This Article Full Text Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via ISI Web of Science (15) Citing Articles via Google Scholar Google Scholar Articles by Kucho, K.-i. Articles by Fukuzawa, H. Search for Related Content PubMed PubMed Citation Articles by Kucho, K.-i. Articles by Fukuzawa, H. Agricola Articles by Kucho, K.-i. Articles by Fukuzawa, H.

ENVIRONMENTAL STRESS AND ADAPTATION

Cis-acting Elements and DNA-Binding Proteins Involved in CO₂-Responsive Transcriptional Activation of Cah1 Encoding a Periplasmic Carbonic Anhydrase in Chlamydomonas reinhardtii¹

Division of Integrated Life Science, Graduate School of Biostudies, Kyoto University, Kyoto, 606–8502, Japan

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO₂ conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between –293 and –231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO₂ conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from –651 to –231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO₂ conditions. These EEC-binding proteins were present even in cells grown under high-CO₂ conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.

¹ This work was supported by Grants-in-Aid from the Japanese Ministry of Education, Science and Culture and by the Japan Society for the Promotion of Science (grant no. JSPS–RFTF97R16001 to H.F.).

^* Corresponding author; e-mail fukuzawa{at}lif.kyoto-u.ac.jp; fax 81–75–753–6127.

Received May 6, 2003; returned for revision June 5, 2003; accepted June 24, 2003.

This article has been cited by other articles:

				S. Lu, L. Li, X. Yi, C. P. Joshi, and V. L. Chiang Differential expression of three eucalyptus secondary cell wall-related cellulose synthase genes in response to tension stress J. Exp. Bot., February 16, 2008; (2008) erm350v1. [Abstract] [Full Text] [PDF]

				T. Kohinata, H. Nishino, and H. Fukuzawa Significance of Zinc in a Regulatory Protein, CCM1, Which Regulates the Carbon-Concentrating Mechanism in Chlamydomonas reinhardtii Plant Cell Physiol., February 1, 2008; 49(2): 273 - 283. [Abstract] [Full Text] [PDF]

				X. Fei and X. Deng A Novel Fe Deficiency-Responsive Element (FeRE) Regulates the Expression of atx1 in Chlamydomonas reinharditii Plant Cell Physiol., October 1, 2007; 48(10): 1496 - 1503. [Abstract] [Full Text] [PDF]

				J. V. Moroney and R. A. Ynalvez Proposed Carbon Dioxide Concentrating Mechanism in Chlamydomonas reinhardtii Eukaryot. Cell, August 1, 2007; 6(8): 1251 - 1259. [Full Text] [PDF]

				S. Glanz, A. Bunse, A. Wimbert, C. Balczun, and U. Kuck A nucleosome assembly protein-like polypeptide binds to chloroplast group II intron RNA in Chlamydomonas reinhardtii Nucleic Acids Res., October 6, 2006; 34(18): 5337 - 5351. [Abstract] [Full Text] [PDF]

				R. van Lis, A. Atteia, L. A. Nogaj, and S. I. Beale Subcellular Localization and Light-Regulated Expression of Protoporphyrinogen IX Oxidase and Ferrochelatase in Chlamydomonas reinhardtii Plant Physiology, December 1, 2005; 139(4): 1946 - 1958. [Abstract] [Full Text] [PDF]

				H. Harada, D. Nakatsuma, M. Ishida, and Y. Matsuda Regulation of the Expression of Intracellular {beta}-Carbonic Anhydrase in Response to CO2 and Light in the Marine Diatom Phaeodactylum tricornutum Plant Physiology, October 1, 2005; 139(2): 1041 - 1050. [Abstract] [Full Text] [PDF]

				K. Miura, T. Yamano, S. Yoshioka, T. Kohinata, Y. Inoue, F. Taniguchi, E. Asamizu, Y. Nakamura, S. Tabata, K. T. Yamato, et al. Expression Profiling-Based Identification of CO2-Responsive Genes Regulated by CCM1 Controlling a Carbon-Concentrating Mechanism in Chlamydomonas reinhardtii Plant Physiology, July 1, 2004; 135(3): 1595 - 1607. [Abstract] [Full Text] [PDF]

				S. Yoshioka, F. Taniguchi, K. Miura, T. Inoue, T. Yamano, and H. Fukuzawa The Novel Myb Transcription Factor LCR1 Regulates the CO2-Responsive Gene Cah1, Encoding a Periplasmic Carbonic Anhydrase in Chlamydomonas reinhardtii PLANT CELL, June 1, 2004; 16(6): 1466 - 1477. [Abstract] [Full Text] [PDF]