|
|
||||||||
|
First published online October 1, 2008; 10.1104/pp.108.128256 Plant Physiology 148:1295-1308 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Catalytic Key Amino Acids and UDP-Sugar Donor Specificity of a Plant Glucuronosyltransferase, UGT94B1: Molecular Modeling Substantiated by Site-Specific Mutagenesis and Biochemical Analyses1,[C],[OA]VKR Research Centre Pro-Active Plants, DK–1871 Frederiksberg C, Copenhagen, Denmark (S.A.O., S.B., C.E.O., B.L.M.); Plant Biochemistry Laboratory, Department of Plant Biology and Biotechnology (S.A.O., S.B., B.L.M.), and Department of Natural Sciences (C.E.O.), University of Copenhagen, DK–1871 Frederiksberg C, Copenhagen, Denmark; and Centre de Recherches sur les Macromolécules Végétales, CNRS, 38041 Grenoble cedex 09, France (A.I.)
The plant UDP-dependent glucosyltransferase (UGT) BpUGT94B1 catalyzes the synthesis of a glucuronosylated cyanidin-derived flavonoid in red daisy (Bellis perennis). The functional properties of BpUGT94B1 were investigated using protein modeling, site-directed mutagenesis, and analysis of the substrate specificity of isolated wild-type and mutated forms of BpUGT94B1. A single unique arginine residue (R25) positioned outside the conserved plant secondary product glycosyltransferase region was identified as crucial for the activity with UDP-glucuronic acid. The mutants R25S, R25G, and R25K all exhibited only 0.5% to 2.5% of wild-type activity with UDP-glucuronic acid, but showed a 3-fold increase in activity with UDP-glucose. The model of BpUGT94B1 also enabled identification of key residues in the acceptor pocket. The mutations N123A and D152A decreased the activity with cyanidin 3-O-glucoside to less than 15% of wild type. The wild-type enzyme activity toward delphinidin-3-O-glucoside was only 5% to 10% of the activity with cyanidin 3-O-glucoside. Independent point mutations of three residues positioned near the acceptor B ring were introduced to increase the activity toward delphinidin-3-O-glucoside. In all three mutant enzymes, the enzymatic activity toward both acceptors was reduced to less than 15% of wild type. The model of BpUGT94B1 allowed for correct identification of catalytically important residues, within as well as outside the plant secondary product glycosyltransferase motif, determining sugar donor and acceptor specificity.
Glycosylation of bioactive plant natural products (secondary metabolites), xenobiotics, and hormones provides a means to regulate their activity, to secure safe storage in specific cellular compartments, and to modulate their chemical properties, such as solubility and stability important for their in planta function (Jones and Vogt, 2001
Despite low primary sequence similarity, the secondary and tertiary structures of GTs are highly conserved. So far, the crystal structures available show that the GTs adopt one of two distinct folds, designated GT-A fold and GT-B fold, with an emerging third fold being identified as GT-A-like (http://www.cermav.cnrs.fr/glyco3d/). The GTs are currently divided into 91 families (http://www.cazy.org/fam/acc_GT.html) based on sequence identity scores (Campbell et al., 1997
New UGT sequences are obtained too fast to be accompanied by functional characterization (Coutinho et al., 2003
UGTs recognizing several different sugar donors have been identified. These include UDP-Glc, UDP-Gal, UDP-Xyl, UDP-Rha, and UDP-GlcUA. In plant UGTs, the most common sugar donor is UDP-Glc. Several conserved residues, most of which are found in the PSPG motif of plant UGTs, interact with the sugar donor (Shao et al., 2005
Functional characterization of a UGT requires time-demanding biochemical studies as well as the study of site-specific mutants. Knowledge derived from crystal structures is an important tool for the rational design of mutants for such biochemical studies. So far the crystal structures of 11 family 1 GTs have been solved. Ten are listed at http://www.cermav.cnrs.fr/glyco3d/ and the structure coordinates of all 11 are available at http://www.rcsb.org/pdb/home/home.do. These GTs all adopt the GT-B fold. Obtaining GT crystals has proven difficult (Breton et al., 2006
A plant UGT with affinity for the alternative sugar UDP-GlcUA (Fig. 1
) UGT94B1 has been identified in red daisy (Bellis perennis; Sawada et al., 2005
Homology Modeling of UGT94B1
Prediction of red daisy UGT94B1 sary structure identified 16 potential
The structural alignment (Fig. 2) was entered into the Composer function of the Sybyl protein modeling software and divided into 17 structurally conserved regions (SCRs) and 18 loops (Fig. 2). All 18 SCRs and 13 of the 18 loops were constructed using the coordinates of the MtUGT71G1 and VvGT1 crystal structures as templates. The missing loops were loops 1, 7, 9, 11, and 18. Loop 1 corresponds to the N-terminal end and loop 18 to the C terminus. Construction of loop 1 (residues 1–9), loop 7 (residues 156–162), and loop 11 (residues 232–242) was performed by search in the GT crystal structure database. Two loops were left out of the model. Loop 9 (residues 204–208) was left out because it could not be modeled without major energy constraints. The N-terminal loop 18 was also left out, as no acceptable template for this region was found.
The model was optimized by several steps of energy minimization of side chains and loop regions (Imberty et al., 2006
In vitro, BpUGT94B1 catalyzes the regiospecific transfer of GlcUA from UDP-GlcUA to the 2''-OH of cyanidin 3-O-β-glucoside and cyanidin 3-O-β-6''-O-malonylglucoside (Fig. 1; Sawada et al., 2005 The VvGT1 acceptor is a flavonoid, as is the acceptor in BpUGT94B1, whereas the glycosylated position of the GftD acceptor is the 2'-OH group of a Glc residue, as is also the case in BpUGT94B1. Docking was followed by energy optimization of amino acid side chains surrounding the substrates.
The tertiary structure of the model takes a GT-B-fold conformation with two distinct domains formed by the N- and C-terminal parts of the primary structure (Fig. 3
). In the final model, the N-terminal domain folds into seven
The N- and C-terminal domains form a deep cleft accommodating a tight binding site for the sugar acceptor and sugar donor deeply buried inside the protein (Fig. 4, A–E ). The sugar donor is positioned so that it mainly interacts with residues in the C-terminal domain, whereas the acceptor mainly interacts with residues in the N-terminal domain (Fig. 4, B–E).
Sugar Donor Interactions In the BpUGT94B1 model, several residues are positioned so that they may interact with the activated sugar donor (Fig. 5, A and B ). The majority of these residues are situated within the PSPG motif that is highly conserved between different UGTs (BpUGT94B1 residues 315–358; Fig. 2). Nine PSPG residues are predicted to interact with the sugar donor in the BpUGT94B1 model (Fig. 5A). These nine residues possess similar positions in the crystal structure of MtUGT71G1, with five being identical and four being similar residues (Fig. 2).
In the BpUGT94B1 model, the residues Q355, D357, and Q358 are all positioned near the sugar moiety of the sugar donor (Fig. 5A). The residue V316 lies within H-bond distance to the uridine ring of the donor. The position of the uridine ring is further stabilized by aromatic ring stacking with the indole ring of W315. E341 can interact with the Rib ring of the donor. H333, S337, and S338 can form H bonds with the -P, while S264 and maybe Q355 can interact with the β-P. Two highly conserved residues outside the PSPG motif are the residues corresponding to BpUGT94B1 H22 and D121. These are directly involved in the catalytic process and have been shown to be crucial for activity in many plant UGTs (Hans et al., 2004Less conserved residues outside the PSPG motif also exhibit interaction with the sugar donor. These residues are S143 that can H bond with the sugar moiety and is paralleled by a Thr residue in MtUGT71G1, S21 that interacts with the β-P, and the positively charged R25 that is positioned near the negatively charged carboxylate group of the GlcUA (Fig. 5B).
The residues in the BpUGT94B1 model that form the acceptor pocket are mainly positioned in the N-terminal domain. A hydrophobic environment is created by the residues W17, P88, P89, F122, L148, L151, P174, I187, Y186, and F356. Additional residues forming part of the acceptor pocket are T92, D121, N123, D152, K175, N176, Q355, and D357. An analysis of the model following docking of the acceptor cyanidin 3-O-glucoside shows that the acceptor is held in place by a tight fit of the surrounding amino acid residues. Stabilizing interactions are also envisioned between specific amino acid residues and the acceptor. The residues N123 and T92 are positioned close to the sugar part of the acceptor (Fig. 5A), and the acceptor B ring can be stabilized by H-bond formation to D152 (Fig. 5C). The A and C rings of the cyanidin moiety can be stabilized by aromatic ring stacking with the side chain of F356. The possibility to dock cyanidin 3-O-6''-O-malonylglucoside (Fig. 1) as an alternative acceptor was also investigated. Despite the tight fit of the enzyme around the smaller acceptor cyanidin 3-O-glucoside, it was possible to accommodate the acceptor cyanidin 3-O-6''-O-malonylglucoside within the acceptor pocket with favorable energy. This is accomplished when the malonic acid is bent toward the aglycone, which is also the energetically favored configuration of the molecule (Fig. 4, D and E).
To study the substrate specificity and enzyme kinetic properties of BpUGT94B1, a full-length cDNA clone encoding the enzyme was obtained from petals of red daisy. An N-terminal His-tag was added for heterologous expression in Escherichia coli and subsequent affinity purification (Fig. 6 ). The three-dimensional structure of UGTs suggests that N-terminal His-tagging would position the tag on the surface of the protein far from the active site, i.e. at a position that would not be expected to interfere with protein folding and activity (Fig. 3).
The isolated His-tagged enzyme was highly specific with respect to the sugar donor UDP-GlcUA. Activity with other activated sugars such as UDP-Glc, UDP-Gal, and UDP-Xyl was very low. The activity with UDP-Glc was <0.5% of the activity with UDP-GlcUA. The Km value for UDP-GlcUA was determined to be 1.1 ± 0.1 mM (Fig. 7 ; Table I ), whereas the Km value for UDP-Glc was 7.3 ± 0.9 mM (Fig. 8 ; Table I). The enzyme exhibited high activity using cyanidin 3-O-glucoside as acceptor. The Km value for cyanidin 3-O-glucoside was estimated to be 0.8 ± 0.2 mM. Substrate inhibition of BpUGT94B1 at acceptor concentrations above 1 mM prevented a more accurate assessment of this Km value (Fig. 9 ). Enzyme activity with the acceptor delphinidin-3-O-glucoside (Fig. 1) was of only 5% to 10% of the activity observed with cyanidin 3-O-glucoside.
Modulation of Sugar Donor Specificity
Residues in the PSPG motif of plant UGTs have previously been shown to be involved in sugar donor binding of UGTs (Kubo et al., 2004 All mutated enzymes were tested for activity with the sugar donors UDP-GlcUA, UDP-GalUA, UDP-Glc, UDP-Xyl, and UDP-Gal, using cyanidin 3-O-glucoside as the acceptor. All the mutants exhibited significantly decreased activity (relative activity <2.5% of wild type) with UDP-GlcUA (Table I; Fig. 10 ). Despite the severe decrease in activity with UDP-GlcUA for the R25S mutant, the Km value for UDP-GlcUA only increased from 1.1 ± 0.1 mM to 1.4 ± 0.3 mM. In contrast, the Km value for the mutant R25K increased to 7.0 ± 0.5 mM (Fig. 7; Table I).
BpUGT94B1 and mutants R25S, R25G, R25P, and R25K were tested for their ability to use UDP-Glc as the sugar donor. Three of the four mutants (R25S, R25G, and R25K) showed 3-fold activity increases using UDP-Glc as donor compared to the wild type (Fig. 10). Km for UDP-Glc was determined for the mutant R25S and was 2.9 ± 0.5 mM (Fig. 8; Table I) as compared to 7.3 ± 0.9 mM for the wild-type enzyme (Fig. 8; Table I), and the relative Kcat value was more than twice as high as for the wild-type enzyme. No activity was detected with UDP-GalUA and UDP-Xyl. In contrast to the wild-type enzyme, the mutants R25S, R25G, and R25K showed marginal activity with UDP-Gal.
In vivo, BpUGT94B1 glucuronosylates cyanidin 3-O-glucoside at the 2''-OH (Fig. 1; Toki et al., 1991 The mutated proteins were assayed for their activity toward the acceptors cyanidin 3-O-glucoside and delphinidin 3-O-glucoside. For both acceptors, the mutated proteins all showed less than 15% of the activity obtained with the wild-type protein. The most severe effect was observed with the D152A mutant, in which the activity toward cyanidine 3-O-glucoside dropped to less than 5% of wild type (Fig. 10). Km values of the mutant enzymes with respect to the two sugar acceptors were not determined because of the observed substrate inhibition (Fig. 9). To observe if the affinity for the sugar donor could account for the reduced relative activity of the mutants, the Km values for the sugar donor UDP-GlcUA were determined for the mutants L148A D152A and I187A (Fig. 7; Table I). The mutated proteins had Km values for the sugar donor UDP-GlcUA 1 to 3 times higher than wild type. Analysis of the acceptor pocket in the model identified an additional residue predicted to be important for acceptor stabilization in the active site. This was the residue N123 that proposes H bonding to the sugar part of the acceptor. To verify a role of this residue for activity, the mutation N123A was introduced in the BpUGT94B1 sequence. Introduction of an Ala residue would abolish any interaction between this residue and the acceptor. The N123A mutation caused relative enzyme activity to decrease to less than 15% of wild type for both acceptors (Fig. 10).
Recent crystallization of four plant UGTs, MtUGT71G1 (Shao et al., 2005
In the molecular model of BpUGT94B1, the substrates are tightly fitted in the cleft between the N- and C-terminal domains deeply buried within the enzyme (Fig. 4). This suggests cleft opening as a prerequisite for substrate binding. This is in accordance with studies of several GT crystal structures, suggesting accommodation of substrates within GT-B-fold GTs proceeds by slight movements of the linker region between the N- and C-terminal domains (Hu et al., 2003
In the model of BpUGT94B1, the positively charged side chain of R25 is positioned so that it points toward the carboxylate group of the UDP-GlcUA sugar donor. The crucial importance of the residue R25 was substantiated by biochemical analyses of BpUGT94B1 R25 mutants. Mutant proteins R25S, R25G, R25K, and R25P all possessed only 0.5% to 2.5% of wild-type activity with the sugar donor UDP-GlcUA. For the R25K mutant, this was paralleled by a 7-fold increase in Km. These results demonstrated the importance of R25 for enzyme activity with UDP-GlcUA as sugar donor. In contrast to the observed loss of activity with UDP-GlcUA, the three point mutants R25S, R25G, and R25K showed a 3- to 4-fold increase in activity with UDP-Glc as sugar donor paralleled by a decrease of Km for UDP-Glc from 7.3 mM for the wild-type BpUGT94B1 to 2.9 mM for the R25S mutant. Even the R25K mutation that retains a positively charged side chain shows loss of activity with UDP-GlcUA and increased activity with UDP-Glc. Apparently even a minor displacement of the positive charge away from the GlcUA, as mediated by the shorter side chain of the Lys residue as compared to Arg, is enough to abolish activity with UDP-GlcUA as the sugar donor. The mutant R25P showed decreased activity with both sugar donors. The severity of this mutation probably reflects that the Pro residue causes a changed torsion of the backbone.
The crystal structures of UGTs show the majority of interactions with the UDP-sugar donor to be provided by amino acid residues within the highly conserved PSPG motif (Shao et al., 2005
The observation that a single amino acid residue in BpUGT94B1 may be decisive with respect to UDP-sugar specificity is in accordance with other studies of the sugar specificity of UGTs. In the A. cordata UGT78A2 (GaT), a single residue (H374) was observed to dictate specificity for UDP-Gal (Kubo et al., 2004
Studies of GTs from animals support the involvement of single residues as determinants of sugar specificity in specific GTs (Qasba et al., 2005
BpUGT94B1 glucuronosylates cyanidine 3-O-glucoside at the 2''-OH position (Fig. 1). A very tight acceptor specificity of BpUGT94B1 is evidenced by the low activity with the acceptor delphinidin 3-O-glucoside, relative activity being only 5% of the activity with cyanidin 3-O-glucoside. Cyanidin 3-O-glucoside and delphinidine 3-O-glucoside offer the same structural epitope for glycosylation at the 2''-OH position, and only differ by the presence of an additional hydroxyl group on the B ring of the aglycone (Fig. 1). This shows that the entire structure of the substrates and not just the site of the accepting atom is being recognized by BpUGT94B1. To investigate residues in BpUGT94B1 responsible for this very tight substrate specificity distinguishing between cyanidin and delphinidin, independent point mutations of residues forming the acceptor pocket were made. The mutations I187S, I187A, and L148A all severely compromised activity toward cyanidin as well as delphinidin 3-O-glucoside. This showed that even minor structural changes of the residues forming the substrate-binding pocket can have a large impact on enzyme activity. To further investigate residues important for substrate interaction, two additional residues were mutated. The mutation D152A was expected to result in reduced activity because of lost ability to form a stabilizing H bond with the 4'-OH on the B ring of the two acceptors. The mutant N123A was made as this residue is positioned favorably for interaction with the sugar part of the acceptor. These mutants showed loss of activity with the D152A mutation being the most severe (activity <5% of wild type). These results verify the predictive power of homology modeling in identifying residues directly involved in substrate binding and enzymatic activity.
The importance of several residues in the acceptor pocket for enzymatic activity has also been observed in a study of MtUGT71G1 (He et al., 2006
In vivo the activity of BpUGT94B1 is a step in the synthesis pathway of the main anthocyanin in red daisy cyanidin 3-O-2''-O-glucuronosyl-6''-O-malonylglucoside (Fig. 1; Sawada et al., 2005
The in vitro activity does not reveal whether the glucuronosylating activity of BpUGT94B1 in vivo takes place before or after introduction of malonic acid at the C 6''-OH of the cyanidin 3-O-glucoside. This cannot be deduced from the model either, because both substrates can be fitted into the acceptor pocket (Fig. 4). The site surrounding the acceptor hydroxyl group to be glucuronosylated is the same on both acceptors, but the malonic acid ester residue would take up additional space in the narrow acceptor pocket. Successful docking of the malonylated anthocyanin requires a twist of the malonic acid ester residue toward the aglycone, favored by intramolecular H-bond formation between the malonic acid and the cyanidine A ring (Dangles, 1997
Cyanidin 3-O-2''-O-glucuronosyl-6''-O-malonylglucoside constitutes 85% of total anthocyanins in the petals of red daisy and very low amounts of the putative intermediates in the biosynthetic pathway are present (Sawada et al., 2005
The very narrow in vitro substrate specificity of BpUGT94B1 is a general feature of several other UGTs (Fukuchi-Mizutani et al., 2003
The conclusion of this study is that a few specific amino acid residues as well as the overall size and shape of the acceptor pocket define substrate specificity. The residues in the BpUGT94B1 model forming the acceptor pocket are mostly situated in the N-terminal domain, the least well conserved domain between UGTs. The presence of several highly variable loops in the N-terminal domain adds to the possible diversity in overall shape and size of the substrate pocket of UGTs. This explains why substrate specificity cannot be assigned based on primary structure alone. It also implies that novel combinations of donor and acceptor specificity might be obtained by combining entire N- and C-terminal domains of different UGTs. In recent studies (Cartwright et al., 2008 The importance of glucuronosylation for in planta stability, transport, and storage of bioactive natural products including anthocyanins is not yet understood. Nevertheless, engineering of specific UDP-glucuronosyltransferase activities into plants offers a wide range of interesting applications. Glucuronosylation of anthocyanins may be used to alter the color tonation of flowers, fruits, and vegetables. Increased stability during exposure to high or low pH, light, elevated temperatures, oxygen, and ascorbic acid are desired properties, which may be gained by glucuronosylation and open up new uses for anthocyanins as food colorants. A chimeric UGT able to use delphinidin 3-O-glucoside as sugar acceptor and UDP-GlcUA as sugar donor would offer the possibility to produce a blue plant pigment with improved stability for use in fermented foods like yogurt. Likewise, introduction of glucuronosylated defense compounds into plants by genetic engineering may improve resistance to biotic attacks.
Homology Modeling of UGT94B1
Homology modeling was performed according to guidelines for molecular modeling of GTs (Imberty et al., 2006
Docking of the sugar donor was performed by homology docking (Imberty et al., 2006
Analytical liquid chromatography-mass spectrometry was carried out using an Agilent 1100 Series LC (Agilent Technologies) hyphenated to a HCTplus ion trap mass spectrometer (Bruker Daltonics) and fitted with a Zorbax SB-C18 RRHT column (2.1 x 50 mm, 1.8 µM [Agilent], protected by a Phenomenex Gemini C18 security guard cartridge, flow rate: 0.2 mL min–1). The mobile phases were: A, 2% (v/v) formic acid in water; B, 0.1% (v/v) formic acid in acetonitrile. The gradient program was: 0 to 8 min, linear gradient 5% to 25% (v/v) B; 8 to 9 min, linear gradient 25% to 100% B; 9 to 10.5 min 100% B, followed by equlibration at 5% B for 3.5 min.
For the cloning of UGT94B1, mRNA was prepared from petals of red daisy using MicropolyA purist kit (Ambion). cDNA was prepared from the isolated mRNA and used as template for PCR with the UGT94B1-specific primers 5'gcatggtaccttaattattcatttcac3' and 5'gctactcgagatggattcaaaaatcg3' introducing KpnI and XhoI sites in the 5' and 3' ends, respectively. The construct was cloned first into pCR-blunt II-TOPO vector (Invitrogen) and then transferred into pET30a+ vector (Novagen). Single point mutations were introduced by PCR using UGT94B1 inserted into the PET30a+ vector (KpnI and XhoI sites) as template. PCR was performed using Phusion polymerase and thermocycling parameters were 95°C 1 min, 15 cycles of 95°C 30 s, 55°C 1 min, 68°C 12 min. PCR products were digested with DpnI (1–2 h, 37°C) and transformed into competent Escherichia coli cells. Plasmids were extracted from overnight cultures of transformed colonies and sequenced to verify the correctness of mutated sequences harboring the following changes: R25P, R25S, R25K, R25G, I187A, I187S, N123A, D152A, and P174G. The primers used to introduce these point mutations were: R25P fw: 5'GCATATAGTCACATATCTCCCTTCCTAGTTTTTGCC3', R25P rew: 5'GGCAAAAACTAGGAAGGGAGATATGTGACTATATGC3'; R25 S fw: 5'GCATATAGTCACATATCTTCCTTCCTAGTTTTTGCC3', R25 S rew 5'GGCAAAAACTAGGAAGGGAGATATGTGACTATATGC3'; R25G fw: 5'GCATATAGTCACATATCTGGCTTCCTAGTTTTTGCC3', R25G rev: 5'GGCAAAAACTAGGAAGCCAGATATGTGACTATATGC3'; R25K fw: 5'GCATATAGTCACATATCTAAGTTCCTAGTTTTTGCC3', R25K rev: 5'GGCAAAAACTAGGAACTTAGATATGTGACTATATGC3'; I187A fw: 5'GGTGGTTCGAAATATGCTGAACGCTTTGTTGATTGC3', I187A rew: 5'GCAATCAACAAAGCGTTCAGCATATTTCGAACCACC3'; D152A fw: 5'GCGTTATATGCTTTGGCTGCTCATCTCTACAC3', D152A rew: 5'GTGTAGAGATGAGCAGCCAAAGCATATAACGC3'; I187S fw: 5'GGTGGTTCGAAATATAGTGAACGCTTTGTTGATTGC3', I187S rev: 5'GCAATCAACAAAGCGTTCACTATATTTCGAACCACC3'; P174G fw: 5'TTCCTGAAATATATGGTAAAAATCGCGATATT3', P174G rew: 5'AATATCGCGATTTTTACCATATATTTCAGGAA3'; and N123A fw: 5'GGTTATATATGATTTTGCCCAATTGTGGGCCCCA3', N123A rev: 5'TGGGGCCCACAATTGGGCAAAATCATATATAACC3'.
PET30a+ plasmids (Novagen) harboring BpUGT94B1 or mutated derivatives were transformed into the E. coli XJa DE30 autolysis strain (Zymo research). This strain has a chromosomally inserted
The activity of UGT94B1 and mutants was determined in assay mixtures (total volume: 20 µL) containing UDP-sugar donor and acceptor as specified for individual experiments, enzyme (2 µg protein), and 100 mM Tris-HCl pH 7.5. After incubation (30°C, 450 rpm, 2–60 min), the reactions were stopped by addition of 1 volume MeOH/6% formic acid. After centrifugation (10 min, 4°C, 10,000g), product formation was analyzed by liquid chromatography-mass spectrometry analysis of supernatants. Sugar acceptor concentration (cyanidin 3-O-glucoside) was 650 µM for all experiments (except determination of cyanidine 3-O-glucoside kinetic parameters). Sugar donor concentrations were as stated in Figures 7, 8, and 9 for determining kinetic parameters and were 2.5 mM for determining relative activity. For all enzymatic assays both donor and acceptor were added to obtain a 5 to 10 times substrate excess during the entire time course of the enzymatic reactions. Calculation of kinetic parameters Km ± SD (mM) and relative Vmax ± SD (calculated as relative product formation min–1 mol–1 also called kcat) were performed using the software R (version 2.6.2), fitting initial velocity data (experimental points) to the Michaelis Menten (V0 = Vmax[S]/Km + [S]) equation by means of nonlinear regression analysis. Received August 20, 2008; accepted September 19, 2008; published October 1, 2008.
1 This work was supported by the Ministry of Science and Innovation, Program Committee for Foods and Health, the EU–FP6–2005 Life Science Health Programme to the "CAPELLA" project, the Center of Molecular Plant Physiology, the VKR Research Centre Pro-Active Plants, and a Ph.D. stipend from the University of Copenhagen (to S.A.O.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Birger Lindberg Møller (blm{at}life.ku.dk).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.108.128256 * Corresponding author; e-mail blm{at}life.ku.dk.
Bhattacharya A, Wunderlich Z, Monleon D, Tejero R, Montelione GT (2008) Assessing model accuracy using the homology modeling automatically software. Proteins 70: 105–118[CrossRef][Medline] Brazier-Hicks M, Offen WA, Gershater MC, Revett TJ, Lim EK, Bowles DJ, Davies GJ, Edwards R (2007) Characterization and engineering of the bifunctional N- and O-glucosyltransferase involved in xenobiotic metabolism in plants. Proc Natl Acad Sci USA 104: 20238–20243 Breton C, Snajdrova L, Jeanneau C, Koca J, Imberty A (2006) Structures and mechanisms of glycosyltransferases. Glycobiology 16: 29R–37R Campbell JA, Davies GJ, Bulone V, Henrissat B (1997) A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem J 326: 929–939[Web of Science][Medline] Caputi L, Lim EK, Bowles DJ (2008) Discovery of new biocatalysts for the glycosylation of terpenoid scaffolds. Chemistry 14: 6656–6662[CrossRef][Web of Science][Medline] Cartwright AM, Lim EK, Kleanthous C, Bowles DJ (2008) A kinetic analysis of regiospecific glucosylation by two glycosyltransferases of Arabidopsis thaliana: domain swapping to introduce new activities. J Biol Chem 283: 15724–15731 Coutinho PM, Deleury E, Davies GJ, Henrissat B (2003) An evolving hierarchical family classification for glycosyltransferases. J Mol Biol 328: 307–317[CrossRef][Web of Science][Medline] Dangles O (1997) Anthocyanin complexation and colour expression. Analusis Magazine 25: 50–52 DeLano WL (2002) The PyMOL Molecular Graphics System. DeLano Scientific, Palo Alto, CA Ford CM (1998) Multiple glucosyltransferase activities in the grapevine Vitis vinifera L. Aust J Grape Wine Res 4: 48–58[CrossRef] Fukuchi-Mizutani M, Okuhara H, Fukui Y, Nakao M, Katsumoto Y, Yonekura-Sakakibara K, Kusumi T, Hase T, Tanaka Y (2003) Biochemical and molecular characterization of a novel UDP-glucose:anthocyanin 3'-O-glucosyltransferase, a key enzyme for blue anthocyanin biosynthesis, from gentian. Plant Physiol 132: 1652–1663 Hans J, Brandt W, Vogt T (2004) Site-directed mutagenesis and protein 3D-homology modelling suggest a catalytic mechanism for UDP-glucose-dependent betanidin 5-O-glucosyltransferase from Dorotheanthus bellidiformis. Plant J 39: 319–333[CrossRef][Web of Science][Medline] Hansen KS, Kristensen C, Tattersall DB, Jones PR, Olsen CE, Bak S, Moller BL (2003) The in vitro substrate regiospecificity of recombinant UGT85B1, the cyanohydrin glucosyltransferase from Sorghum bicolor. Phytochemistry 64: 143–151[CrossRef][Medline] He XZ, Wang X, Dixon RA (2006) Mutational analysis of the Medicago glycosyltransferase UGT71G1 reveals residues that control regioselectivity for (iso)flavonoid glycosylation. J Biol Chem 281: 34441–34447 Hefner T, Stockigt J (2003) Probing suggested catalytic domains of glycosyltransferases by site-directed mutagenesis. Eur J Biochem 270: 533–538[Web of Science][Medline] Hu Y, Chen L, Ha S, Gross B, Falcone B, Walker D, Mokhtarzadeh M, Walker S (2003) Crystal structure of the MurG:UDP-GlcNAc complex reveals common structural principles of a superfamily of glycosyltransferases. Proc Natl Acad Sci USA 100: 845–849 Hughes J, Hughes MA (1994) Multiple secondary plant product UDP-glucose glucosyltransferase genes expressed in cassava (Manihot esculenta Crantz) cotyledons. DNA Seq 5: 41–49[Web of Science][Medline] Imberty A, Wimmerova M, Koca J, Breton C (2006) Molecular modeling of glycosyltransferases. Methods Mol Biol 347: 145–156[Medline] Jones P, Vogt T (2001) Glycosyltransferases in secondary plant metabolism: tranquilizers and stimulant controllers. Planta 213: 164–174[CrossRef][Web of Science][Medline] Jones PR, Moller BL, Hoj PB (1999) The UDP-glucose:p-hydroxymandelonitrile-O-glucosyltransferase that catalyzes the last step in synthesis of the cyanogenic glucoside dhurrin in Sorghum bicolor: isolation, cloning, heterologous expression, and substrate specificity. J Biol Chem 274: 35483–35491 Jorgensen K, Rasmussen AV, Morant M, Nielsen AH, Bjarnholt N, Zagrobelny M, Bak S, Moller BL (2005) Metabolon formation and metabolic channeling in the biosynthesis of plant natural products. Curr Opin Plant Biol 8: 280–291[CrossRef][Web of Science][Medline] Kamra P, Gokhale RS, Mohanty D (2005) SEARCHGTr: a program for analysis of glycosyltransferases involved in glycosylation of secondary metabolites. Nucleic Acids Res 33: W220–W225 Kogawa K, Kato N, Kazuma K, Noda N, Suzuki M (2007) Purification and characterization of UDP-glucose: anthocyanin 3',5'-O-glucosyltransferase from Clitoria ternatea. Planta 226: 1501–1509[Medline] Kohara A, Nakajima C, Yoshida S, Muranaka T (2007) Characterization and engineering of glycosyltransferases responsible for steroid saponin biosynthesis in Solanaceous plants. Phytochemistry 68: 478–486[CrossRef][Web of Science][Medline] Kramer CM, Prata RT, Willits MG, De LV, Steffens JC, Graser G (2003) Cloning and regiospecificity studies of two flavonoid glucosyltransferases from Allium cepa. Phytochemistry 64: 1069–1076[CrossRef][Web of Science][Medline] Kristensen C, Morant M, Olsen CE, Ekstrom CT, Galbraith DW, Moller BL, Bak S (2005) Metabolic engineering of dhurrin in transgenic Arabidopsis plants with marginal inadvertent effects on the metabolome and transcriptome. Proc Natl Acad Sci USA 102: 1779–1784 Kubo A, Arai Y, Nagashima S, Yoshikawa T (2004) Alteration of sugar donor specificities of plant glycosyltransferases by a single point mutation. Arch Biochem Biophys 429: 198–203[CrossRef][Web of Science][Medline] Laskowski RA, MacArthur MW, Moss DS, Thornton JM (1992) PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Cryst 26: 283–291[CrossRef][Web of Science] Laskowski RA, Rullmannn JA, MacArthur MW, Kaptein R, Thornton JM (1996) AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR. J Biomol NMR 8: 477–486[Web of Science][Medline] Li L, Modolo LV, Escamilla-Trevino LL, Achnine L, Dixon RA, Wang X (2007) Crystal structure of Medicago truncatula UGT85H2—insights into the structural basis of a multifunctional (iso)flavonoid glycosyltransferase. J Mol Biol 370: 951–963[CrossRef][Web of Science][Medline] Lim EK, Ashford DA, Hou B, Jackson RG, Bowles DJ (2004) Arabidopsis glycosyltransferases as biocatalysts in fermentation for regioselective synthesis of diverse quercetin glucosides. Biotechnol Bioeng 87: 623–631[CrossRef][Web of Science][Medline] Lim EK, Baldauf S, Li Y, Elias L, Worrall D, Spencer SP, Jackson RG, Taguchi G, Ross J, Bowles DJ (2003a) Evolution of substrate recognition across a multigene family of glycosyltransferases in Arabidopsis. Glycobiology 13: 139–145 Lim EK, Bowles DJ (2004) A class of plant glycosyltransferases involved in cellular homeostasis. EMBO J 23: 2915–2922[CrossRef][Web of Science][Medline] Lim EK, Higgins GS, Li Y, Bowles DJ (2003b) Regioselectivity of glucosylation of caffeic acid by a UDP-glucose:glucosyltransferase is maintained in planta. Biochem J 373: 987–992[CrossRef][Web of Science][Medline] Mackenzie PI, Owens IS, Burchell B, Bock KW, Bairoch A, Belanger A, Fournel-Gigleux S, Green M, Hum DW, Iyanagi T, et al (1997) The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics 7: 255–269[Web of Science][Medline] Martin RC, Cloud KA, Mok MC, Mok DWS (2000) Substrate specificity and domain analyses of zeatin O-glycosyltransferases. Plant Growth Regul 32: 289–293[CrossRef][Web of Science] Masada S, Terasaka K, Mizukami H (2007) A single amino acid in the PSPG-box plays an important role in the catalytic function of CaUGT2 (Curcumin glucosyltransferase), a group d family 1 glucosyltransferase from Catharanthus roseus. FEBS Lett 581: 2605–2610[CrossRef][Web of Science][Medline] Modolo LV, Blount JW, Achnine L, Naoumkina MA, Wang X, Dixon RA (2007) A functional genomics approach to (iso)flavonoid glycosylation in the model legume Medicago truncatula. Plant Mol Biol 64: 499–518[CrossRef][Web of Science][Medline] Morita Y, Hoshino A, Kikuchi Y, Okuhara H, Ono E, Tanaka Y, Fukui Y, Saito N, Nitasaka E, Noguchi H, Iida S (2005) Japanese morning glory dusky mutants displaying reddish-brown or purplish-gray flowers are deficient in a novel glycosylation enzyme for anthocyanin biosynthesis, UDP-glucose:anthocyanidin 3-O-glucoside-2''-O-glucosyltransferase, due to 4-bp insertions in the gene. Plant J 42: 353–363[CrossRef][Web of Science][Medline] Mulichak AM, Losey HC, Lu W, Wawrzak Z, Walsh CT, Garavito RM (2003) Structure of the TDP-epi-vancosaminyltransferase GtfA from the chloroeremomycin biosynthetic pathway. Proc Natl Acad Sci USA 100: 9238–9243 Mulichak AM, Lu W, Losey HC, Walsh CT, Garavito RM (2004) Crystal structure of vancosaminyltransferase GtfD from the vancomycin biosynthetic pathway: interactions with acceptor and nucleotide ligands. Biochemistry 43: 5170–5180[CrossRef][Web of Science][Medline] Nagashima S, Hirotani M, Yoshikawa T (2000) Purification and characterization of UDP-glucuronate: baicalein 7-O-glucuronosyltransferase from Scutellaria baicalensis Georgi. cell suspension cultures. Phytochemistry 53: 533–538[CrossRef][Web of Science][Medline] Nielsen KA, Tattersall DB, Jones PR, Moller BL (2008) Metabolon formation in dhurrin biosynthesis. Phytochemistry 69: 88–98[CrossRef][Web of Science][Medline] Offen W, Martinez-Fleites C, Yang M, Kiat-Lim E, Davis BG, Tarling CA, Ford CM, Bowles DJ, Davies GJ (2006) Structure of a flavonoid glucosyltransferase reveals the basis for plant natural product modification. EMBO J 25: 1396–1405[CrossRef][Web of Science][Medline] Ouzzine M, Gulberti S, Levoin N, Netter P, Magdalou J, Fournel-Gigleux S (2002) The donor substrate specificity of the human β-1,3-glucuronosyltransferase I toward UDP-glucuronic acid is determined by two crucial histidine and arginine residues. J Biol Chem 277: 25439–25445 Paquette S, Moller BL, Bak S (2003) On the origin of family 1 plant glycosyltransferases. Phytochemistry 62: 399–413[CrossRef][Web of Science][Medline] Qasba PK, Ramakrishnan B, Boeggeman E (2005) Substrate-induced conformational changes in glycosyltransferases. Trends Biochem Sci 30: 53–62[CrossRef][Web of Science][Medline] Richman A, Swanson A, Humphrey T, Chapman R, McGarvey B, Pocs R, Brandle J (2005) Functional genomics uncovers three glucosyltransferases involved in the synthesis of the major sweet glucosides of Stevia rebaudiana. Plant J 41: 56–67[CrossRef][Web of Science][Medline] Sawada S, Suzuki H, Ichimaida F, Yamaguchi M-A, Iwashita T, Fukui Y, Hemmi H, Nishino T, Nakayama T (2005) UDP-glucuronic acid:anthocyanin glucuronosyltransferase from red daisy (Bellis perennis) flowers: enzymology and phylogenetics of a novel glucosyltransferase involved in flower pigment biosynthesis. J Biol Chem 280: 899–906 Sefton MA, Francis IL, Williams PJ (1993) The volatile composition of chardonnay juices: a study by flavor precursor analysis. Am J Enol Vitic 44: 359–370 Sefton MA, Francis IL, Williams PJ (1994) Free and bound volatile secondary metabolites of Vitis vinifera grape cv. Sauvignon Blanc. J Food Sci 59: 142–147[CrossRef][Web of Science] Shao H, He X, Achnine L, Blount JW, Dixon RA, Wang X (2005) Crystal structures of a multifunctional triterpene/flavonoid glycosyltransferase from Medicago truncatula. Plant Cell 17: 3141–3154 Thorsoe KS, Bak S, Olsen CE, Imberty A, Breton C, Moller BL (2005) Determination of catalytic key amino acids and UDP sugar donor specificity of the cyanohydrin glycosyltransferase UGT85B1 from Sorghum bicolor: molecular modeling substantiated by site-specific mutagenesis and biochemical analyses. Plant Physiol 139: 664–673 Toki K, Saito N, Honda T (1991) Three cyanidin 3-glucuronylglucosides from red flowers of Bellis perennis. Phytochemistry 30: 3769–3771[CrossRef][Web of Science] Vogt T, Jones P (2000) Glycosyltransferases in plant natural product synthesis: characterization of a supergene family. Trends Plant Sci 5: 380–386[CrossRef][Web of Science][Medline] Vogt T, Zimmermann E, Grimm R, Meyer M, Strack D (1997) Are the characteristics of betanidin glucosyltransferases from cell-suspension cultures of Dorotheanthus bellidiformis indicative of their phylogenetic relationship with flavonoid glucosyltransferases? Planta 203: 349–361[CrossRef][Web of Science][Medline] Weis M, Lim EK, Bruce NC, Bowles DJ (2008) Engineering and kinetic characterisation of two glucosyltransferases from Arabidopsis thaliana. Biochimie 90: 830–834[CrossRef][Web of Science][Medline] Wiederstein M, Sippl MJ (2007) ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res 35: W407–W410 Yonekura-Sakakibara K, Tohge T, Niida R, Saito K (2007) Identification of a flavonol 7-O-rhamnosyltransferase gene determining flavonoid pattern in Arabidopsis by transcriptome coexpression analysis and reverse genetics. J Biol Chem 282: 14932–14941 This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|