|
|
||||||||
|
First published online September 26, 2008; 10.1104/pp.108.128769 Plant Physiology 148:1655-1667 (2008) © 2008 American Society of Plant Biologists
Characterization of Arabidopsis Lines Deficient in GAPC-1, a Cytosolic NAD-Dependent Glyceraldehyde-3-Phosphate Dehydrogenase1,[C]Instituto de Investigaciones Biotecnológicas-Instituto Tecnológico de Chascomús, CONICET/UNSAM, 7130, Chascomús, Argentina (S.P.R., D.F.G.-C.); Centro de Estudios Fotosintéticos y Bioquímicos, Universidad Nacional de Rosario, 2000, Rosario, Argentina (P.C.); and Laboratorio de Enzimología Molecular, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, 3000, Santa Fe, Argentina (A.A.I.)
Phosphorylating glyceraldehyde-3-P dehydrogenase (GAPC-1) is a highly conserved cytosolic enzyme that catalyzes the conversion of glyceraldehyde-3-P to 1,3-bis-phosphoglycerate; besides its participation in glycolysis, it is thought to be involved in additional cellular functions. To reach an integrative view on the many roles played by this enzyme, we characterized a homozygous gapc-1 null mutant and an as-GAPC1 line of Arabidopsis (Arabidopsis thaliana). Both mutant plant lines show a delay in growth, morphological alterations in siliques, and low seed number. Embryo development was altered, showing abortions and empty embryonic sacs in basal and apical siliques, respectively. The gapc-1 line shows a decrease in ATP levels and reduced respiratory rate. Furthermore, both lines exhibit a decrease in the expression and activity of aconitase and succinate dehydrogenase and reduced levels of pyruvate and several Krebs cycle intermediates, as well as increased reactive oxygen species levels. Transcriptome analysis of the gapc-1 mutants unveils a differential accumulation of transcripts encoding for enzymes involved in carbon partitioning. According to these studies, some enzymes involved in carbon flux decreased (phosphoenolpyruvate carboxylase, NAD-malic enzyme, glucose-6-P dehydrogenase) or increased (NAD-malate dehydrogenase) their activities compared to the wild-type line. Taken together, our data indicate that a deficiency in the cytosolic GAPC activity results in modifications of carbon flux and mitochondrial dysfunction, leading to an alteration of plant and embryo development with decreased number of seeds, indicating that GAPC-1 is essential for normal fertility in Arabidopsis plants.
Glyceraldehyde-3-P dehydrogenases (GAPDHs) are enzymes conserved in all living organisms, where they play a central role in the carbon economy of the cells. Higher plants possess four distinct isoforms of GAPDHs: (1) GAPC, a cytosolic, phosphorylating, NAD-specific GAPDH catalyzing the conversion of glyceraldehyde-3-P (Ga3P) to 1,3-bisphosphoglycerate; (2) NP-GAPDH, a cytosolic non-phosphorylating NADP-dependent GAPDH that catalyzes the oxidation of Ga3P to 3-phosphoglycerate (3PGA; Valverde et al., 2005
Much is known concerning the gene structure, evolution, and functional properties of GAPDHs in algal systems (Koksharova et al., 1998
In recent years, detailed studies have been carried out on the structure-function relationships (Mateos and Serrano, 1992
The importance of GAPC in photosynthetic tissues has been widely reported; however, only a few reports have described its function in heterotrophic tissues (Fernie et al., 2004 In this work, we isolated and characterized two lines exhibiting a GAPC-1 deficiency: a null mutant line of Arabidopsis deficient in GAPC-1 expression (gapc-1, SALK_010839) and a transgenic line expressing the antisense version of the GAPC-1 gene (At3g04120, as-GAPC1). Both lines exhibited defects in fertility, with alterations in seed and fruit development, suggesting that GAPC-1 is essential in these organs. The molecular, biochemical, and physiological studies of these lines indicate that this enzyme plays critical and pleiotropic roles, being essential for the maintenance of cellular ATP levels and carbohydrate metabolism and required for full fertility in Arabidopsis.
Identification of a gapc-1 Mutant and Construction of the Antisense as-GAPC1 Line To evaluate the possible function(s) of the GAPC-1 gene in Arabidopsis, we selected a T-DNA insertion mutant from the Arabidopsis Biological Resource Center (The Ohio State University, Columbus, OH) seed stock (SALK_010839, gapc-1). GAPC-1 (At3g04120; 1,017 bp) is composed of nine exons and eight introns, and in gapc-1 plants the T-DNA is inserted in the ninth exon (Fig. 1A). gapc-1 homozygous plants were isolated using PCR screening, and segregation analysis and DNA gel-blot hybridization indicate that the mutant plants contained only one copy of T-DNA (data not shown).
To obtain a second GAPC-1-deficient line, we constructed a transgenic antisense line (as-GAPC1) by transformation with pCAMBIA 2200 plasmid (Hajdukiewiez et al., 1994
Phenotypic Characterization of gapc-1 and as-GAPC1 Plants Under normal growth conditions, gapc-1 and as-GAPC1 plants exhibited retarded growth at different developmental stages compared to wild-type plants (Fig. 3, A and B). While we did not observe differences in the morphology of roots and leaves, flowers and fruits were severely affected in their morphology, with fruits displaying alterations in their size and weight (Fig. 3C). Wild-type plants have normal amounts of seeds per silique (45 ± 5) and normal morphology (Fig. 3D), whereas gapc-1 and as-GAPC1 plants showed aberrant seed development and seed number deficiency (Fig. 3, E and F). The reduced number of seeds (about 12% and 6% for gapc-1 and as-GAPC1 plants, respectively) was frequently accompanied by empty embryo sacs (Table I). These results suggest that GAPC activity is essential for zygotic and/or early embryo development. Because GAPC-1-deficient plants have abnormal fruit development, we investigated whether or not pollen viability and/or pollen tube elongation was affected in post-anthesis flowers of these plants. Pollen grains from gapc-1 and as-GAPC1 lines showed apparently normal morphology. However, they were not fertile and showed defects in pollen tube germination in vitro. We observed 23% and 21% viable pollen grains in gapc-1 and as-GAPC1 lines, respectively, compared to more than 95% of germinated pollen in wild-type plants (Fig. 4).
When the gapc-1 plants were fertilized with wild-type pollen, the resulting F1 plants exhibited a silique morphology and seed production similar to the wild-type phenotype, with 43 ± 6 seeds per silique and the absence of empty sacs or aborted seeds observed in the mutant line (Fig. 5, A and B). This result suggests that the reduced fertility of the mutant was due to defects in male organs and the female fertility was unaffected.
Analysis of gapc-1 Plants To have a better assessment of the way by which GAPC activity changes determine the observed phenotype, we next compared the transcriptome of gapc-1 and wild-type plants. Results were analyzed to state a primary relationship between transcript levels and changes in enzyme activities and/or protein function. In addition, we also sought further evidence of changes determining levels of protein and/or activity for many of the implied enzymes. Microarray analysis revealed alterations in the expression of genes encoding for glycolytic and Krebs cycle enzymes in gapc-1 plants. As shown in Table II, we observed a down-regulation of several genes involved in these pathways: GAPC-2, NP-GAPDH, two phosphofructokinase (PFK) genes, two pyruvate kinase (PK) genes, and a triose-P isomerase (TPI) gene. Conversely, we observed an up-regulation of two malate dehydrogenase (NAD-MDH) genes. As shown in Table II, there is also an alteration in the transcript levels of several genes related to photosynthesis, such as Rubisco SSU (At1g67090), Rubisco LSU (At1g14030 and At4g20130), and RCA (for Rubisco activase; At2g39730). Furthermore, several genes involved in the TCA cycle showed decreased expression: citrate synthase (At3g60100), succinate dehydrogenase (SDH; At3g27380), and aconitase (ACO; At2g05710 and At4g26970) genes. Also, several genes encoding for enzymes related to stress responses showed altered expression, such as different peroxidase (PER) isoforms, a peroxiredoxin (PEROX; At1g65970) isoform, an alternative oxidase (AOX; At5g64210) isoform, and three isoforms of catalase (CATs). Thus, microarray results suggest that mutants have an altered metabolism, which can induce a stress situation that could account for the delayed growth observed in the GAPC-deficient plants.
As described above, GAPC and NP-GAPDH participate in a bypass step of the glycolysis in plants, catalyzing the production of 3PGA, NADH, and ATP or 3PGA and NADPH, respectively. To further characterize the regulation of this bypass, we analyzed the expression of NP-GAPDH in gapc-1 and as-GAPC1 plants. A decrease of 25% and 92% in the expression of NP-GAPDH in gapc-1 and as-GAPC1, respectively, was observed (Fig. 6), in agreement with the decrease determined by microarray analysis (Table II) and also with the decrease in NP-GAPDH-specific activity (Fig. 7A). This is in contrast to the results obtained with np-gapdh mutant plants, where the expression of GAPC-1 is induced in the absence of NP-GAPDH. In addition, we did not observe an up-regulation of genes encoding for Glc-6-P dehydrogenase (G6PDH) isoforms either by microarrays or RT-PCR experiments as was observed in the np-gapdh plants (Rius et al., 2006
As mentioned above, microarray data from gapc-1 plants showed an alteration in the level of transcripts encoding for glycolytic and energy metabolism enzymes (Table II). To assess the impact of alterations in gene expression observed in microarrays, we evaluated the activity of several enzymes involved in both pathways (Fig. 7A). A 25% decrease in PK activity was detected in gapc-1 plants. This correlates with the 74% and 57% decreases in the two PK genes expression determined by RT-PCR for gapc-1 and as-GAPC1 plants (Fig. 7B) and microarray experiments with gapc-1 mutants (Table II). We also observed decreases in the activity of other enzymes in the mutant plants: 49% for phosphoenolpyruvate carboxylase (PEPC), 24% for NAD-malic enzyme (NAD-ME), and 39% for G6PDH (Fig. 7A). The decrease in several glycolytic transcripts such as the two PK genes and the inhibition of PK activity (the primary point of regulation of plant glycolysis), as well as the inhibition of other glycolytic enzymes, gives strong support that GAPC-1 deficiency lead to an inhibition of carbohydrate metabolism.
Russell and Sachs (1989) As described above, some genes related to photosynthesis, for example, Rubisco SSU and RCA, were decreased in microarray analysis. We confirm the decrease in RCA transcript levels (about 50%) by RT-PCR analysis. However, a slight increase of Rubisco SSU mRNA expression was observed (Fig. 7B). Furthermore, the transcription of many genes encoding for enzymes related to stress responses such as the three catalases was repressed (Fig. 7B; see also Table II). Thus, microarray and RT-PCR results suggest that mutants have an altered photosynthetic and carbon metabolism, which can induce a stress situation that could account for delayed growth.
To evaluate the effect of the GAPC deficiency in glycolytic or TCA intermediates, we quantified the levels of pyruvate, the end product of glycolysis, and malate, the product of the alternative glycolytic pathway. Furthermore, we determined the levels of two metabolites of the TCA cycle, citrate and isocitrate. The gapc-1 and as-GAPC1 plants accumulate 31% and 22%, respectively, of the pyruvate levels compared to the wild type, whereas there is an increase of about 1.7-fold in the accumulation of malate in both lines. Indeed, gapc-1 and as-GAPC1 plants showed a reduction in TCA intermediate levels such as citrate (40% and 32%, respectively) and isocitrate (54% and 27%, respectively; Table III).
gapc-1 Plants Show Reduced Levels of Oxygen Uptake and ATP, and Reduced Expression and Activity of TCA Cycle Enzymes
It has been demonstrated that GAPC-1 and other glycolytic enzymes are associated with the mitochondrial outer membrane in Arabidopsis (Giege et al., 2003
The energetic status of the gapc-1 line was evaluated by measuring total ATP levels. We found 38% and 29.4% decreases in the ATP concentration in mutant leaves and flowers, respectively (Fig. 8B). The results suggest that GAPC-1 deficiency has an important effect on ATP levels, in correlation with the decrease in the respiration rate observed in the mutant plants (Fig. 8A). The decrease in ATP pools and the reduction of the respiration rate in mutant plants correlate with a reduced expression of genes involved in the TCA cycle such as ACO and SDH determined by RT-PCR (Fig. 8C). This is in agreement with the observed decrease in aconitase (15% and 20% in gapc-1 and as-GAPC1 plants, respectively) and SDH activity (about 20% in both lines; Fig. 8C). Taken together, our results suggest that the GAPC-1 deficiency affects not only the glycolysis but also the function of other respiratory pathways, and that this metabolic deficit could be the cause of the phenotypes observed in reproductive tissues, which depend mainly on respiration to obtain energy.
Recently, it has been suggested that GAPC plays a regulatory role in reactive oxygen species (ROS) signaling in plants (Hancock et al., 2005
Microarray data also show that transcript levels for several genes encoding proteins that participate in oxidative stress response, such as peroxidases (PER62, PER41, PER52, PER9, and PER2) and superoxide dismutase [Cu-Zn], show increased levels in gapc-1 plants. In addition, we measured by RT-PCR the mRNA levels of other genes encoding for proteins involved in stress responses, such as PEROX and AOX (Sweetlove et al., 2002
To investigate other possible physiological functions of GAPC-1, we characterized two GAPC-deficient lines: a T-DNA insertional mutant (SALK_010839, gapc-1) and an antisense line, as-GAPC1. We found evidence that GAPC-1 plays an important role and is required for full fertility in Arabidopsis plants. The knockout mutant gapc-1 is null in terms of GAPC-1 expression, and the as-GAPC1 line displayed a decrease in the expression of GAPC-1 transcript. Accordingly, both lines showed lower levels of GAPC protein by western-blot analysis (Figs. 1 and 2) and reduced activity in leaves and flowers (Fig. 2B). Western-blot analysis performed in gapc-1 and as-GAPC1 plants revealed the presence of a protein band that reacts with a-GAPC antibodies. This can be due to the expression of GAPC-2, a cytosolic isoform of GAPC having high structural similarity with GAPC-1, whereas GAPC-2, GAPCp, and/or GAPA/B isoforms could contribute to the NADH-dependent residual activity observed in the two lines.
Both gapc-1 and as-GAPC1 plants exhibited a delay in growth. Indeed, both lines presented an alteration in silique morphology and seed production. The defect in pollen tube germination and the restoration of viable seed production after crossing experiments using wild-type pollen indicate that GAPC-1 function is important in male organs and suggest that the decrease in GAPC-1 activity impairs the mitochondrial function required for normal pollen production (Heiser et al., 1997
In a previous work, Hajirezaei et al. (2006)
In plants, the glycolytic carbon flux can pass through the GAPC enzyme producing 3PGA, NADH, and ATP or through a metabolic bypass catalyzed by NP-GAPDH producing 3PGA and NADPH, but not ATP. This alternative pathway has energetic and metabolic consequences; it has been proposed to participate in a shuttle of triose-P/phosphate that indirectly transfers photosynthetically reduced NADP+ from chloroplast to cytoplasm during photosynthesis (Kelly and Gibbs, 1973b
The deficiency of GAPC-1 activity shows a direct effect on the production of energy, as we measured a decrease in ATP cellular levels in flowers and leaves of the gapc-1 plants. Indeed, the decrease of pyruvate levels and TCA cycle intermediates suggests a decrease in the carbon flux through the glycolytic pathway to the mitochondria. Pollen development in the anther and the growth of the pollen tube are highly energy-demanding processes. It has been reported that pollen granules contain 20 times more mitochondria per cell than normal vegetative tissues in maize (Gass et al., 2005
Two major sites of ROS production in plant cells have been reported, one in the chloroplast, where ROS is produced in the photosynthetic electron transport chain, and the other in the mitochondria (Millar et al., 2001 In conclusion, in this work, we studied the effect of the disruption of the GAPC-1 gene in Arabidopsis plants using gapc-1 null mutants and antisense lines deficient in GAPC-1 expression. Both lines showed defects in fertility, with alterations of seed and fruit development, suggesting that GAPC-1 and the presence of a full glycolytic pathway are essential in these organs and have an important role in fertility in Arabidopsis. Analysis by microarrays, RT-PCR, and enzymatic activity suggest that a deficiency in GAPC-1 results in an inhibition of glycolysis, mitochondrial dysfunction, and increase of oxidative stress.
Plant Material and Growth Conditions Arabidopsis (Arabidopsis thaliana) var Columbia was used as the wild type. The gapc-1 mutant plant contains a T-DNA insertion in the ninth exon of the GAPC-1 gene At3g04120 (SALK_010839; Fig. 1A). The gapc-1 mutant seeds were obtained from the T-DNA Express Collection at the Salk Institute (http://signal.salk.edu/cgi-bin/tdnaexpress). Seeds were germinated directly in soil and kept at 4°C for at least 72 h before light treatment. Plants were grown in greenhouse conditions at 25°C under fluorescent lamps (Grolux, Sylvania and Cool White, Philips) with an intensity of 150 µmol m–2 s–1 using a 16-h-light/8-h-dark photoperiod.
The position of the T-DNA insert was determined by PCR using the following primers: LBb1 (GCGTGGACCGCTTGCTGCAACT; http://signal.salk.edu) and GAPC-1 (Table IV).
Genomic DNA was extracted from leaves using the cetyl-trimethyl-ammonium bromide method described by Sambrook et al. (1989)
Isolation of RNA and RT-PCR Analysis Total RNA from 6-week-old fully expanded rosette leaves collected from pools of six plants was extracted using TRI Reagent (Sigma-Aldrich). First, cDNA synthesis was obtained using total RNA (3 µg) in the presence of random hexamers and moloney murine leukemia virus RT (USB) according to the manufacturers' instructions. An aliquot (1 µL) from the RT reaction was used as template in PCR reactions with the corresponding oligonucleotides (Table IV). Semiquantitative RT-PCR analysis was performed on the amplification of products after 16, 20, 24, and 28 PCR cycles using (at least) three independent samples. Appropriate number of cycles was determined for each cDNA to obtain data during the exponential phase of the PCR reaction. β-ACTIN was used as internal control. Specific primer pairs were designed based on the cDNA sequence reported in GenBank for the desired genes. PCR products were analyzed on agarose gels and visualized using ethidium bromide staining and/or transferred onto Hybond N+ membranes (Amersham Biosciences). Probe labeling and membrane hybridization were performed according to the ECL Direct Nucleic Acid Labeling and Detection System protocol (Amersham Biosciences).
Arabidopsis oligonucleotide microarrays were fabricated by the University of Arizona and contain 26,000 oligonucleotides (http://www.ag.arizona.edu/microarray/). All analyses were completed as described previously (Rius et al., 2006
The relative levels of mRNA transcripts for the different genes were determined by densitometric analysis using the Gel Pro Analyzer program (Media Cybernetics).
Oxygen consumption was measured at 25°C using an air-tight chamber fitted with a Clark type electrode (Hansatech Leaf Disc Electrode unit). Calibration was achieved by a simple 2-point calibration between air (21% O2) and the injection or removal of a known volume of air from the chamber. Zero oxygen was achieved by equilibration with N2 to displace all the O2 present in the chamber. Plants were kept in the dark for 15 min before measurement. Detached Arabidopsis leaves and bud flowers (200–300 mg) were placed in the oxygen electrode chamber. Oxygen concentration was monitored for 15 min.
Leaf extracts obtained from pools of six plants were electrophoresed on 12% SDS-polyacrylamide gels and electroblotted onto a nitrocellulose membrane. Immunoblotting was revealed using affinity-purified antibodies raised against recombinant GAPC of Triticum aestivum, and antigenic polypeptides were detected using an alkaline-phosphatase-conjugated secondary antibody (dilution 1:10,000), as described previously (Plaxton, 1989
In vitro pollen germination was determined by incubating released pollen with medium containing 17% (w/v) Suc, 2 mM CaCl2, 1.65 mM H3BO3, 0.6% (w/v) agar, and 5 mM MES, pH 5.8, as described previously (Busi et al., 2006a
Six-week-old rosette leaves and bud flowers from wild-type and gapc-1 plants frozen with liquid nitrogen were ground to a powder using a chilled mortar and pestle. The powder (20 mg) was homogenized with 60 µL of 0.1 M HCl in a 1.5-mL microtube. The homogenate was centrifuged at 20,000g for 10 min at 4°C. The supernatant was filtered through a micro-concentrator Microcon YM-3 (Amicon) at 14,000g at 4°C. After neutralization with 1 M Tris-HCl, pH 7.4, the filtrates were used for the measurement of ATP levels. Total cellular ATP content was determined with an ATP bioluminescent assay kit (Sigma-Aldrich) and an LD-400 Luminescence detector (Beckman-Coulter; Wulff and Döppen, 1985
Metabolite levels were assayed spectrophotometrically as described previously (Chen et al., 2002
The histochemical detection of ROS was performed according to Hempel et al. (1999)
Homogenates used to determine enzyme activity were prepared as described (Eastmond et al., 2000
Protein concentration was determined by the modified Bradford assay (Bollag et al., 1996
General molecular techniques such as plasmid DNA isolation, restriction digestion, modification and ligation of DNA, PCR, agarose gel electrophoresis, northern blots, transformation, and culture of Escherichia coli were carried out according to standards protocols (Sambrook et al., 1989
We are grateful to Jose Luis Burgos (Comision de Investigaciones Científicas) for excellent technical assistance and the Arabidopsis Biological Resource Center and the stock donor(s). We thank Drs. María Victoria Busi, Guillermo Santa María, and Alejandro Araya for helpful discussions and critical reading of the manuscript and Dr. Carlos Bartoli for helping with the respiration measurements. Received August 30, 2008; accepted September 22, 2008; published September 26, 2008.
1 This work was supported by CONICET (grant nos. PIP–6241 to D.F.G.-C., and PIP–6357 and CAI+D'06 to A.A.I.), by ANPCyT (grant nos. PICT'06-00614 to D.F.G.-C.; PICTO03–13241 and 05–13129, PICT'03–14733, and PAV'03–137 to A.A.I.; and PICT'03–13278 to P.C.), and by Fundación Antorchas (grant no. 4306–5 to P.C.). The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors is: Diego F. Gomez-Casati (diego.gomezcasati{at}intech.gov.ar).
[C] Some figures in this article are displayed in color online but in black and white in the print edition. www.plantphysiol.org/cgi/doi/10.1104/pp.108.128769 * Corresponding author; e-mail diego.gomezcasati{at}intech.gov.ar.
Anderson LE, Ringenberg MR, Carol AA (2004) Cytosolic glyceraldehyde-3-P dehydrogenase and the B subunit of the chloroplast enzyme are present in the pea leaf nucleus. Protoplasma 223: 33–43[CrossRef][Web of Science][Medline] Baek D, Jin Y, Jeong JC, Lee HJ, Moon H, Lee J, Shin D, Kang CH, Kim DH, Nam J, et al (2008) Suppression of reactive oxygen species by glyceraldehyde-3-phosphate dehydrogenase. Phytochemistry 69: 333–338[CrossRef][Web of Science][Medline] Bollag DM, Rozycki MD, Edelstein SJ (1996) Protein Methods, Ed 2. Wiley-Liss, New York Bolstad DM, Irizarry RA, Astrand M, Speed TP (2003) A comparison of normalization methods for high density oligonucleotide array data based on bias and variance. Bioinformatics 19: 185–193 Busi MV, Gomez-Casati DF, Perales M, Araya A, Zabaleta E (2006a) Nuclear-encoded mitochondrial complex I gene expression is restored to normal levels by inhibition of unedited ATP9 transgene expression in Arabidopsis thaliana. Plant Physiol Biochem 44: 1–6[CrossRef][Web of Science][Medline] Busi MV, Maliandi MV, Valdez H, Clemente M, Zabaleta EJ, Araya A, Gomez-Casati DF (2006b) Deficiency of Arabidopsis thaliana frataxin alters activity of mitochondrial Fe-S proteins and induces oxidative stress. Plant J 48: 873–882[CrossRef][Web of Science][Medline] Bustos DM, Iglesias AA (2002) Non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase is post-translationally phosphorylated in heterotrophic cells of wheat (Triticum aestivum). FEBS Lett 530: 169–173[CrossRef][Web of Science][Medline] Bustos DM, Iglesias AA (2003) Phosphorylated non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase from heterotrophic cells of wheat interacts with 14-3-3 proteins. Plant Physiol 133: 2081–2088 Cerff R, Chambers SE (1979) Subunit structure of higher plant glyceraldehyde-3-phosphate dehydrogenases (EC 1.2.1.12 and EC 1.2.1.13). J Biol Chem 254: 6094–6098 Chen LS, Lin Q, Nose A (2002) A comparative study on diurnal changes in metabolite levels in the leaves of three crassulacean acid metabolism (CAM) species, Ananas comosus, Kalanchoe daigremontiana and K. pinnata. J Exp Bot 53: 341–350 Chuong SD, Good AG, Taylor GJ, Freeman MC, Moorhead GB, Muench DG (2004) Large-scale identification of tubulin-binding proteins provides insight on subcellular trafficking, metabolic channeling, and signaling in plant cells. Mol Cell Proteomics 3: 970–983 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743[CrossRef][Web of Science][Medline] Conley TR, Peng HP, Shih MC (1999) Mutations affecting induction of glycolytic and fermentative genes during germination and environmental stresses in Arabidopsis. Plant Physiol 119: 599–608 Eastmond PJ, Germain V, Lange PR, Bryce JH, Smith SM, Graham IA (2000) Postgerminative growth and lipid catabolism in oilseeds lacking the glyoxylate cycle. Proc Natl Acad Sci USA 97: 5669–5674 Fermani S, Sparla F, Falini G, Martelli PL, Casadio R, Pupillo P, Ripamonti A, Trost P (2007) Molecular mechanism of thioredoxin regulation in photosynthetic A2B2-glyceraldehyde-3-phosphate dehydrogenase. Proc Natl Acad Sci USA 104: 11109–11114 Fernie AR, Carrari F, Sweetlove LJ (2004) Respiratory metabolism: glycolysis, the TCA cycle and mitochondrial electron transport. Curr Opin Plant Biol 7: 254–261[CrossRef][Web of Science][Medline] Fillinger S, Boschi-Muller S, Azza S, Dervyn E, Branlant G, Aymerich S (2000) Two glyceraldehyde-3-phosphate dehydrogenases with opposite physiological roles in a nonphotosynthetic bacterium. J Biol Chem 275: 14031–14037 Gass N, Glagotskaia T, Mellema S, Stuurman J, Barone M, Mandel T, Roessner-Tunali U, Kuhlemeier C (2005) Pyruvate decarboxylase provides growing pollen tubes with a competitive advantage in petunia. Plant Cell 17: 2355–2368 Giege P, Heazlewood JL, Roessner-Tunali U, Millar AH, Fernie AR, Leaver CJ, Sweetlove LJ (2003) Enzymes of glycolysis are functionally associated with the mitochondrion in Arabidopsis cells. Plant Cell 15: 2140–2151 Gomez Casati DF, Sesma JI, Iglesias AA (2000) Structural and kinetic characterization of NADP-dependent, non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase from celery leaves. Plant Sci 154: 107–115[Medline] Graham JW, Williams TC, Morgan M, Fernie AR, Ratcliffe RG, Sweetlove LJ (2007) Glycolytic enzymes associate dynamically with mitochondria in response to respiratory demand and support substrate channeling. Plant Cell 19: 3723–3738 Gutierrez-Alcala G, Gotor C, Meyer AJ, Fricker M, Vega JM, Romero LC (2000) Glutathione biosynthesis in Arabidopsis trichome cells. Proc Natl Acad Sci USA 97: 11108–11113 Habenicht A (1997) The non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase: biochemistry, structure, occurrence and evolution. Biol Chem 378: 1413–1419[Web of Science][Medline] Habenicht A, Hellman U, Cerff R (1994) Non-phosphorylating GAPDH of higher plants is a member of the aldehyde dehydrogenase superfamily with no sequence homology to phosphorylating GAPDH. J Mol Biol 237: 165–171[CrossRef][Web of Science][Medline] Hajdukiewiez P, Svab Z, Maliga P (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25: 989–994[CrossRef][Web of Science][Medline] Hajirezaei MR, Biemelt S, Peisker M, Lytovchenko A, Fernie AR, Sonnewald U (2006) The influence of cytosolic phosphorylating glyceraldehyde 3-phosphate dehydrogenase (GAPC) on potato tuber metabolism. J Exp Bot 57: 2363–2377 Hancock JT, Henson D, Nyirenda M, Desikan R, Harrison J, Lewis M, Hughes J, Neill SJ (2005) Proteomic identification of glyceraldehyde 3-phosphate dehydrogenase as an inhibitory target of hydrogen peroxide in Arabidopsis. Plant Physiol Biochem 43: 828–835[CrossRef][Web of Science][Medline] Heiser V, Rasmusson A, Thieck O, Brennicke A, Grohmann L (1997) Antisense repression of the mitochondrial NADH-binding subunit of complex I in transgenic potato plants induces male sterility. Plant Sci 127: 61–69 Hempel SL, Buettner GR, O'Malley YQ, Wessels DA, Flaherty DM (1999) Dihydrofluorescein diacetate is superior for detecting intracellular oxidants: comparison with 2',7'-dichlorodihydrofluorescein diacetate, 5(and 6)-carboxy-2',7'-dichlorodihydrofluorescein diacetate, and dihydrorhodamine 123. Free Radic Biol Med 27: 146–159[CrossRef][Web of Science][Medline] Holtgrawe D, Scholz A, Altmann B, Scheibe R (2005) Cytoskeleton-associated, carbohydrate-metabolizing enzymes in maize identified by yeast two-hybrid screening. Physiol Plant 125: 141–156[CrossRef] Igamberdiev AU, Hurry V, Kromer S, Gardestrom P (1998) The role of mitochondrial electron transport during photosynthetic induction. A study with barley (Hordeum vulgare) protoplasts incubated with rotenone and oligomycin. Physiol Plant 104: 431–439[CrossRef] Iglesias AA, Vicario LR, Gómez-Casati DF, Sesma JI, Gómez-Casati ME, Bustos DM, Podestá FE (2002) On the interaction of substrate analogues with non-phosphorylating glyceraldehydes 3-phosphate dehydrogenase from celery leaves. Plant Sci 162: 689–696 Kelly GJ, Gibbs M (1973a) A mechanism for the indirect transfer of photosynthetically reduced nicotinamide adenine dinucleotide phosphate from chloroplasts to the cytoplasm. Plant Physiol 52: 674–676 Kelly GJ, Gibbs M (1973b) Nonreversible d-glyceraldehyde 3-phosphate dehydrogenase of plant tissues. Plant Physiol 52: 111–118 Koksharova O, Schubert M, Shestakov S, Cerff R (1998) Genetic and biochemical evidence for distinct key functions of two highly divergent GAPDH genes in catabolic and anabolic carbon flow of the cyanobacterium Synechocystis sp. PCC 6803. Plant Mol Biol 36: 183–194[CrossRef][Web of Science][Medline] Li J, Kogan M, Knight SA, Pain D, Dancis A (1999) Yeast mitochondrial protein, Nfs1p, coordinately regulates iron-sulfur cluster proteins, cellular iron uptake, and iron distribution. J Biol Chem 274: 33025–33034 Mateos ML, Serrano A (1992) Occurrence of phosphorylating and nonphosphorylating NADP+-dependent gylceraldehyde 3-phosphate dehydrogenases in photosynthetic organisms. Plant Sci 84: 163–170 Michels S, Scagliarini S, Della Seta F, Carles C, Riva M, Trost P, Branlant G (1994) Arguments against a close relationship between non-phosphorylating and phosphorylating glyceraldehyde-3-phosphate dehydrogenases. FEBS Lett 339: 97–100[CrossRef][Web of Science][Medline] Millar AH, Considine MJ, Day DA, Whelan J (2001) Unravelling the role of mitochondria during oxidative stress in plants. IUBMB Life 51: 201–205[Web of Science][Medline] Moller IM (2001) Plant mitochondria and oxidative stress: electron transport, NADPH turnover, and metabolism of reactive oxygen species. Annu Rev Plant Physiol Plant Mol Biol 52: 561–591[CrossRef][Web of Science][Medline] Moller IM, Kristensen BK (2004) Protein oxidation in plant mitochondria as a stress indicator. Photochem Photobiol Sci 3: 730–735[CrossRef][Web of Science][Medline] Nagata T, Todoriki S, Hayashi T, Shibata Y, Mori M, Kanegae H, Kikuchi S (1999) Gamma-radiation induces leaf trichome formation in Arabidopsis. Plant Physiol 120: 113–120 Perusse JR, Schoen DJ (2004) Molecular evolution of the GapC gene family in Amsinckia spectabilis populations that differ in outcrossing rate. J Mol Evol 59: 427–436[CrossRef][Web of Science][Medline] Petersen J, Brinkmann H, Cerff R (2003) Origin, evolution, and metabolic role of a novel glycolytic GAPDH enzyme recruited by land plant plastids. J Mol Evol 57: 16–26[CrossRef][Web of Science][Medline] Pietrzak M, Shillito RD, Hohn T, Potrykus I (1986) Expression in plants of two bacterial antibiotic resistance genes after protoplast transformation with a new plant expression vector. Nucleic Acids Res 14: 5857–5868 Plaxton WC (1989) Molecular and immunological characterization of plastid and cytosolic pyruvate kinase isozymes from castor oil endosperm and leaf. Eur J Biochem 181: 443–451[Web of Science][Medline] Plaxton WC (1996) The organization and regulation of plant glycolysis. Annu Rev Plant Physiol Plant Mol Biol 47: 185–214[CrossRef][Web of Science] Plaxton WC, Podestá FE (2006) The functional organization and control of plant respiration. Crit Rev Plant Sci 25: 159–198[CrossRef] Rius SP, Casati P, Iglesias AA, Gomez-Casati DF (2006) Characterization of an Arabidopsis thaliana mutant lacking a cytosolic non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase. Plant Mol Biol 61: 945–957[CrossRef][Web of Science][Medline] Rumpho ME, Edwards GE, Loescher WH (1983) A pathway for photosynthetic carbon flow to mannitol in celery leaves: activity and localization of key enzymes. Plant Physiol 73: 869–873 Russell DA, Sachs MM (1989) Differential expression and sequence analysis of the maize glyceraldehyde-3-phosphate dehydrogenase gene family. Plant Cell 1: 793–803 Salt DE, Prince RC, Pickering IJ, Raskin I (1995) Mechanisms of cadmium mobility and accumulation in Indian mustard. Plant Physiol 109: 1427–1433[Abstract] Sambrook J, Maniatis T, Fritsch EF (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Schnurr JA, Storey KK, Jung HJ, Somers DA, Gronwald JW (2006) UDP-sugar pyrophosphorylase is essential for pollen development in Arabidopsis. Planta 224: 520–532[CrossRef][Web of Science][Medline] Siddiquee KA, Arauzo-Bravo MJ, Shimizu K (2004) Effect of a pyruvate kinase (pykF-gene) knockout mutation on the control of gene expression and metabolic fluxes in Escherichia coli. FEMS Microbiol Lett 235: 25–33[CrossRef][Web of Science][Medline] Sparla F, Fermani S, Falini G, Zaffagnini M, Ripamonti A, Sabatino P, Pupillo P, Trost P (2004) Coenzyme site-directed mutants of photosynthetic A4-GAPDH show selectively reduced NADPH-dependent catalysis, similar to regulatory AB-GAPDH inhibited by oxidized thioredoxin. J Mol Biol 340: 1025–1037[CrossRef][Web of Science][Medline] Sweetlove LJ, Heazlewood JL, Herald V, Holtzapffel R, Day DA, Leaver CJ, Millar AH (2002) The impact of oxidative stress on Arabidopsis mitochondria. Plant J 32: 891–904[CrossRef][Web of Science][Medline] Tusher V, Tibshirani R, Chu G (2001) Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 98: 5116–5121 Valverde F, Ortega JM, Losada M, Serrano A (2005) Sugar-mediated transcriptional regulation of the Gap gene system and concerted photosystem II functional modulation in the microalga Scenedesmus vacuolatus. Planta 221: 937–952[CrossRef][Web of Science][Medline] Wang X, Chen Y, Zou J, Wu W (2007) Involvement of a cytoplasmic glyceraldehyde-3-phosphate dehydrogenase GapC-2 in low-phosphate-induced anthocyanin accumulation in Arabidopsis. Chin Sci Bull 52: 1764–1770[CrossRef] Weigel D, Glazebrook J (2006) Transformation of Agrobacterium using the freeze-thaw method. Cold Spring Harb Protoc doi/10.1101/pdb.prot4665 Wolosiuk RA, Buchanan BB (1978) Activation of chloroplast NADP-linked glyceraldehyde-3-phosphate dehydrogenase by the ferredoxin/thioredoxin system. Plant Physiol 61: 669–671 Wu P, Ma L, Hou X, Wang M, Wu Y, Liu F, Deng XW (2003) Phosphate starvation triggers distinct alterations of genome expression in Arabidopsis roots and leaves. Plant Physiol 132: 1260–1271 Wulff K, Döppen W (1985) Luminometric method. In HU Bergmeyer, ed, Methods of Enzymatic Analysis, Vol 7. Verlag Chemie, Weinheim, Germany, pp 357–364 Yang Y, Kwon HB, Peng HP, Shih MC (1993) Stress responses and metabolic regulation of glyceraldehyde-3-phosphate dehydrogenase genes in Arabidopsis. Plant Physiol 101: 209–216[Abstract] This article has been cited by other articles:
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|