Plant Physiol. Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online July 30, 2008; 10.1104/pp.108.123216

Plant Physiology 148:611-619 (2008)
© 2008 American Society of Plant Biologists

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
148/1/611    most recent
pp.108.123216v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Albrecht, C.
Right arrow Articles by de Vries, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albrecht, C.
Right arrow Articles by de Vries, S. C.
Agricola
Right arrow Articles by Albrecht, C.
Right arrow Articles by de Vries, S. C.
Related Collections
Right arrow Membrane Trafficking
CELL BIOLOGY AND SIGNAL TRANSDUCTION

Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASE Proteins Serve Brassinosteroid-Dependent and -Independent Signaling Pathways1,[C],[W]

Catherine Albrecht2,*, Eugenia Russinova2,3, Birgit Kemmerling, Mark Kwaaitaal4 and Sacco C. de Vries

Laboratory of Biochemistry, Wageningen University, 6703 HA Wageningen, The Netherlands (C.A., E.R., M.K., S.C.d.V.); and Department of Plant Biochemistry, Centre for Plant Molecular Biology, University of Tübingen, 72076 Tübingen, Germany (B.K.)


    ABSTRACT
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
The Arabidopsis (Arabidopsis thaliana) SOMATIC EMBRYOGENESIS RECEPTOR KINASE (SERK) genes belong to a small family of five plant receptor kinases that are involved in at least five different signaling pathways. One member of this family, BRASSINOSTEROID INSENSITIVE1 (BRI1)-ASSOCIATED KINASE1 (BAK1), also known as SERK3, is the coreceptor of the brassinolide (BR)-perceiving receptor BRI1, a function that is BR dependent and partially redundant with SERK1. BAK1 (SERK3) alone controls plant innate immunity, is also the coreceptor of the flagellin receptor FLS2, and, together with SERK4, can mediate cell death control, all three in a BR-independent fashion. SERK1 and SERK2 are essential for male microsporogenesis, again independent from BR. SERK5 does not appear to have any function under the conditions tested. Here, we show that the different SERK members are only redundant in pairs, whereas higher order mutant combinations only show additive phenotypes. Surprisingly, SERK members that are redundant within one are not redundant in another pathway. We also show that this evolution of functional pairs occurred by a change in protein function and not by differences in spatial expression. We propose that, in plants, closely related receptor kinases have a minimal homo- or heterodimeric configuration to achieve specificity.


In Arabidopsis (Arabidopsis thaliana), there are over 600 genes coding for receptor-like kinases (RLKs; Arabidopsis Genome Initiative, 2000Go; Shiu and Bleecker, 2001Go). Functional information is restricted to a relatively small number of these RLKs.

The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASE (SERK) family consists of five Leu-rich repeat (LRR)-RLKs belonging to subgroup II (Hecht et al., 2001Go) that contain five LRRs in their extracellular domain and display similarity to the previously described DcSERK protein that marks embryogenic competence in carrot (Daucus carota) tissue cultures (Schmidt et al., 1997Go). The main feature distinguishing SERK proteins from other RLKs is the Pro-rich domain containing the SPP motif located between the LRRs and the transmembrane domain. The presence of the SPP domain together with precisely five LRRs was used as a criterion for the identification of the four other SERK genes (SERK2SERK5) among the numerous LRR-RLK encoding genes in the Arabidopsis database (Hecht et al., 2001Go). Sequence analysis of the different SERK proteins indicates that they arose through gene duplication events that generated two ancestral precursors, SERK1-SERK2 and SERK3-SERK4-SERK5. Those precursors further duplicated and mutated to generate the five current SERK members (Hecht et al., 2001Go; He et al., 2007Go). The SERK3 gene was identified as the BRASSINOSTEROID INSENSITIVE1 (BRI1)-ASSOCIATED KINASE1 (BAK1) through interaction with BRI1 in a yeast two-hybrid screen (Nam and Li, 2002Go) and in a genetic screen for suppressors of a weak bri1 phenotype (Li et al., 2002Go). It has also been shown that BRI1 forms heterodimers with SERK3/BAK1 in living cells (Russinova et al., 2004Go; Hink et al., 2008Go) and that the interaction is dependent on the presence of brassinosteroids (BRs; Wang et al., 2005Go). Two other members of the family, SERK1 (Karlova et al., 2006Go) and SERK4/BKK1 (He et al., 2007Go), have also been reported to be involved in BR signaling. Mutant analysis within the SERK family suggested that SERK signaling pathways exist that cannot be directly linked to BRI1-mediated signaling. SERK1 and SERK2 proteins are functionally redundant and essential for tapetum specification and pollen development during male sporogenesis in Arabidopsis (Albrecht et al., 2005Go; Colcombet et al., 2005Go). Null or strong bri1 mutants, although male sterile, are not reported to be altered in male sporogenesis. Recent studies have revealed that, independent from its function in BR signaling, SERK3 alone also controls innate immunity (Kemmerling et al., 2007Go) and is involved in flagellin perception (Chinchilla et al., 2007Go; Heese et al., 2007Go). In combination with SERK4/BKK1, the same SERK3 RLK controls plant cell death (He et al., 2007Go; Kemmerling et al., 2007Go). In cases where the main ligand-binding receptors are known, such as BRI1 or FLS2, the serk3 null mutant allele only displays a subtle phenotype as compared to null mutant alleles of the main receptor (Li et al., 2002Go; Nam and Li, 2002Go; Chinchilla et al., 2007Go). These studies suggested genetic redundancy with other members of the SERK family.

To determine the level of redundancy within the SERK family, here we report the different roles of the SERK proteins, alone or in combination with other members, using a genetic and molecular approach. The results show that only SERK1 functions together with SERK3 in BRI1-mediated BR signaling. No other SERK combinations serve the BR-dependent pathway in our assays. In contrast, only the serk4 mutant allele enhances the susceptibility to bacterial pathogens of serk3 plants. Furthermore, we also provide evidence that the specificity of the SERK-mediated pathways can be largely ascribed to their biochemical function rather than the corresponding gene expression pattern. Hence, the SERK proteins have evolved to serve as coreceptors in multiple signaling pathways through hetero-oligomerization with different receptors.

In animals, signaling pathways exist as networks of interacting receptors of the same or different type (Citri and Yarden, 2006Go). The existence of similar receptor networks is proposed for plant RLKs as well (Dievart et al., 2003Go; Godiard et al., 2003Go; Shpak et al., 2003Go). We propose that, like in animal systems, specialization and redundancy of the SERK gene family members is at the core of a signaling network that provides signaling diversity together with robustness.


    RESULTS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

SERK1 and SERK3 (BAK1) Mediate BR Responses

Except for serk3 (bak1), none of the serk single knockout mutants shows a morphological phenotype. The mutant alleles used are presented in Supplemental Figure S1 for the serk1 alleles and Supplemental Figure S2 for the serk2, serk3, serk4, and serk5 alleles.

serk3 displays some of the characteristic bri1 mutant phenotypes, such as semidwarfism, reduction in hypocotyl and root length, and reduced BR sensitivity (Li et al., 2002Go; Nam and Li, 2002Go). However, all these phenotypes are weaker than those reported for bri1 mutants. This suggests that other members of the SERK family have an overlapping function with SERK3 in BR signaling. Therefore, double mutants between serk3 and the other serk mutants were generated and scored for enhancement of the three serk3-1 BR-related phenotypes, rosette growth, reduced hypocotyl length, and reduced sensitivity of the roots to brassinolide (BL) application. Only for the serk3-1 serk4-1 double mutant, we recorded additional reduction of the rosette size and increased dwarfism as compared to serk3-1 (Supplemental Fig. S3). In double-mutant combinations of serk3-1 with the serk1-1 or serk1-3 alleles, significant modification of the hypocotyl length of the serk3-1 mutant was observed (Fig. 1B ; {chi}2: P ≤ 1.27e–08 and {chi}2: P ≤ 1.17e–15, respectively; Supplemental Table S2A). In none of the other double-mutant combinations, a similar effect on hypocotyl length was observed (Fig. 1B; Supplemental Table S2A). In the root growth inhibition assay, only the single mutant serk3-1 shows reduced sensitivity to BL (Supplemental Table S1). In double-mutant combinations, only the serk1 alleles serk1-1 and serk1-3 enhance the serk3-1 BR insensitivity in roots (Fig. 1A).


Figure 1
View larger version (44K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Phenotypic analyses of the multiple serk mutants. A and C, Root growth measurements of seedlings grown on medium containing different BL concentrations using various double-mutant combinations (A) or multiple mutant combinations (C). Each measurement is represented as a percentage of the root elongation of the control plants grown on medium containing the same volume of 80% (v/v) ethanol used to dilute BL. B and D, Quantitative analysis of the hypocotyl length of various double-mutant combinations (B) and multiple serk mutant combinations (D) grown in the dark for 5 d. Each measurement represents an average of hypocotyl lengths of 20 seedlings. Error bars indicate SD. E, RT-PCR analysis to evaluate the feedback regulation of the CPD gene in the different double-mutant backgrounds after treatment with different concentrations of BL. The constitutively expressed cyclophilin gene ROC5 (Chou and Gasser, 1997Go) was used as control. *, Significant differences from Col-0 wild type (P ≤ 0.05); **, significant differences from the serk3-1 mutant (P ≤ 0.05); s1-1, serk1-1 allele; s1-3, serk1-3; s2, serk2-2; s3, serk3-1; s4, serk4-1; s5, serk5-1; H, heterozygote. [See online article for color version of this figure.]

 
To further confirm that only SERK1 and SERK3 are involved in BR signaling, the CPD molecular marker was used. It was previously shown that the expression of CPD, involved in BR biosynthesis, is down-regulated by BL treatment (Tanaka et al., 2005Go). Hence, the expression level of CPD can be used as an indicator of BL perception. A significant decrease of expression of CPD can be observed in wild-type plants treated with 100 nM BL as well as in untreated bes1-D plants. bes1-D is a constitutive inducer of the BRI1-dependent pathway. As expected, a decrease in expression of CPD is not detected in serk3 mutants after treatment with 10 or 100 nM of BL (Fig. 1E). In double mutants of serk3-1 with either serk1-1 allele or serk1-3 allele, this effect is further enhanced, suggesting an increased insensitivity to BL. No further increase of CPD expression is detected in double mutants between serk3-1 and other serk alleles after BL treatment (Fig. 1E).

Given the high sequence similarity between the different SERK members, we cannot discard the hypothesis that SERK2, SERK4, and SERK5 might be functionally redundant, thereby masking a synergistic effect with SERK3. Therefore, higher order mutants were generated. Triple and quadruple mutants were tested in the hypocotyl and the root growth inhibition assay as described above. Our data show that introduction of additional mutant alleles of serk2, serk4, and/or serk5 in the serk1-1 serk3-1 background does not confer higher BR insensitivity in the root (Fig. 1C) or in the hypocotyl (Fig. 1D; i.e. serk1 serk3 double mutants show the highest BR insensitivity).

To summarize, of all the mutant combinations tested, only serk1 and serk3 show synergy in the decrease of sensitivity to endogenous or exogenously applied BRs. Introduction of additional serk2, serk4, and/or serk5 mutant alleles in the serk1-1 serk3-1 background does not further enhance the phenotype of the serk1-1 serk3-1 double mutant. These data suggest that, from the five closely related SERK family members, only SERK1 and SERK3 have an overlapping function in BR signaling in roots and hypocotyls.


serk3 serk4 Dwarf Stature and serk1 serk2 Male Sterility Are Not BR Related

BR biosynthetic or perception mutants share morphological and physiological changes that include reduced stature, rounded leaves, shortened hypocotyls and roots, and decreased sensitivity to BRs. The double mutant serk3-1 serk4-1 displays severely altered architecture, loss of apical dominance, stunted and dwarfed stature, reduced organ size, and early flowering (Supplemental Fig. S4A). The phenotype of the double mutant could be rescued by either SERK3 or SERK4 under control of their own respective promoter (data not shown), thus confirming that the observed phenotype is caused by the T-DNA insertions in the SERK3 and SERK4 genes. Although showing a severe defect in growth and architecture, the observed phenotype does not resemble any of the known and described bri1 mutant alleles (Supplemental Fig. S4B). Neither a reduction of the hypocotyl length nor an increase in root BR insensitivity was noted in the serk3-1 serk4-1 double mutant as compared to serk3-1 (Fig. 1, A and B). To further confirm that the observed phenotype does not relate to the BRI1-dependent pathway, we attempted to rescue the serk3-1 serk4-1 by overexpressing the gain-of-function mutant gene bes1-D. BES1 encodes a nuclear-localized protein and is essential for the transcription of BRI1 target genes (Yin et al., 2002Go). The bes1-D mutant allele was identified in a suppressor screen aimed at rescuing the weak mutant bri1-119. The mutant bes1-D gene fused to GFP and driven by the 35S promoter was shown to rescue bri1 mutant phenotypes (Yin et al., 2002Go). This construct was introduced in the serk3 serk4 double mutant and the serk1 serk2 serk3 triple mutant. The transgenic plants show curled leaves, a typical feature of bes1-D-overexpressing plants (Fig. 2A ). Expression of the transgene was further confirmed by confocal microscopy and western-blot analysis (Fig. 2, C and D). The serk3 BR-related phenotypes are successfully rescued in the transgenic lines generated in the serk3 serk4 double mutant and the serk1 serk2 serk3 triple mutant, as shown based on the root and hypocotyl assay (Fig. 2, E and F). However, in these same transgenic lines, showing rescue of the serk3 mutant phenotype and the typical curly leaves of bes1-D overexpressing lines, bes1-D does not rescue the serk1 serk2 anther phenotype nor the serk3 serk4 growth phenotype (data not shown; Fig. 2A).


Figure 2
View larger version (94K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. 35S:bes1-D rescues the serk1-1 serk3-1 phenotype, but fails to rescue the serk1-1 serk2-2 and serk3-1 serk4-1 phenotypes. A, The serk3-1 serk4-1 phenotype is not rescued by the 35S:bes1-D construct. B, Roots of transgenic plants transformed with the 35S:bes1-D-GFP fusion are visualized by confocal microscopy. C, Western analysis of the serk3-1 serk4-1 double mutant transformed with the 35S:bes1-D-GFP constructs (1) as compared to the serk3-1 serk4-1 double mutant (2). D, serk1-1 serk2-2 anther showing no pollen grain and bri1-201 anther showing pollen grain. E, Quantitative analysis of the hypocotyl length of serk3-1 serk4-1 double mutants transformed with the 35S:bes1-D-GFP, serk3-1, and Col-0 wild-type plants grown in the dark for 5 d. Each measurement represents an average of hypocotyl lengths of 20 seedlings. Error bars indicate SD. F, Root growth measurements of seedlings grown on medium containing different BL concentrations. Each measurement is calculated as a percentage of the root elongation of the control plants grown on medium containing the same volume of 80% (v/v) ethanol used to dilute BL. *, Significant differences from Col-0 wild type (P ≤ 0.05); s1, serk1-1 allele; s3, serk3-1; s4, serk4-1; kd, kilodalton. [See online article for color version of this figure.]

 
In contrast to the serk1 serk2 double mutant of which the anthers do not produce any pollen (Supplemental Fig. S1B; Albrecht et al., 2005Go), the strong bri1-201 mutant, which is also male sterile, does produce pollen (Fig. 2D).

Taken together, we conclude that the serk1 serk2 male sterility phenotype and the serk3 serk4 dwarf phenotype are not dependent on BRI1-mediated BR signaling.


SERK3 and SERK4 Are Partially Redundant in Pathogen-Induced Cell Death Control

Plants lacking full-length transcripts of SERK3 show a significantly enhanced cell death phenotype after pathogen treatment, which cannot be determined in serk4-1 single knockout lines (Fig. 3 ; Kemmerling et al., 2007Go). In double mutants of both genes, the plants look dwarfed (Fig. 2A), show spontaneous cell death, and seedling lethality (He et al., 2007Go). A combination of weaker alleles of both genes as used here is not seedling lethal anymore, but growth is more reduced (Supplemental Fig. S4A) and pathogen-induced cell death is much more severe than in the serk3-1 parental lines (Fig. 3). serk4-1 single mutants do not show any effect on growth or cell death control nor do single serk1, serk2, and serk5 mutants. None of the double or triple mutants of these genes show any additional effect on growth or cell death responses compared to the serk3-1 single or serk3-1 serk4-1 double mutants, respectively. Taking these results together, we therefore conclude that, in addition to SERK3, SERK4 also exhibits a previously unrecognized effect in plant cell death control after pathogen treatment. However, SERK3 and SERK4 are only partially redundant because serk3-1 single mutants already show the pathogen-related phenotype (Fig. 3).


Figure 3
View larger version (47K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. SERK3 and SERK4 are partially redundant in cell death control, but not SERK1, SERK2, and SERK5. A, Infection phenotypes of representative Col-0 wild type and various single and double serk mutants at 7 DAI with A. brassicicola. B, Quantitative analysis of the growth of A. brassicicola in wild-type Col-0 and various single and double serk mutants. Results represent means ± SD (n ≥ 8). *, Significant differences from Col-0 wild type (P ≤ 0.05). [See online article for color version of this figure.]

 

SERK Overexpression Only Rescues the Rosette Phenotype of bri1 Mutants

To further evaluate the role of the SERK genes in BR signaling, we used an overexpression approach. Overexpression of SERK3/BAK1 was shown to suppress a weak bri1 allele, bri1-5 (Li et al., 2002Go). To independently test whether other SERK genes shared this property, we tested whether SERK1, SERK2, and SERK4 overexpression could rescue the bri1-301 phenotype. Overexpression of the transgenes was confirmed by western-blot analysis (Fig. 4B ). The resulting transgenic lines were tested for rescue of the rosette, root, and hypocotyl phenotypes. In all the SERK overexpression lines, the bri1-301 rosette phenotype is rescued (Fig. 4A). However, none of the transgenic lines is able to rescue the bri1-301 hypocotyl (Fig. 4C) and root phenotypes (Fig. 4D; Supplemental Fig. S5, A and B). Because SERK5 was reported by He et al. (2007)Go to not rescue the rosette phenotype, we did not include the overexpression of SERK5 in that set of experiments. We could not discard the possibility that these results are linked to the different bri1 alleles used here because previous results were obtained with the bri1-5 allele (Li et al., 2002Go). Therefore, the brs1-1D mutant was analyzed to provide independent evidence. The brs1-1D locus was identified following activation tagging of the weak bri1-5 allele (Li et al., 2001Go). Whereas rescue of the rosette phenotype was observed (Li et al., 2001Go), no rescue of the root phenotype was recorded in those lines (Supplemental Fig. S5C). These data confirm that a different requirement for BL signaling exists in the rosette when compared to hypocotyl and root.


Figure 4
View larger version (67K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. SERK overexpression only partially rescues the weak allele bri1-301. A, Overexpression of SERK genes partially suppresses the rosette phenotype of the weak bri1-301 mutation. B, Western analysis to confirm the elevated expression of SERK proteins in the transgenic lines. C, Quantitative analysis of the hypocotyl length of plants overexpressing SERK proteins, bri1-301 mutant, and Col-0 wild-type plants grown in the dark for 5 d. Each measurement represents an average of hypocotyl lengths of 20 seedlings. Error bars indicate SD. D, Root growth measurements of plants grown on medium containing different BL concentrations. Mq, Molecular size marker in daltons (da); P1, P2, and P4, SERK1, SERK2, and SERK4 promoters, respectively; 35S, 35S promoter; wt, wild type. [See online article for color version of this figure.]

 

SERK Genes Are Divergent Paralogs

The different double serk mutant combinations revealed specific pathways (serk1 serk2, serk1 serk3, and serk3 serk4) and suggest that the SERK genes are either differentially expressed or are not functional paralogs of one another. The expression pattern of the different SERK genes was therefore analyzed. Semiquantitative reverse transcription (RT)-PCR analysis and localization studies using fusion proteins of the different members indicate that the different SERK members are expressed in all tissues during development and share a largely overlapping pattern of expression (data not shown). To further confirm that the observed phenotypic differences within the double mutants are not due to subtle differences in expression pattern of the SERK members, we used a transgenic approach. We aimed at rescuing the serk1 serk2 anther phenotype by expressing the SERK1 and SERK2 genes under control of the SERK3 promoter. The serk1 serk2 anther phenotype is rescued by the SERK1 and SERK2 genes driven by the SERK3 promoter (Supplemental Fig. S6, A and C). However, SERK3 under the control of the SERK3 promoter does not rescue the anther phenotype (Supplemental Fig. S6, B and D). Hence, subtle differences in the expression pattern of these SERK genes fail to explain the specific pathways observed within the double-mutant combinations. Similarly, the SERK2 gene driven by the SERK3 promoter, while rescuing the anther phenotype, cannot rescue the root insensitivity of the serk1 serk3 double mutant (Supplemental Fig. S6E). This suggests that the SERK1 and SERK2 proteins are not interchangeable with the SERK3 or SERK4 proteins. Consequently, the respective genes are divergent paralogs.


    DISCUSSION
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Gene duplication is a common phenomenon and has been a key factor in the diversification of plants and animals. The high redundancy level detected in the Arabidopsis genome favors the evolution of new signaling pathways. Only a fraction of those genes have been assigned a function through the characterization of mutant alleles. Due to gene redundancy, this approach remains limited because most of the loss-of-function mutants do not show a phenotype. The SERK gene family appears to be a classic example of redundancy between the SERK gene members because no phenotypes were recorded for the single loss-of-function mutants, except for serk3/bak1 (Li et al., 2002Go; Nam and Li, 2002Go; Kemmerling et al., 2007Go). We used a systematic genetic approach to analyze the function of the SERK genes by generating double, triple, and quadruple mutants. Because serk3/bak1 is involved in BRI signaling and cell death control, the generated double, triple, and quadruple mutants were systematically analyzed for their BR-related phenotypes and their response to pathogen treatment. The phenotypes and the physiological responses observed do not support the hypothesis that all SERK genes are redundant and involved in BRI1 signaling and/or pathogen response. Our data suggest that, of the Arabidopsis SERK family, only SERK1 and SERK3 participate in BRI1-mediated signaling in Arabidopsis roots and hypocotyls. To further support those data, we also used an alternative approach. The gain-of-function construct bes1-D was used to complement the observed serk double-mutant phenotypes. In agreement with the phenotypic and physiological observations, only the hypocotyl and root BL sensitivity phenotype of the serk1 serk3 double mutant could be rescued by this construct.

Triple and quadruple serk mutants only show additive phenotypes, suggesting that the different SERKs have no further redundancy besides the ones revealed by the double-mutant phenotypes. The strong bri1 phenotypes cannot be phenocopied by creating a quadruple mutant, suggesting that genes other than SERKs play a role in BRI1-mediated BL signaling. SERK5 is unlikely to perform this function because higher order mutants, containing the serk5 mutation, do not show additional phenotypes. Furthermore, it was shown that serk5 contains a mutation that inactivates SERK5 kinase activity (He et al., 2007Go). None of the double or triple serk mutants show any additional effect on cell death responses compared to the serk3 singles or serk3-1 serk4-1 double mutants, respectively.

It was shown previously that SERK4 overexpression in weak bri1-5 mutants rescued the rosette phenotype, suggesting that SERK4 mediates BR signaling (He et al., 2007Go). To confirm this, the SERK genes were overexpressed, using the 35S promoter, and introduced in weak bri1-301 mutant plants. In all cases, SERK overexpression was able to rescue the rosette phenotype of the bri1-301 mutant, but not the root and hypocotyl phenotypes, suggesting a difference in requirement for the different BR-related phenotypes. These data indicate that, although not redundant in the BRI1 pathway, SERK genes might have preserved a shared function that allows the rescue of some aspect of the bri1 phenotypes. These data are in line with those reported by He et al. (2007)Go, who further showed coimmunoprecipitation of SERK4/BKK1 with BRI1 in plants overexpressing both genes. However, the reported phenotypes and physiological observations are not related to any bri1-mediated aspect. Therefore, it remains to be determined whether this shared function operates in wild-type plants or whether it is caused by ectopic or overexpression of the SERK genes. The serk3 allele used in this study is a weaker variant than the one used previously and this allowed us to demonstrate that the SERK4 gene is partially redundant with SERK3 in mediating a pathogen-induced response as reported by Kemmerling et al. (2007)Go. However, we have not been able to observe the strong early seedling lethality phenotype reported previously for the same allele in the serk3 serk4 double mutant (He et al., 2007Go).

In principle, gene duplication creates functionally identical copies that are fully redundant. Our data indicate that the SERK genes, although partially redundant, are involved in different signaling pathways (i.e. SERK1 and SERK3 act synergistically in BR signaling, SERK2 acts redundantly with SERK1 in male sporogenesis [Albrecht et al., 2005Go; Colcombet et al., 2005Go], and SERK4 redundantly with SERK3 in cell death control [He et al., 2007Go]). Hence, we observed that the SERK genes have evolved to perform different functions. Acquisition of novel gene function can occur either by alteration of protein function, due to amino acid substitution, or gene expression pattern. SERK3 is unable to substitute for SERK1 or SERK2 activity in the anther, when driven by the SERK1 or SERK2 promoter, which indicates that the protein itself confers specificity. This suggests that the specificity for ligands may be altered or that different downstream targets are activated. So far, no ligand has been identified for the SERK receptors and they are thought to be non-ligand-binding coreceptors. Coreceptors are fully functional through the formation of hetero-oligomeric complexes and are capable of generating potent cellular signals. SERK3 heterodimerizes with at least two different main receptors, BRI1 and FLS2 (Li et al., 2002Go; Nam and Li, 2002Go; Russinova et al., 2004Go; Chinchilla et al., 2007Go), whereas a function in cell death suggests the involvement of a third as-yet unidentified ligand-binding receptor (He et al., 2007Go; Kemmerling et al., 2007Go). SERK1 also heterodimerizes with BRI1 and SERK3. Independent of its role in BL signaling, SERK1, together with SERK2, activates targets involved in tapetum formation that cannot be activated by SERK3. Likewise, SERK3 is involved in cell death and innate immunity, whereas SERK1 and SERK2 are not involved in these processes. This situation is reminiscent of that described for the mammalian ERBB (erythroblastosis oncogene B) receptors. The system has evolved from a simple cascade with a single ortholog of ERBB in nematodes into a highly interconnected network in mammals through the duplication of genes encoding ligands and receptors (Citri and Yarden, 2006Go). Following gene duplication, partial inactivation due to mutations abolished the autonomy of two of the four receptors; ERBB2 lacks the capacity to bind ligands and ERBB3 is defective in kinase activity. This led to the transformation of a linear system of four receptors into a complex network where ERBB2 functions as the preferred heterodimeric partner of the other ERBB members and where ERBB3 needs to heterodimerize to be functional. At the core of such an interconnected network, autonomous dimer receptor modules function as essential signaling units that integrate diverse signals and activate a variety of downstream effectors. Along with its modular properties, the ERBB network displays redundancy that contributes to the robustness of that signaling system (Citri and Yarden, 2006Go).

Hetero-oligomerization of RLKs is essential in the activation of plant signaling cascades (e.g. Li et al., 2002Go; Wang et al., 2005Go). Our results support that hypothesis and show that the SERK receptors contribute to a network that controls the activation of multiple and partially independent pathways (Fig. 5 ). Based on our previously reported size estimate of the BRI1/SERK1/SERK3 receptor complex of 350 to 450 kD (Karlova et al., 2006Go), together with the observation that the BRI1 receptors can indeed homodimerize (Russinova et al., 2004Go), we proposed that a heterotetrameric receptor complex of two ligand-binding receptors and two coreceptors is a plausible configuration. This configuration would predict that no further enhancement of a particular phenotype would be possible upon removal of other members of the family of coreceptors than the ones present in either homodimeric or heterodimeric combination. Different specificities could then be attributed to a specific combination of main and coreceptors, in line with the results presented here. Understanding how the SERK genes are being recruited within the different receptor networks will help to understand how specificity of signaling using LRR-RLKs is being established in plant cells.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. SERK genes are involved in several independent pathways. Model of pathways involving the five SERK genes (SERK1SERK5) containing five LRRs (stripes) and one SPP (red square) domain as defined by Hecht et al. (2001)Go. Shown are: BR pathway involving BRI1, SERK1, and SERK3 (Li et al., 2002Go; Nam and Li, 2002Go; Karlova et al., 2006Go); FLS2 pathway involving SERK3 essential to innate immunity (Chinchilla et al., 2007Go); pathway involving likely EMS1/EXS (Canales et al., 2002Go; Zhao et al., 2002Go), TPD1 (Yang et al., 2003Go), and SERK1 and SERK2 mediating male sporogenesis (Albrecht et al., 2005Go; Colcombet et al., 2005Go; C. Albrecht and S.C. de Vries, unpublished data); and pathway involving SERK3, SERK4, and probably an unidentified RLK leading to cell death control (He et al., 2007Go; Heese et al., 2007Go; Kemmerling et al., 2007Go). [See online article for color version of this figure.]

 

    MATERIALS AND METHODS
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 

Plant Growth Conditions

Arabidopsis (Arabidopsis thaliana) plants (ecotype Columbia [Col-0]) were used as the wild type. Seeds were surface sterilized and germinated on 0.5x Murashige and Skoog medium (Duchefa) supplemented with 1% Suc. Plants were grown at 22°C under fluorescent light, with 16-h-light/8-h-dark photoperiods, unless otherwise specified. Transgenic seedlings were selected on 0.5x Murashige and Skoog medium containing either 50 mg/L kanamycin, 15 mg/L phosphinothricin, or 11.25 mg/L sulfadiazin. The serk1-3 allele (line 448E10) was obtained from the GABI-KAT collection at the Max Planck Institute (Rosso et al., 2000Go). The serk1-1 (SALK_044330), serk3-1 (SALK_034523) or bak1-3 (Russinova et al., 2004Go; Kemmerling et al., 2007Go), serk4-1 (SALK_057955) or bkk1-1 (He et al., 2007Go), and serk5-1 (SALK_147275) alleles were obtained from the Signal Collection at the Salk Institute (Alonso et al., 2003Go). The serk2-2 T-DNA-tagged allele was identified in the Syngenta Arabidopsis Insertion Library (SAIL) lines, nonredundant 119-G03. The genotyping for single and double mutants was performed by PCR reactions using primer combinations for the serk1-3 allele, GK_S1F (AGCAATTTTGTTTTGCAGAAAAGT)/GK_LB1 (CCCATTTGGACGTGAATGTAGACAC) and GK_S1F/S3 (AGAGATATTCTGGAGCGATGTGACCGATGG); the serk1-1 allele, V3 (CGTGACAACAGCAGTCCGTGGCACCATCGG)/TgR1 (TGTTGCCGGTCTTGCGATGATTAT) and V3/KinR1 (TTTTTGCCATTCGTCCCATTTC); the serk2-2 allele, F23M9_ZF (GTGTACTTGGTTTCACGTAACG)/LB1 (GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC) and F23M9_ZF/GSP1 (CGGCTAGTAACTGGGCCGCATAGATCC); and for the serk3-1 allele, F17M5_ZF (GCACTGAAAAACAGTTTAGC)/LBb1 (GCGTGGACCGCTTGCTGCAACT) and F17M5_ZF/S3E6R (GATGCAGGAAGGGGAGTCAACTTGGTG) to amplify the T-DNA-tagged and the wild-type alleles, respectively. For the serk4-1 allele, the following primers were used: IF (CTGAAGAAGACCCAGAGG)/sk4-R3 (GGAGTTGATATTCAAAAGTGCATGGG) and IF/LBb1 (GCGTGGACCGCTTGCTGCAACT), and for the serk5-1 allele, IF-sk5R1 (GCTTAATGGAAGTGGAGAGA) and IF/LBb1 (GCGTGGACCGCTTGCTGCAACT) to amplify the wild-type and the T-DNA-tagged alleles, respectively. The bri1-301 allele was obtained from Jianming Li (University of Michigan) and genotyped by PCR amplification of a product of 0.55 kb using primers Bri1-301_F (CATCGAAATCTTGTGCCTC)/Bri1-301_R (CCTTCATAAGCTCGGGGTC) followed by a restriction enzyme digest with MboI. The bri1-301 mutant allele contained no restriction site, whereas the BRI1 wild-type allele generated two fragments of 0.16 and 0.39 kb, respectively.

Alternaria brassicicola infections were performed as described (Kemmerling et al., 2007Go). Bonitation of the symptom development was monitored at 7 d after infection.


Expression Analyses

RNA isolation, cDNA synthesis, and RT-PCR were performed as described by Hecht et al. (2001)Go. For the detection of the SERK1 transcript in the serk1-3 mutant and wild-type background, cDNA synthesis was performed using random hexamer and oligo(dT) primers (Amersham Biosciences). PCR products were collected after 21, 23, 25, and 27 cycles for the constitutively expressed cyclophilin gene ROC5 and 28, 30, 32, and 34 cycles for the SERK1 gene. The PCR reaction was performed using primer combinations ROC5-5/ROC5-3 to amplify ROC5 and either V1 (TTGGAAATCTGACAAACTTAGTGAGTTTGG)/S2 (TCGTCGCCACCAAGCAAAGGCTATTGCAGG) or V2 (GCTGCTCCTGCAATAGCCTTTGCTTGGTGG)/S3 (AGAGATATTCTGGAGCGATGTGACCGATGG) to amplify SERK1 (Hecht et al., 2001Go).

For the detection of the CPD transcripts, cDNA synthesis was performed by using oligo(dT) primers and PCR amplification with CPD-f (ATGGCCTTCACCGCTTTTCTCCTC) and CPD-r (TCAAGTAGCAAAATCACGGCGCTT) primer combinations. PCR products were collected after 28 cycles. ATA7 transcripts were analyzed as described by Albrecht et al. (2005)Go.


Hypocotyl and Root Growth Assays

Freshly harvested seeds were surface sterilized and placed on either 0.5x Murashige and Skoog plates without hormones or 0.5x Murashige and Skoog plates containing different concentrations of BL (Sigma) or 2 µM brassinazole (Brz220; Tokyo Chemical Industry). The plates were kept at 4°C for 2 d and then placed at 22°C either in dark or grown under 16-h-light/8-h-dark photoperiods. The hypocotyl length with and without brassinazole was measured after 5-d incubation in dark and the root length with and without BRs was determined after 7 d of growth in light. Every experiment was performed in duplicate and repeated twice.


Microscopy and Histological Analysis

For the anther structure study, inflorescences of the serk1-3 and serk1-3 serk2-2 mutants were fixed in 5% (w/v) glutaraldehyde in 25 mM sodium phosphate, pH 7.4, dehydrated in ethanol series to 95% (v/v), and embedded in Technovit 7100 (EBSciences) according to the recommendations of the manufacturer. Seven-micrometer sections were stained with 0.25% (w/v) Toluidine Blue.


Gene Cloning and Arabidopsis Transformation

The entire open reading frames of SERK1, SERK2, SERK3, and SERK4 cDNAs were amplified by RT-PCR from Col-0. The forward and reverse primers were engineered with an NcoI site to replace the SERK1 and SERK2 stop codons and allow an in-frame fusion with yellow fluorescent protein (YFP). The primers used were S1-NcoF and S1-NcoR for the SERK1 cDNA, S2-NcoF and S2-NcoR for the SERK2, S3-NcoF and S3-NcoR for the SERK3, and S4-NcoF and S4-NcoR for the SERK4 cDNA.

To prepare the SERK1, SERK2, SERK3, and SERK4 promoter constructs, a 2-kb region upstream of the start codons of the SERK1, SERK2, SERK3, and SERK4 genes was amplified from Col genomic DNA and cloned in the PGEM-T vector (Promega). The primers used were P1F and P1-NcoR for the SERK1 promoter, P2F and P2-NcoR for the SERK2 promoter, P3F and P3-NcoR for the SERK3 promoter, and P4F and P4-NcoR for the SERK4 promoter. The PGEM-T cloned promoters were inserted via SalI-NcoI in a modified pBluescript vector containing the YFP gene inserted as NcoI-BamH1 fragment in front of the Tnos terminator. The entire open reading frames of SERK1 and SERK2 as described above were then inserted as NcoI fragments. The resulting full cassettes were then subcloned into a modified pFluar vector via SalI-SmaI (Stuitje et al., 2003Go). These constructs will be further referred to as PSERK1:SERK1-YFP, PSERK2:SERK2-YFP, PSERK3:SERK3-YFP, and PSERK4:SERK4-YFP for the SERK1, SERK2, SERK3, and SERK4 transgenes, respectively.

The different SERK cDNAs were also cloned into the NcoI site of a modified pBluescript vector carrying the 35S promoter driving the YFP fluorophore. The resulting full cassettes were then subcloned into the binary vector as previously described. These constructs will be further referred to as 35S:SERK1-YFP, 35S:SERK2-YFP, and 35S:SERK4-YFP.

These constructs were verified by sequencing and were electroporated in Agrobacterium tumefaciens strain C58C1 containing a disarmed C58 Ti plasmid (Koncz et al., 1989Go). The constructs were transformed into the different mutant backgrounds by the floral-dip method (Clough and Bent 1998Go).


Protein Extraction and Western Analysis

Protein extraction was performed as described by Karlova et al. (2006)Go. The proteins were separated with 10% SDS-PAGE. GFP antibodies and western analysis procedures were as previously described (Karlova et al., 2006Go).


Fluorescence Microscopy

Anthers and root apices from transgenic plants harboring the 35S:bes-1D-GFP construct were used for confocal analyses. Transgenic roots were analyzed using a Zeiss confocal microscope (Zeiss Axiovert 100M equipped with a LSM510, argon laser with a 488-nm laser line). The settings for the GFP were as follows: 488-nm laser -> HFT488/543 -> sample -> HFT488/543 -> mirror -> NFT545 -> BP505-550 -> detector. Autofluorescence spectral bleed-through was assessed by imaging at the same time with the YFP/GFP channel, a channel that detects red fluorescence: 514-nm laser -> HFT458/514 -> sample -> NFT635vis -> LP650 -> detector. Pinhole was adjusted for each channel in such a way that Z resolution is equal (typically 2 µm). Amplifier gain for YFP/GFP and autofluorescence/spectral bleed-through channels is always the same between experiments.


Accession Numbers

The serk1-3 allele (line 448E10) was obtained from the GABI-KAT collection at the Max Planck Institute (Rosso et al., 2000Go). The serk1-1 (SALK_044330), serk3-1 (SALK_034523) or bak1-3 (Russinova et al., 2004Go; Kemmerling et al., 2007Go), serk4-1 (SALK_057955) or bkk1-1 (He et al., 2007Go), and serk5-1 (SALK_147275) alleles were obtained from the Signal Collection at the Salk Institute (Alonso et al., 2003Go). The serk2-2 T-DNA-tagged allele was identified in the SAIL lines, nonredundant 119-G03.


Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Identification of the serk1-3 allele.
Supplemental Figure S2. T-DNA insertion sites of single knockout lines.
Supplemental Figure S3. Growth phenotype of the different double and triple serk mutants.
Supplemental Figure S4. serk3-1 serk4-1 double-mutant phenotype.
Supplemental Figure S5. Comparison of the root morphology of wild type, bri1-5, and bri1-5 brs1-D double mutant when grown on BL.
Supplemental Figure S6. SERK genes are divergent paralogs.


    ACKNOWLEDGMENTS
 
We thank Jianming Li (University of Michigan) for providing us with bri1-301 seeds and Joanne Chory (The Salk Institute) for supplying us with the PBRI1-BRI1-GFP seeds and the 35S:bes1-D binary construct. We are grateful to the Arabidopsis Biological Resource Center for providing us with Arabidopsis seeds.

Received May 22, 2008; accepted July 22, 2008; published July 30, 2008.


    FOOTNOTES
 
1 This work was supported by the European Union (EU) Biotechnology program (grant no. ERBIO4–CT96–0689), the EU Quality of Life and Management of Living Resources program (grant no. QLG2–2000–00602), and Wageningen University, Department of Agrotechnology and Food Sciences (to E.R., M.K., and S.C.d.V.). Back

2 These authors contributed equally to the article. Back

3 Present address: VIB Department of Plant Systems Biology, Ghent University, Technologiepark 927, 9052 Ghent, Belgium. Back

4 Present address: Max Planck Institute for Plant Breeding Research, Department for Plant-Microbe Interactions, Carl van Linne weg 10, 50829 Cologne, Germany. Back

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Catherine Albrecht (catherine.albrecht{at}wur.nl).

[C] Some figures in this article are displayed in color online but in black and white in the print edition. Back

[W] The online version of this article contains Web-only data. Back

www.plantphysiol.org/cgi/doi/10.1104/pp.108.123216

* Corresponding author; e-mail catherine.albrecht{at}wur.nl.


    LITERATURE CITED
 TOP
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 LITERATURE CITED
 
Albrecht C, Russinova E, Hecht V, Baaijens E, de Vries SC (2005) The Arabidopsis thaliana SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASES1 and 2 control male sporogenesis. Plant Cell 17: 3337–3349[Abstract/Free Full Text]

Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657[Abstract/Free Full Text]

Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796–815[CrossRef][Web of Science][Medline]

Canales C, Bhatt AM, Scott R, Dickinson H (2002) EXS, a putative LRR receptor kinase, regulates male germline cell number and tapetal identity and promotes seed development in Arabidopsis. Curr Biol 12: 1718–1727[CrossRef][Web of Science][Medline]

Chinchilla D, Zipfel C, Robatzek S, Kemmerling B, Nürnberger T, Jones JD, Felix G, Boller T (2007) A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 26: 497–500[CrossRef][Web of Science]

Chou IT, Gasser CS (1997) Characterization of the cyclophilin gene family of Arabidopsis thaliana and phylogenetic analysis of known cyclophilin proteins. Plant Mol Biol 35: 873–892[CrossRef][Web of Science][Medline]

Citri A, Yarden Y (2006) EGF-ERBB signaling: towards the systems level. Nat Rev Mol Cell Biol 7: 505–516[CrossRef][Web of Science][Medline]

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation in Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline]

Colcombet J, Boisson-Dernier A, Ros-Palau R, Vera CE, Schroeder JI (2005) Arabidopsis SOMATIC EMBRYOGENEIS RECEPTOR KINASES1 and 2 are essential for tapetum development and microspore maturation. Plant Cell 17: 3350–3361[Abstract/Free Full Text]

Dievart A, Dalal M, Tax FE, Lacey AD, Hutty A, Li J, Clark S (2003) CLAVATA1 dominant-negative alleles reveal functional overlap between multiple receptor kinases that regulate meristem and organ development. Plant Cell 15: 1198–1211[Abstract/Free Full Text]

Godiard L, Sauviac L, Torri KU, Grenon O, Mangin B, Grimsley NH, Marco Y (2003) ERECTA, an LRR receptor-like kinase protein controlling development pleiotropically affects resistance to bacterial wilt. Plant J 36: 353–363[CrossRef][Web of Science][Medline]

He K, Gou X, Yuan T, Lin H, Asami T, Yoshida S, Russell SD, Li J (2007) BAK1 and BKK1 regulate brassinosteroid-dependent growth and brassinosteroid-independent cell-death pathways. Curr Biol 17: 1109–1115[CrossRef][Web of Science][Medline]

Hecht V, Velle-Calzada JP, Hartog MV, Schmidt EDL, Boutilier K, Grossniklaus U, de Vries SC (2001) The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASE 1 gene is expressed in developing ovules and embryos and enhances embryogenic competence in culture. Plant Physiol 127: 803–816[Abstract/Free Full Text]

Heese A, Hann DR, Gimenez-Ibanez S, Jones AM, He K, Li J, Schroeder JI, Peck SC, Rathjen JP (2007) The receptor-like kinase SERK3/BAK1 is a central regulator of innate immunity in plants. Proc Natl Acad Sci USA 104: 12217–12222[Abstract/Free Full Text]

Hink MA, Shah K, Russinova E, de Vries SC, Visser AJ (2008) Fluorescence fluctuation analysis of Arabidopsis thaliana Somatic Embryogenesis Receptor-like Kinase and Brassinosteroid Insensitive 1 receptor oligomerization. Biophys J 94: 1052–1062[CrossRef][Web of Science][Medline]

Karlova R, Boeren S, Russinova E, Aker J, Vervoort J, de Vries S (2006) The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE1 protein complex includes BRASSINOSTEROID-INSENSITIVE1. Plant Cell 18: 625–638

Kemmerling B, Schwedt A, Rodriguez P, Mazzotta S, Frank M, Qamar SA, Mengiste T, Betsuyaku S, Parker JE, Mussig C, et al (2007) The BRI1-associated kinase 1, BAK1, has a brassinolide-independent role in plant cell-death control. Curr Biol 17: 1116–1122[CrossRef][Web of Science][Medline]

Koncz C, Martini N, Mayerhofer R, Koncz-Kalman Z, Korber H, Redei JP, Schell J (1989) High-frequency T-DNA-mediated gene tagging in plants. Proc Natl Acad Sci USA 86: 8467–8471[Abstract/Free Full Text]

Li J, Lease KA, Tax FE, Walker JC (2001) BRS1, a serine carboxypeptidase, regulates BRI1 signaling in Arabidopsis thaliana. Proc Natl Acad Sci USA 98: 5916–5921[Abstract/Free Full Text]

Li J, Wen J, Lease KA, Doke JT, Tax FE, Walker JC (2002) BAK1, an Arabidopsis LRR receptor-like protein kinase, interacts with BRI1 and modulates brassinosteroid signaling. Cell 110: 213–222[CrossRef][Web of Science][Medline]

Nam KH, Li J (2002) BRI1/BAK1, a receptor kinase pair mediating brassinosteroid signaling. Cell 110: 203–212[CrossRef][Web of Science][Medline]

Rosso MG, Li Y, Strizhov N, Reiss B, Dekker K, Weisshaar B (2000) An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53: 247–259[CrossRef]

Russinova E, Borst JW, Kwaaitaal M, Yanhai Yin Y, Caño-Delgado A, Chory J, de Vries SC (2004) Heterodimerization and endocytosis of Arabidopsis brassinosteroid receptors BRI1 and AtSERK3 (BAK1). Plant Cell 16: 3216–3229[Abstract/Free Full Text]

Schmidt EDL, Guzzo F, Toonen MAJ, de Vries SC (1997) A leucine-rich receptor-like kinase marks somatic plant cells competent to form embryos. Development 124: 2049–2062[Abstract]

Shiu SH, Bleecker AB (2001) Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proc Natl Acad Sci USA 98: 10763–10768[Abstract/Free Full Text]

Shpak ED, Lakeman MB, Torii KU (2003) Dominant-negative receptor uncovers redundancy in the Arabidopsis ERCTA leucine-rich repeat receptor-like kinase signaling pathway that regulates organ shape. Plant Cell 15: 1095–1110[Abstract/Free Full Text]

Stuitje AR, Verbree EC, van der Linden KH, Mietkiewska EM, Nap JP, Kneppers TJA (2003) Seed-expressed fluorescent proteins as versatile tools for easy (co)transformation and high-throughput functional genomics in Arabidopsis. Plant Biotechnol J 1: 301–309[CrossRef][Medline]

Tanaka K, Asami T, Yoshida S, Nakamura Y, Matsuo T, Okamoto S (2005) Brassinosteroid homeostasis in Arabidopsis is ensured by feedback expressions of multiple genes involved in its metabolism. Plant Physiol 138: 1117–1125[Abstract/Free Full Text]

Wang X, Goshe MB, Soderblom EJ, Phinney BS, Kuchar JA, Li J, Asami T, Yoshida S, Huber SC, Clouse S (2005) Identification and functional analysis of in vivo phosphorylation sites of the Arabidopsis BRASSINOSTEROID-INSENSITIVE1 receptor kinase. Plant Cell 17: 1685–1703[Abstract/Free Full Text]

Yang SY, Xie LF, Mao HZ, Puah CP, Yang WC, Jiang L, Sundaresan V, Ye D (2003) TAPETUM DERTERMINANT1 is required for cell specialization in the Arabidopsis anther. Plant Cell 15: 2792–2804[Abstract/Free Full Text]

Yin Y, Wang ZY, Mora-Garcia S, Li J, Yoshida S, Asami T, Chory J (2002) BES1 accumulates in the nucleus in response to brassinosteroids to regulate gene expression and promote stem elongation. Cell 109: 181–191[CrossRef][Web of Science][Medline]

Zhao DZ, Wang GW, Speal B, Ma H (2002) The EXCESS MICROSPOROCYTES1 gene encodes a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fate in the Arabidopsis anther. Genes Dev 16: 2021–2031[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
J Exp BotHome page
K. E. Nolan, S. Kurdyukov, and R. J. Rose
Expression of the SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE1 (SERK1) gene is associated with developmental change in the life cycle of the model legume Medicago truncatula
J. Exp. Bot., April 1, 2009; 60(6): 1759 - 1771.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
148/1/611    most recent
pp.108.123216v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Albrecht, C.
Right arrow Articles by de Vries, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albrecht, C.
Right arrow Articles by de Vries, S. C.
Agricola
Right arrow Articles by Albrecht, C.
Right arrow Articles by de Vries, S. C.
Related Collections
Right arrow Membrane Trafficking


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ASPB Publications PLANT PHYSIOLOGY® THE PLANT CELL
Copyright © 2008 by the American Society of Plant Biologists