|
|
||||||||
|
First published online October 22, 2008; 10.1104/pp.108.126813 Plant Physiology 148:1953-1963 (2008) © 2008 American Society of Plant Biologists OPEN ACCESS ARTICLE
Transcriptional Modulation of Ethylene Response Factor Protein JERF3 in the Oxidative Stress Response Enhances Tolerance of Tobacco Seedlings to Salt, Drought, and Freezing1,[C],[W],[OA]Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, China (L.W., Z.Z., H.Z., R.H.); National Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100094, China (L.W., X.-C.W.); National Key Facility of Crop Gene Resources and Genetic Improvement, Beijing 100081, China (L.W., Z.Z., H.Z., R.H.); and National Center for Plant Gene Research, Beijing 100081, China (L.W., Z.Z., H.Z., R.H.)
Abiotic stresses such as drought, cold, and salinity affect normal growth and development in plants. The production and accumulation of reactive oxygen species (ROS) cause oxidative stress under these abiotic conditions. Recent research has elucidated the significant role of ethylene response factor (ERF) proteins in plant adaptation to abiotic stresses. Our earlier functional analysis of an ERF protein, JERF3, indicated that JERF3-expressing tobacco (Nicotiana tabacum) adapts better to salinity in vitro. This article extends that study by showing that transcriptional regulation of JERF3 in the oxidative stress response modulates the increased tolerance to abiotic stresses. First, we confirm that JERF3-expressing tobacco enhances adaptation to drought, freezing, and osmotic stress during germination and seedling development. Then we demonstrate that JERF3-expressing tobacco imparts not only higher expression of osmotic stress genes compared to wild-type tobacco, but also the activation of photosynthetic carbon assimilation/metabolism and oxidative genes. More importantly, this regulation of the expression of oxidative genes subsequently enhances the activities of superoxide dismutase but reduces the content of ROS in tobacco under drought, cold, salt, and abscisic acid treatments. This indicates that JERF3 also modulates the abiotic stress response via the regulation of the oxidative stress response. Further assays indicate that JERF3 activates the expression of reporter genes driven by the osmotic-responsive GCC box, DRE, and CE1 and by oxidative-responsive as-1 in transient assays, suggesting the transcriptional activation of JERF3 in the expression of genes involved in response to oxidative and osmotic stress. Our results therefore establish that JERF3 activates the expression of such genes through transcription, resulting in decreased accumulation of ROS and, in turn, enhanced adaptation to drought, freezing, and salt in tobacco.
Regulation of transcription has proved to be a vital aspect of the complex genetic and biochemical networks involved in plant responses to stresses. Understanding the interaction between stress-responsive transcription factors and their corresponding cis-acting elements in promoters of the downstream target genes is a prerequisite to dissecting the transcriptional regulatory network. For instance, investigation of the promoters of COR genes in Arabidopsis (Arabidopsis thaliana) indicated that they are regulated in an abscisic acid (ABA)-dependent or ABA-independent pathway under conditions of cold, dehydration, and high salinity (Liu et al., 1998
Accumulated evidence indicates that stress-stimulated physiological imbalance increases the level of reactive oxygen species (ROS) in plant cells. The steady-state levels of hydrogen peroxide (H2O2), singlet oxygen, the superoxide anion (O2–), and the hydroxyl radical depend on the balance between generation and removal, which is facilitated by the ROS-scavenging system of the cell (Bartoli et al., 2004
Expression of JERF3 in Tobacco Increases Seed Germination and Root Elongation under Salt and Osmotic Stress, and Tolerance to Drought and Freezing in Seedling Stage
Salinity, drought, and low temperature result in osmotic stress. Our earlier experiments showed that after NaCl treatment, leaf discs from JERF3-overexpressing tobacco (OE) seedlings remained green, whereas those from wild type (wild-type tobacco) were bleached, indicating that JERF3 enhances tolerance to salt in vitro (Wang et al., 2004
After 0.15 M NaCl treatment for 14 d, the seedling roots in the five independent OE lines were about twice as long than those in wild type (Fig. 1C). Interestingly, when subjected to higher concentrations of 0.2 mM mannitol for the same duration, roots of five independent OE lines were not only about 34% longer than those of wild type but also showed more lateral roots (Fig. 1C). Student's t tests indicate that the above data of seed germination or root elongation are not significantly different among the five independent OE lines at 95% probability, indicating that the distinctive transcript level of JERF3 (Supplemental Fig. S1A) did not correlate with the degree of tolerance in OE lines. However, there are differences (significant at 95% probability) in the seed germination or root elongation between OE lines and wild type. These results indicate that JERF3 increases the adaptation to salt and osmotic stress during seed germination and root elongation in tobacco. Next we tested the response of wild type and the above five independent OE seedlings to drought at different stages. We found that after 3-week-old seedlings were not watered for 20 d, more than 85% of wild-type seedlings had wilted whereas growth was almost normal in the five independent OE seedlings (Fig. 2A). Interestingly, when 6-week-old seedlings were exposed to drought for 15 d, the phenotypes of wilted leaves did not show obvious differences between wild type and five independent OE seedlings. However, after rewatering for another 2 d, more than 80% of wild-type seedlings did not recover from the wilted phenotype whereas growth was back to normal in the five independent OE seedlings (Fig. 2B), indicating that JERF3 increases tolerance to drought in tobacco seedlings.
We also examined the response of wild type and three one-copy insertion OE seedlings to freezing. Initially, we exposed seedlings to –10°C in the growth chamber but found no clear difference between OE lines and wild type. We then set the temperature to –2°C. As can be seen in Figure 2C, wild-type seedlings were injured after a 3-h exposure to –2°C but OE seedlings were not obviously affected. More interestingly, leakage of ions from wild-type seedlings after the treatment was 30% but that from OE seedlings was only 10% (Fig. 2D), which is consistent with the report that plasma membranes of plants are injured because of exposure to cold, resulting in leakage of ions from the cytoplasm (Gonzalez-Aguilar et al., 2000
To investigate how JERF3 modulates plant response to drought, cold, and salt stresses, we compared the expression profiles in two independent OE seedlings with that in wild-type plants using cDNA-amplified fragment length polymorphism (AFLP; Vos et al., 1995
Among the up-regulated genes, we first confirmed the expression of four genes related to osmotic stress in five independent OE lines and wild type using quantitative real-time PCR (qPCR) amplifications, namely NtSAM1, TOBLTP, NtERD10C, and NtSPS. It is known that NtSAM1 encodes S-adenosyl-L-Met synthetase, which was reported to be inducible by ABA, mannitol, and NaCl (Espartero et al., 1994
Next we analyzed the expression of four genes involved in photosynthetic carbon assimilation/metabolism in OE seedling. It is established that NtRub-SS encodes Rubisco small subunit (Mazur and Chui 1985
Also we analyzed the expression of seven genes involved in the response to oxidative stress in OE seedling. It has been reported that NtCA encodes carbonic anhydrase, which displays antioxidant activity and functions in the hypersensitive defense response (Slaymaker et al., 2002
The finding that JERF3 regulates the expression of photosynthetic carbon assimilation/metabolism and oxidative genes indicates that ROS might be related to the enhanced tolerance to drought, salt, and freezing. The possible involvement of ERF factors in ROS transcriptional regulatory networks that govern plant stress responses has been analyzed in previous studies (Mittler, 2002
Expression of JERF3 in Tobacco Increases the Activities of SOD But Decreases the Accumulation of ROS
The data so far indicate that plants accumulate osmotic solutes to regulate osmotic potential under drought, salt, and cold stress (Gilmour et al., 2000 The fact that JERF3 increases the expression of genes related to oxidative stress suggests that JERF3 might modulate the levels of ROS. To evaluate the important ROS-scavenging pathways of SOD in cellular compartments, and the possible regulation of individual SOD genes at the transcriptional level, we further measured the activities of SOD in the oxidative response. Our results showed that the SOD activities were 5% to approximately 8% higher in OE seedlings than that in wild type under normal growth conditions, consistent with the significant expression of NtSOD in OE seedlings. SOD activities increased 160% to approximately 210% and 7% to approximately 12% in OE and wild-type seedlings, respectively, compared to that in wild type of control, after dehydration, cold, salt, and ABA treatments (Fig. 5A ). Student's t tests indicate that the significant difference of SOD activities cannot be seen between the two independent OE lines, except between OE lines and wild type at 95% probability, indicating that JERF3 gives rise to the increase of SOD activities in tobacco under abiotic stresses and ABA treatment.
Because H2O2, singlet oxygen, O2–, and the hydroxyl radical all belong to ROS (Bartoli et al., 2004
Our results indicate that JERF3 enhances tolerance to drought, cold, and osmotic stress. Moreover, it has been reported that ERF proteins interact with several elements such as GCC box (Ohme-Takagi and Shinshi, 1995
To further clarify the direct regulation of JERF3 in the expression of photosynthetic carbon assimilation/metabolism and oxidative genes, we cloned the promoters of Rubisco small subunit gene (the promoter sequence is reported to be 1,041 bp in length; Mazur and Chui 1985
Interestingly, JERF3 also interacts with the full-length promoter (–1 to –1,096 bp) of NtCA (NtCA-p1). Concomitant with the deletion of the promoter, GUS activity weakened but not markedly until NtCA-p7 (–1 to –617 bp; Fig. 7B), suggesting that the deleted sequence between NtCA-p6 and NtCA-p7 might interact with JERF3. In fact, removal of the fragment in the promoter of NtCA (NtCA-39 del) significantly reduced the expression of the reporter gene (Fig. 7B). Therefore our results demonstrate that JERF3 might interact with a novel sequence of 39 bp (–617 to –657 bp, ATCTGTGATCAGCAATAATTGTTGAGTTGATTTGGAATT) located on the promoter of NtCA to activate gene expression in this manner.
It has been documented that the stress-induced increase of ROS in plant cells results from an imbalance between generation and removal. The production and accumulation of ROS cause oxidative stress under these abiotic stresses. Our earlier experiments (Wang et al., 2004
Chloroplast and mitochondria are the major sites of generation of ROS (Asada, 2006
After being detected by a receptor, ROS continues transferring the signal through two main pathways. In one, a group of transcription factors participating in different cellular pathways is activated by a mitogen-activated protein kinase cascade (Pitzschke and Hirt, 2006
In Arabidopsis, ethylene receptors including ETR1, ETR2, EIN4, ERS1, and ERS2 (Potuschak et al., 2003
Plant Material and Growth Conditions
JERF3-expressing tobacco (Nicotiana tabacum; Wang et al., 2004
All seeds in the following assays were surface sterilized and kept at 4°C for 2 d to break dormancy (Mukhopadhyay et al., 2004
For drought assays, both 3-week-old and 6-week-old OE and wild-type seedlings in pots were adequately watered and then water was withheld for 15 to approximately 20 d. For freezing assays, 3-week-old OE lines and wild type in pots were placed in a growth chamber at –2°C for 3 h. For electrolyte leakage assay, seedlings of 3-week-old NC89 wild-type and OE seedlings were placed at –2°C in a growth chamber for 0, 2, 4, 8, and 12 h to determine electrolyte leakage as described by Guo et al. (2002)
Total RNA was extracted from unstressed 3-week-old tobacco plants using Trizol (Invitrogen) according to the manufacturer's recommendations. cDNA was synthesized from 1 µg of total RNA using 200 units of moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega) following the manufacturer's instructions. For synthesis of the second strand, M-MLV RTase cDNA synthesis kit (TaKaRa) was used. cDNA-AFLP assay was performed as described by Vos et al. (1995)
Total RNA was extracted from unstressed 3-week-old tobacco plants using Trizol (Invitrogen) according to the manufacturer's recommendations. cDNA from unstressed 3-week-old seedlings was synthesized from 1 µg of total RNA using 200 units of M-MLV reverse transcriptase (Promega) following the manufacturer's instructions. After reverse transcription, qPCRs were performed using an ABI Prism 7000 system (Applied Biosystems). The relative transcript abundance for some genes derived from cDNA-AFLP analysis is relative to the actin transcript levels measured in the same sample. The primers used in this article for qPCR are listed in Supplemental Table S1.
Three-week-old tomato plants (Lycopersicon esculentum Lichun) were grown in growth chambers at 25°C with a 16-h light regime with illumination from cool-white fluorescent lights of about 150 µmol m–2 s–1. For the H2O2 and MV treatments, 100 µM H2O2 or 50 µM MV in 0.1% Tween 20 was used to spray tomato seedling leaves (Nishizawa et al., 2008
The stress treatments were applied as described below. For the drought treatment, OE and wild-type seedlings were removed from Murashige and Skoog medium, washed with water, dried with tissue paper, and then placed on tissue paper for 1 h. For the low-temperature treatment, OE and wild-type seedlings in plates were placed at 4°C in a growth chamber for 2 d. For the ABA and salt treatments, OE and wild-type seedlings in plates were sprayed with 100 µM ABA or 200 mM NaCl and kept under high humidity for 3 h. Activity of SOD was determined using the method of Winterbourn et al. (1975)
TAIL-PCR was performed as described by Liu et al. (1995)
For constructing the reporter vectors, four-times-repeated sequences of cis-acting elements GCC (AGCCGCC), DRE (TACCGACAT), CE1 (TGCCACCGG), or as-1 (TGACG) were inserted upstream of the minimal TATA box (–46 to +10) to replace the cauliflower mosaic virus 35S promoter in pBI121 (CLONTECH). The plasmids were then introduced into the Agrobacterium tumefaciens strain LBA4404. Agrobacterium-mediated transient assay was performed on the leaves of 4-week-old wild-type and OE seedlings as described by Yang et al. (2000) To ascertain whether JERF3 interacts with the upstream sequence of the ATG start code of NtCA, DNA fragments 1,096 bp (NtCA-p1), 870 bp (NtCA-p2), 788 bp (NtCA-p3), 733 bp (NtCA-p4), 692 bp (NtCA-p5), 657 bp (NtCA-p6), 617 bp (NtCA-p7), and 192 bp (NtCA-mini as a minimal promoter) upstream of the ATG start code of NtCA were inserted separately into pCAMBIA1303 using the enzymes PstI and BglII. Similarly, a DNA fragment 807 bp (NtSOD-f), 660 bp (NtSOD-p1), 600 bp (NtSOD-p2), and 300 bp (NtSOD-mini as a minimal promoter) upstream of the ATG start code of NtSOD was inserted separately into pCAMBIA1303 using the enzymes PstI and BglII. Sequences of the primers of NtCA and NtSOD promoters were listed in Supplemental Table S1. To generate the removal of GCC box or 39-bp fragment from NtSOD-f or NtCA-p1, respectively, PCR amplifications were used with special primers listed in Supplemental Table S1 using pCAMBIA1303-NtCA-p1 or pCAMBIA1303-NtSOD-f as a template. Then PCR production was self linked with T4 DNA ligase and was followed by transformation into Escherichia coli. After sequencing confirmation, the above-constructed plasmids were then introduced separately into the A. tumefaciens strain LBA4404. Agrobacterium-mediated transient assay was performed and the GUS activity measured about 48 h later. The GenBank accession numbers for the sequences used as materials in this article are: AY383630 (JERF3), X63603 (actin), AF127243 (NtSAM1), D13952 (TOBLT), AB049337 (NtERD10C), AF194022 (NtSPS), X02353 (NtRub-SS), M14417 (ChlGaPA), M14419 (CyGAP), U35111 (NtRCA342), AB093097 (NtSOD), AF454759 (NtCA), AJ309006 (NtRbohD), U93244 (NtCAT1), AB041518 (NtGPX), AU15933 (NtAPX1), D85912 (NtAPX2), EU342357 (NtCA promoter), EU342358 (NtSOD promoter), AF328784 (LeEIL1), and EU910896 (JERF3 promoter).
The following materials are available in the online version of this article.
The authors thank Professor Clive W. Lloyd and International Science Editing for improving the text. Received July 22, 2008; accepted October 16, 2008; published October 22, 2008.
1 This work was supported by the National Science Foundation of China (grant nos. 30525034 and 30671135) and the National Basic Research Program of China (grant nos. 2006CB100102 and 2007CB108801).
2 These authors contributed equally to the article. The author responsible for the distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Rongfeng Huang (rongfeng{at}public3.bta.net.cn).
[C] Some figures in this article are displayed in color online but in black and white in the print edition.
[W] The online version of this article contains Web-only data.
[OA] Open access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.108.126813 * Corresponding author; e-mail rongfeng{at}public3.bta.net.cn.
Apel K, Hirt H (2004) REACTIVE OXYGEN SPECIES: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55: 373–399[CrossRef][Medline] Asada K (2006) Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol 141: 391–396 Bartoli CG, Gomez F, Martinez DE, Guiamet JJ (2004) Mitochondria are the main target for oxidative damage in leaves of wheat (Triticum aestivum L.). J Exp Bot 55: 1663–1669 Bishopp A, Mahonen AP, Helariutta Y (2006) Signs of change: hormone receptors that regulate plant development. Development 133: 1857–1869 Börnke F (2005) The variable C-terminus of 14-3-3 proteins mediates isoform-specific interaction with sucrose-phosphate synthase in the yeast two-hybrid system. J Plant Physiol 162: 161–168[CrossRef][Web of Science][Medline] Chao Q, Rothenberg M, Solano R, Roman G, Terzaghi W, Ecker JR (1997) Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell 89: 1133–1144[CrossRef][Web of Science][Medline] Cheng C, Yun KY, Ressom HW, Mohanty B, Bajic VB, Jia Y, Yun SJ, Reyes BG (2007) An early response regulatory cluster induced by low temperature and hydrogen peroxide in seedlings of chilling-tolerant japonica rice. BMC Genomics 8: 175[Medline] Despres C, Chubak C, Rochon A, Clark R, Bethune T, Desveaux D, Fobert PR (2003) The Arabidopsis NPR1 disease resistance protein is a novel cofactor that confers redox regulation of DNA binding activity to the basic domain/leucine zipper transcription factor TGA1. Plant Cell 15: 2181–2191 Espartero J, Pintor-Toro JA, Pardo JM (1994) Differential accumulation of S-adenosylmethionine synthetase transcripts in response to salt stress. Plant Mol Biol 25: 217–227[CrossRef][Web of Science][Medline] Gadjev I, Vanderauwera S, Gechev TS, Laloi C, Minkov IN, Shulaev V, Apel K, Inze D, Mittler R, Breusegem FV (2006) Transcriptomic footprints disclose specificity of reactive oxygen species signaling in Arabidopsis. Plant Physiol 141: 436–445 Gechev TS, Breusegem FV, Stone JM, Denev I, Laloi C (2006) Reactive oxygen species as signals that modulate plant stress responses and programmed cell death. Bioessays 28: 1091–1101[CrossRef][Web of Science][Medline] Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol 124: 1854–1865 Gonzalez-Aguilar GA, Fortiz J, Cruz R, Baez R, Wang CY (2000) Methyl jasmonate reduces chilling injury and maintains postharvest quality of mango fruit. J Agric Food Chem 48: 515–519[Medline] Guo H, Ecker JR (2004) The ethylene signaling pathway: new insights. Curr Opin Plant Biol 7: 40–49[CrossRef][Web of Science][Medline] Guo Y, Xiong L, Ishitani M, Zhu JK (2002) An Arabidopsis mutation in translation elongation factor 2 causes superinduction of CBF/DREB1 transcription factor genes but blocks the induction of their downstream targets under low temperatures. Proc Natl Acad Sci USA 99: 7786–7791 Kasuga M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K (2004) A combination of the Arabidopsis DREB1A gene and stress-inducible rd29A promoter improved drought- and low-temperature stress tolerance in tobacco by gene transfer. Plant Cell Physiol 45: 346–350 Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72: 427–441[CrossRef][Web of Science][Medline] Kizis D, Lumbreras V, Pages M (2001) Role of AP2/EREBP transcription factors in gene regulation during abiotic stress. FEBS Lett 498: 187–189[CrossRef][Web of Science][Medline] Lee BH, Lee H, Xiong L, Zhu JK (2002) A mitochondrial complex I defect impairs cold-regulated nuclear gene expression. Plant Cell 14: 1235–1251 Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10: 1391–1406 Liu Y, Zhao TJ, Liu JM, Liu WQ, Liu Q, Yan YB, Zhou HM (2006) The conserved Ala37 in the ERF/AP2 domain is essential for binding with the DRE element and the GCC box. FEBS Lett 580: 1303–1308[CrossRef][Web of Science][Medline] Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J 8: 457–463[CrossRef][Web of Science][Medline] Marcus Y, Altman-Gueta H, Finkler A, Gurevitz M (2005) Mutagenesis at two distinct phosphate-binding sites unravels their differential roles in regulation of Rubisco activation and catalysis. J Bacteriol 187: 4222–4228 Masuta C, Furuno M, Tanaka H, Yamada M, Koiwai A (1992) Molecular cloning of a cDNA clone for tobacco lipid transfer protein and expression of the functional protein in Escherichia coli. FEBS Lett 311: 119–123[Medline] Mazur BJ, Chui CF (1985) Sequence of a genomic DNA clone for the small subunit of ribulose bis-phosphate carboxylase-oxygenase from tobacco. Nucleic Acids Res 13: 2373–2386 Menke FLH, Champion A, Kijne JW, Memelink J (1999) A novel jasmonate- and elicitor-responsive element in the periwinkle secondary metabolite biosynthetic gene Str interacts with a jasmonate- and elicitor-inducible AP2-domain transcription factor, ORCA2. EMBO J 18: 4455–4463[CrossRef][Web of Science][Medline] Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405–410[CrossRef][Web of Science][Medline] Mittler R, Vanderauwera S, Gollery M, Breusegem FV (2004) Reactive oxygen gene network of plants. Trends Plant Sci 9: 490–498[CrossRef][Web of Science][Medline] Morel J, Fromentin J, Blein JP, Simon-Plas F, Elmayan T (2004) Rac regulation of NtrbohD, the oxidase responsible for the oxidative burst in elicited tobacco cell. Plant J 37: 282–293[Web of Science][Medline] Mori IC, Schroeder JI (2004) Reactive oxygen species activation of plant Ca2+ channels: a signaling mechanism in polar growth, hormone transduction, stress signaling, and hypothetically mechanotransduction. Plant Physiol 135: 702–708 Mukhopadhyay A, Vij S, Tyagi AK (2004) Overexpression of a zinc-finger protein gene from rice confers tolerance to cold, dehydration, and salt stress in transgenic tobacco. Proc Natl Acad Sci USA 101: 6309–6314 Mustilli AC, Merlot S, Vavasseur A, Fenzi F, Giraudat J (2002) Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Cell 14: 3089–3099 Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J 34: 137–148[CrossRef][Web of Science][Medline] Nishizawa A, Yabuta Y, Shigeoka S (2008) Galactinol and raffinose constitute a novel function to protect plants from oxidative damage. Plant Physiol 147: 1251–1263 Niu X, Helentjaris T, Bate NJ (2002) Maize ABI4 binds coupling element1 in abscisic acid and sugar response genes. Plant Cell 14: 2565–2575 Ohme-Takagi M, Shinshi H (1995) Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell 7: 173–182[Abstract] Orvar BL, Ellis BE (1995) Isolation of a cDNA encoding cytosolic ascorbate peroxidase in tobacco. Plant Physiol 108: 839–840[CrossRef][Web of Science][Medline] Pasqualini S, Paolocci F, Borgogni A, Morettini R, Ederli L (2007) The overexpression of an alternative oxidase gene triggers ozone sensitivity in tobacco plants. Plant Cell Environ 30: 1545–1556[CrossRef][Medline] Pitzschke A, Hirt H (2006) Mitogen-activated protein kinases and reactive oxygen species signaling in plants. Plant Physiol 141: 351–356 Potuschak T, Lechner E, Parmentier Y, Yanagisawa S, Grava S, Koncz C, Genschik P (2003) EIN3-dependent regulation of plant ethylene hormone signaling by two Arabidopsis F box proteins: EBF1 and EBF2. Cell 115: 679–689[CrossRef][Web of Science][Medline] Ruuska SA, Andrews TJ, Badger MR, Price GD, von Caemmerer S (2000) The role of chloroplast electron transport and metabolites in modulating Rubisco activity in tobacco: insights from transgenic plants with reduced amounts of cytochrome b/f complex or glyceraldehyde 3-phosphate dehydrogenase. Plant Physiol 122: 491–504 Shih MC, Lazar G, Goodman HM (1986) Evidence in favor of the symbiotic origin of chloroplasts: primary structure and evolution of tobacco glyceraldehyde-3- phosphate dehydrogenases. Cell 47: 73–80[CrossRef][Web of Science][Medline] Simon-Plas F, Elmayan T, Blein JP (2002) The plasma membrane oxidase NtrbohD is responsible for AOS production in elicited tobacco cells. Plant J 31: 137–147[CrossRef][Web of Science][Medline] Slaymaker DH, Navarre DA, Clark D, del Pozo O, Martin GB, Klessig DF (2002) The tobacco salicylic acid-binding protein 3 (SABP3) is the chloroplast carbonic anhydrase, which exhibits antioxidant activity and plays a role in the hypersensitive defense response. Proc Natl Acad Sci USA 99: 11640–11645 Slooten L, Capiau K, Van Camp W, Van Montagu M, Sybesma C, Inze D (1995) Factors affecting the enhancement of oxidative stress tolerance in transgenic tobacco overexpressing manganese superoxide dismutase in the chloroplasts. Plant Physiol 107: 737–750[Abstract] Smith KS, Ferry JG (2000) Prokaryotic carbonic anhydrases. FEMS Microbiol Rev. 24: 335–366[CrossRef][Web of Science][Medline] Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes Dev 12: 3703–3714 Tang W, Charles TM, Newton RJ (2005) Overexpression of the pepper transcription factor CaPF1 in transgenic Virginia pine (Pinus Virginiana Mill.) confers multiple stress tolerance and enhances organ growth. Plant Mol Biol 59: 603–617[Medline] Tieman DM, Ciardi JA, Taylor MG, Klee HJ (2001) Members of the tomato LeEIL (EIN3-like) gene family are functionally redundant and regulate ethylene responses throughout plant development. Plant J 26: 47–58[CrossRef][Web of Science][Medline] Torres-Schumann S, Godoy JA, Pintor-Toro JA (1992) A probable lipid transfer protein gene is induced by NaCl in stems of tomato plants. Plant Mol Biol 18: 749–757[CrossRef][Web of Science][Medline] Trevino MB, O'Connell MA (1998) Three drought-responsive members of the nonspecific lipid-transfer protein gene family in Lycopersicon pennellii show different developmental patterns of expression. Plant Physiol 116: 1461–1468 Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, et al (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23: 4407–4414 Wang H, Huang Z, Chen Q, Zhang Z, Zhang H, Wu Y, Huang D, Huang R (2004) Ectopic overexpression of tomato JERF3 in tobacco activates downstream gene expression and enhances salt tolerance. Plant Mol Biol 55: 183–192[CrossRef][Web of Science][Medline] Winterbourn CC, Hawkins RE, Brian M, Carrell RW (1975) The estimation of red cell superoxide dismutase activity. J Lab Clin Med 85: 337–341[Web of Science][Medline] Wormuth D, Heiber I, Shaikali J, Kandlbinder A, Baier M, Dietz KJ (2007) Redox regulation and antioxidative defence in Arabidopsis leaves viewed from a systems biology perspective. J Biotechnol 129: 229–248[CrossRef][Web of Science][Medline] Xue GP, Loveridge CW (2004) HvDRF1 is involved in abscisic acid-mediated gene regulation in barley and produces two forms of AP2 transcriptional activators, interacting preferably with a CT-rich element. Plant J 37: 326–339[CrossRef][Web of Science][Medline] Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol 57: 781–803[CrossRef][Medline] Yang Y, Li R, Qi M (2000) In vivo analysis of plant promoters and transcription factors by agroinfiltration of tobacco leaves. Plant J 22: 543–551[CrossRef][Web of Science][Medline] Zhang H, Zhang D, Chen J, Yang Y, Huang Z, Huang D, Wang XC, Huang R (2004) Tomato stress-responsive factor TSRF1 interacts with ethylene responsive element GCC box and regulates pathogen resistance to Ralstonia solanacearum. Plant Mol Biol 55: 825–834[Web of Science][Medline] This article has been cited by other articles:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ASPB Publications | PLANT PHYSIOLOGY® | THE PLANT CELL | |
|---|---|---|---|