S, Usami S, Ueki J, Kumashiro T, Komari T, Burnell JN (1996) Identification of the amino acid residues responsible for cold tolerance in Flaveria brownii pyruvate, orthophosphate dikinase. FEBS Lett 396: 152–156[CrossRef][Web of Science][Medline]

Pittermann J, Sage R (2001) The response of the high altitude C₄ grass Muhlenbergia montana (Nutt.) A. S. Hitchc. to long- and short-term chilling. J Exp Bot 52: 829–838[Abstract/Free Full Text]

Pittermann J, Sage RF (2000) Photosynthetic performance at low temperature of Bouteloua gracilis Lag., a high-altitude C₄ grass from the Rocky Mountains, USA. Plant Cell Environ 23: 811–823[CrossRef]

Porra RJ, Thompson WA, Kriedemann PE (1989) Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectrometry. Biochim Biophys Acta 975: 384–394

Powles SBBJ, Bjorkman O (1983) Interaction between light and chilling temperature on the inhibition of photosynthesis chilling-sensitive plants. Plant Cell Environ 6: 117–123[CrossRef]

Sage RF (1999) Why C₄ photosynthesis? In RF Sage, RK Monson, eds, C₄ Plant Biology. Academic Press, San Diego, pp 3–16

Sage RF (2002) Variation in the k_cat of Rubisco in C₃ and C₄ plants and some implications for photosynthetic performance at high and low temperature. J Exp Bot 53: 609–620[Abstract/Free Full Text]

Sage RF, McKown AD (2006) Is C4 photosynthesis less phenotypically plastic than C3 photosynthesis? J Exp Bot 57: 303–317[Abstract/Free Full Text]

Salahas G, Cormas E, Zervoudakis G (2002) Cold inactivation of phosphoenolpyruvate carboxylase and pyruvate orthophosphate dikinase from the C₄ perennial plant Atriplex halimus. Russ J Plant Physiol 49: 211–215[CrossRef]

Salahas G, Manetas Y, Gavalas NA (1990) Effects Of glycerol on the in-vitro stability and regulatory activation-inactivation of pyruvate orthophosphate dikinase of Zea-mays L. Photosynth Res 26: 9–18[Web of Science]

Shirahashi K, Hayakawa S, Sugiyama T (1978) Cold lability of pyruvate, orthophosphate dikinase in the maize leaf. Plant Physiol 62: 826–830[Abstract/Free Full Text]

Simon JP (1996) Molecular forms and kinetic properties of pyruvate, P_i dikinase from two populations of barnyard grass (Eichinochloa crus-galli) from sites of contrasting climates. Aust J Plant Physiol 23: 191–199[Web of Science]

Simon JP, Hatch MD (1994) Temperature effects on the activation and inactivation of pyruvate, P_i dikinase in two populations of the C₄ weed Echinochloa crus-galli (barnyard grass) from sites of contrasting Climates. Aust J Plant Physiol 21: 463–473[Web of Science]

Smith AM, Woolhouse HW (1983) Metabolism of phosophoenolpyruvate in the C₄ cycle during photosynthesis in the phosphoenolpyruvate-carboxykinase C₄ grass Spartina anglica Hubb. Planta 159: 175–189

Sugiyama T, Boku K (1976) Differing sensitivity of pyruvate orthophosphate dikinase to low temperature in maize cultivars. Plant Cell Physiol 17: 851–854[Abstract/Free Full Text]

Thomashow MF, Gilmour SJ, Stockinger EJ, Jaglo-Ottosen KR, Zarka DG (2001) Role of the Arabidopsis CBF transcriptional activators in cold acclimation. Physiol Plant 112: 171–175[CrossRef]

Wang D, Naidu SL, Portis AR Jr, Moose SP, Long SP (2008) Can the cold tolerance of C₄ photosynthesis in Miscanthus x giganteus relative to Zea mays be explained by differences in activities and thermal properties of Rubisco? J Exp Bot 59: 1779–1787[Abstract/Free Full Text]

Wang D, Portis AR Jr (2006) Increased sensitivity of oxidized large isoform of ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) activase to adp inhibition is due to an interaction between its carboxyl extension and nucleotide-binding pocket. J Biol Chem 281: 25241–25249[Abstract/Free Full Text]

Wang D, Portis AR Jr (2007) A novel nucleus-encoded chloroplast protein, PIFI, is involved in NAD(P) H dehydrogenase complex-mediated chlororespiratory electron transport in Arabidopsis. Plant Physiol 144: 1742–1752[Abstract/Free Full Text]

This article has been cited by other articles:

				J. Kromdijk, H. E. Schepers, F. Albanito, N. Fitton, F. Carroll, M. B. Jones, J. Finnan, G. J. Lanigan, and H. Griffiths Bundle Sheath Leakiness and Light Limitation during C4 Leaf and Canopy CO2 Uptake Plant Physiology, December 1, 2008; 148(4): 2144 - 2155. [Abstract] [Full Text] [PDF]

This Article Free via Open Access: OA OA Abstract Full Text (PDF) Supplemental Data OA All Versions of this Article: 148/1/557    most recent pp.108.120709v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via ISI Web of Science (1) Citing Articles via Google Scholar Google Scholar Articles by Wang, D. Articles by Long, S. P. Search for Related Content PubMed PubMed Citation Articles by Wang, D. Articles by Long, S. P. Agricola Articles by Wang, D. Articles by Long, S. P.