Article Figures & Data
Figures
- Fig. 1.
Comparison of BL treatment on the WT,bri1, and det2 seedlings with the use of GeneChip. A, The distribution of the signal log ratio values for WT (y axis) and det2 (x axis) are shown for the BR-regulated genes, listed in Tables I to III. B, The distribution of signal log ratio values for bri1(y axis) and det2 (x axis) are shown for the BR-regulated genes, listed in Tables I to III. The signal log ratio represents the ratio of hybridization signals between BL- and mock-treated samples using a log (base 2) scale. A signal log ratio of 1 represents a gene that shows a 2-fold increase in expression by BL treatment; a signal log ratio of −1 represents a gene that shows a 2-fold reduction by BL treatment.
- Fig. 2.
Comparison of BL and Brz treatment with the use of GeneChip experiment. The distribution of signal log ratio values for treatments with BL (y axis) and Brz (x axis) are shown. A, All of the genes (>8,000) on the GeneChip are plotted. B, Genes that are induced or reduced more than 2-fold in a single GeneChip experiment are plotted. C, Genes that are induced or reduced more than 2-fold in two of the three GeneChip experiments are plotted. D, The BR-regulated genes (induced or reduced more than 2-fold in three GeneChip experiments, listed in Tables I and II) are plotted. The signal log ratio represents the ratios of hybridization signals using a log (base 2) scale. A signal log ratio of 1 represents a gene whose expression is increased 2-fold by treatment with either BL or Brz, and a signal log ratio of −1 represents a gene whose expression is reduced 2-fold by treatment with either BL or Brz.
- Fig. 3.
Regulation of PIF3, Lhcb1.3, and rbcS-1A gene expression by BL. Time courses of the inhibition of PIF3 (A), Lhcb1.3 (B), andrbcS-1A (C) gene expression by BL. Light-growndet2 seedlings were treated with 10 nmBL or were mock treated (cont) for the indicated times, and transcript abundance was analyzed by quantitative Taq-Man RT-PCR. D, Effects of cycloheximide (CHX) on PIF3 expression. Seedlings were treated with 100 μm CHX or mock treatment for 1 h, and then for an additional 3 h with 10 nm BL or mock treatment in the continued presence of CHX. The amount of PIF3 mRNA was determined by quantitative Taq-Man RT-PCR analysis. Transcript abundance levels are presented as relative values that are normalized with respect to the levels of 18S ribosomal RNA. Data are means ±se from three different plant samples.
- Fig. 4.
Induction of early auxin-inducible genes by BL. Kinetics of the induction of a GH3 homolog, BRU6(A), SAUR-AC1 (B), and IAA3 (C) by BL are shown. Light-grown det2 seedlings were treated with 10 nm BL or were mock treated (cont) for the indicated times, after which transcript abundance was analyzed by Taq-Man RT-PCR. Transcript abundance levels are presented as relative values that are normalized with respect to the levels of 18S ribosomal RNA. Data are means ± se from three different plant samples.
- Fig. 5.
BL induction of genes that are implicated in cell elongation or cell wall organization. Kinetics of induction by BL ofTCH4 (A), a putative expansin gene AtExp8 (B), and KCS1 (C) are shown. Light-grown det2seedlings were treated with 10 nm BL or were mock treated (cont) for the indicated times, after which transcript abundance was analyzed by Taq-Man RT-PCR. Transcript abundance levels are presented as relative values that are normalized with respect to the levels of 18S ribosomal RNA. Data are shown as means ± se from three different plant samples.
- Fig. 6.
Regulation of P450 genes by BL. A, Phylogenetic relationships among BR-regulated and other P450 genes. Proteins whose genes were shown to be up- or down-regulated by BL are indicated in bold and underlined, respectively (Tables I andII). BR6ox (Arabidopsis, CYP85A, AB035868), CPD (Arabidopsis, CYP90A,X87367), ROT3 (Arabidopsis, CYP90C, AB008097), DWF4 (Arabidopsis, CYP90B, AF044216), and CYP90D (Arabidopsis, AB066286) belong to the CYP85 or CYP90 families. CYP72B1 (Arabidopsis, BAS1, AC003105) is a suppressor of the phyB mutant. CYP88A3 (Arabidopsis, AtKAO1,AF318500) and CYP701A3 (Arabidopsis, GA3, AF047720) participate in GA biosynthesis. CYP83B1 (Arabidopsis, D78598) and CYP79B2 (Arabidopsis, AF069495) participate in auxin metabolism. The genes for CYP73A1 (Helianthus sp., cinnamate 4-hydroxylase,Z17369) and CYP75A1 (Petunia sp., flavonoid-3′, 5′-hydroxylase, D14588) were the first P450 genes to be identified functionally in higher plants and belong to the higher plant-specific group A of P450 genes. The accession numbers of the other P450 family members are D30718 (CYP8) and M93133 (CYP7A1). Kinetics of regulation of the CPD (B), DWF4 (C), BR6ox (D),ROT3 (E), CYP90D (F), CYP72, CYP85, CYP90, andBAS1 (G) genes by BL are shown. Light-grown det2seedlings were treated with 10 nm BL or were mock treated (cont) for the indicated times, after which transcript abundance was analyzed by Taq-Man RT-PCR. Transcript abundance levels are presented as relative values that are normalized with respect to the levels of 18S ribosomal RNA. Data are shown as means ±se from three different plant samples.
- Fig. 7.
Frequencies of up-regulated and down-regulated genes. A, Distribution of BR-down-regulated genes that are listed in Table I. B, Distribution of BR-up-regulated genes that are listed in Table II. The BR-regulated genes are classified into the functional categories based on their established or putative functions.
Tables
Gene Name Accession No. Function or Comment Affymetrix No. det2 WT Amplified No-Amp. Amplified No-Amp. FC ± se FC ± se FC ±se FC ± se DWF4/CYP90B1 AF044216 BR biosynthesis (P450) 13870_at −7.5 ± 0.76 −3.4 ± 0.29 −2.8 ± 0.40 −1.8 ± 0.10 CPD/CYP90A1 X87367 BR biosynthesis (P450) 16042_s_at −2.5 ± 0.66 −3.7 ± 0.37 −4.0 ± 1.30 −4.0 ± 0.40 ROT3/CYP90C1 AB008097 Leaf polar elongation (P450) 16535_s_at −4.5 ± 0.45 −3.8 ± 0.17 −2.1 ± 0.10 −2.3 ± 0.05 CYP71B3 D78602 Expression in older leaves (P450) 17039_at −2.6 ± 0.20 −2.3 ± 0.49 −2.3 ± 0.80 −1.3 ± 0.25 PIF3 AF100166 PIF3 14630_s_at −2.1 ± 0.07 −2.1 ± 0.09 −1.1 ± 0.05 −0.1 ± 1.05 NIA1/NR1 X13434 Nitrate reductase (cytokinin-regulated type) 14240_s_at −3.0 ± 0.62 −4.0 ± 0.32 −4.2 ± 0.15 −4.6 ± 0.05 XTR7 U43489 Putative xyloglucan endotransglycosylase 15178_s_at −3.1 ± 0.46 −3.5 ± 0.55 −1.7 ± 0.05 −1.5 ± 0.00 AAP3 X77499 Amino acid transporter (His uptake complement) 12372_at −4.5 ± 0.59 −4.5 ± 0.99 −2.0 ± 0.10 −2.1 ± 0.05 AAP4 X77500 Amino acid transporter (His uptake complement) 16522_at −2.3 ± 0.12 −2.4 ± 0.35 −1.7 ± 0.10 −2.0 ± 0.05 AtKUP1 AF029876 High-affinity potassium transporter 16119_s_at −6.5 ± 0.56 −6.3 ± 0.50 −2.3 ± 0.00 −2.2 ± 0.30 AKT2 U40154 Potassium channel 16163_s_at −4.4 ± 0.71 −2.6 ± 0.23 −2.5 ± 0.10 −1.7 ± 0.00 AtNAS1 AB021934 Nicotianamine synthase 20547_at −3.3 ± 0.12 −3.3 ± 0.31 −2.2 ± 0.20 −2.3 ± 0.25 AtmybL2 Z68157 Leaf-specific myb-related protein 20362_at −2.9 ± 0.42 −2.5 ± 0.33 −2.1 ± 0.70 −1.9 ± 0.55 Athb-5 X67033 Athb family Leu-zipper protein 20389_at −2.4 ± 0.12 −2.2 ± 0.31 −2.4 ± 0.25 −2.1 ± 0.00 MS2-like protein X99923 Fatty acyl CoA reductase homolog 19177_at −2.9 ± 0.43 −3.3 ± 0.35 −8.7 ± 2.60 −4.6 ± 2.10 CYP78A6 AC006418/F13A10.19 P450 monooxygenase 18190_at −7.3 ± 0.73 −2.9 ± 0.59 −3.7 ± 0.50 −1.5 ± 0.30 CYP81H1 Z99707/C7A10.50 P450 monooxygenase 20271_at −3.5 ± 0.18 −3.1 ± 0.59 −2.6 ± 0.00 −1.5 ± 0.35 CYP710A AC004481/F13P17.32 P450 monooxygenase 14856_at −4.1 ± 0.20 −4.4 ± 0.50 −3.9 ± 0.05 −3.4 ± 0.60 CYP96A1 AC002391/T20D16.19 P450 monooxygenase 19281_i_at −3.2 ± 0.12 −2.5 ± 0.65 −2.0 ± 0.40 −1.9 ± 0.55 CYP96A9 AL078620/F23D16.110 P450 monooxygenase 19730_at −2.5 ± 0.23 −2.2 ± 0.38 −1.5 ± 0.00 −1.6 ± 0.00 PAP1/IAA26 AF088281 IAA gene family/putative phytochrome-associated protein 16078_at −3.4 ± 0.49 −2.7 ± 0.07 −2.6 ± 0.20 −2.7 ± 0.25 iaglu U81293 Putative indole-3-acetate β-d-glucosyltransferase 16603_s_at −3.1 ± 0.42 −2.9 ± 0.24 −1.3 ± 0.20 −1.4 ± 0.15 PIN7 AF087820 Putative auxin efflux carrier protein 17576_at −2.2 ± 0.06 −2.2 ± 0.17 −1.7 ± 0.00 −1.6 ± 0.00 MYB55 AF176000 MYB-like gene 17977_at −5.0 ± 0.37 −4.5 ± 1.00 −3.7 ± 0.95 −2.4 ± 0.05 BRD1 AL049746/T23J7.130 Aldose 1-epimerase like protein 12998_at −2.5 ± 0.20 −2.3 ± 0.38 −2.0 ± 0.00 −1.7 ± 0.10 BRD2 AC006836/F19B11.20 Putative sulfotransferase 19127_at −2.5 ± 0.29 −2.5 ± 0.29 −2.0 ± 0.10 −2.2 ± 0.35 BRD3 AL049171/T25K17.30 Putative caffeoyl-CoA O-methyltransferase 19348_at −2.3 ± 0.25 −2.3 ± 0.26 −1.2 ± 0.05 0.0 ± 1.15 BRD4 AL035528/F18A5.290 Leu-rich repeat protein 14110_i_at −4.0 ± 0.35 −1.9 ± 0.38 −2.0 ± 0.10 −1.3 ± 0.10 BRD5/SAUR361-a AC002387/F4L23.28 Auxin-inducible SAUR gene homolog 14448_at −4.4 ± 0.85 −2.9 ± 0.70 −3.0 ± 0.20 −1.7 ± 0.25 BRD6 AL049659/T29H11.120 Putative DNA-binding protein (BTB domain) 19977_at −4.1 ± 0.47 −3.8 ± 0.50 −2.1 ± 0.30 −2.3 ± 0.50 BRD7 AC002335/T01O24.18 MYB-like gene 18780_at −4.2 ± 0.82 −2.7 ± 0.15 −2.2 ± 0.45 −1.2 ± 0.05 BRD8 AC007659/T14P1.14 GATA-type zinc finger protein 13168_i_at −2.2 ± 0.13 −2.2 ± 0.06 −1.6 ± 0.05 −1.7 ± 0.35 BRD9 Z99708/C7A10.580 Unknown 19221_at −3.2 ± 0.15 −3.1 ± 0.23 −2.4 ± 0.40 −2.4 ± 0.15 BRD10 AL035605/F19F18.30 Unknown 19398_at −2.9 ± 0.18 −2.9 ± 0.15 −2.2 ± 0.05 −2.3 ± 0.10 BRD11 AC006224/MFL8.8 Unknown 20174_at −5.2 ± 0.27 −4.2 ± 0.46 −3.6 ± 0.45 −2.4 ± 0.15 BRD12 AC003033/T21L14.19 Unknown 19889_at −2.6 ± 0.22 −2.5 ± 0.28 −0.1 ± 1.35 −0.1 ± 1.15 When genes have names on publications or on database, we adopted their names. Otherwise, we designated genes from BRD1 to BRD12. Amplified and No-Amp., Before and after signal amplification with antibody, respectively.
-
↵F1-a Gene name for SAUR36 is from Hagen and Guilfoyle (2002).
-
Gene Name Accession No. Function or Comment Affymetrix No. det2 WT Amplified No-Amp. Amplified No-Amp. FC ± se FC ± se FC ±se FC ± se IAA3/SHY2 U18406 Auxin-inducible nuclear protein/suppressor of phyB 13301_at 2.4 ± 0.42 2.7 ± 0.29 1.3 ± 0.10 1.3 ± 0.10 IAA5 U18407 Auxin-inducible nuclear protein 13660_i_at 16.8 ± 4.64 7.8 ± 1.02 3.3 ± 0.35 1.8 ± 0.00 SAUR-AC1/−15 S70188 Small auxin up RNA from Arabidopsis Columbia 12608_i_at 9.9 ± 0.55 9.6 ± 1.22 3.3 ± 0.00 3.7 ± 0.25 IAA19 U49075 Member of IAA gene family/IAA1 binding protein 13296_at 3.1 ± 0.25 2.9 ± 0.15 1.8 ± 0.00 2.1 ± 0.20 BAS1/CYP72B1 AC003105/F18A8.8 Activation-tagged suppressor of phyB 12543_at 3.8 ± 0.27 4.2 ± 1.16 2.7 ± 0.05 3.1 ± 0.00 TCH2 AF026473 Touch-induced gene 2/calmodulin-related protein 18300_at 2.5 ± 0.19 2.7 ± 0.24 1.9 ± 0.15 1.8 ± 0.05 TCH4 AF051338 Touch-induced gene 4/xyloglucan endotransglycosylase 16620_s_at 8.8 ± 0.81 16.8 ± 4.62 6.5 ± 0.35 8.2 ± 0.75 XTR6 U43488 Xyloglucan endotransglycosylase-related protein 6 17533_s_at 9.0 ± 1.10 5.7 ± 0.96 5.5 ± 0.45 1.4 ± 2.50 MSS3 AC004450/F14B2.23 Suppressor of snf4/calmodulin-like protein (EF-hand) 20689_at 3.2 ± 0.35 3.8 ± 0.58 1.6 ± 0.15 1.8 ± 0.25 ZAT7 X98676 Zinc finger protein 15778_at 4.2 ± 0.47 2.0 ± 0.15 1.4 ± 0.15 0.1 ± 1.20 ATPA2 X99952 Root-specific peroxidase 12356_at 4.0 ± 2.09 3.0 ± 0.43 1.4 ± 0.20 1.7 ± 0.40 KCS1 AF053345 Fatty acid elongase 3-ketoacyl-CoA synthase 1 17961_at 2.7 ± 0.28 3.0 ± 0.29 1.3 ± 0.05 1.3 ± 0.10 OPR1 U92460 12-Oxophytodienoate reductase (jasmonate biosynthesis) 18253_s_at 2.0 ± 0.03 2.1 ± 0.03 1.4 ± 0.10 1.4 ± 0.10 AtPMEpcrB AF033206 Pectin methylesterase homolog 19267_s_at 4.1 ± 0.32 4.4 ± 0.46 3.3 ± 0.15 3.5 ± 0.10 ATP24a Y11788 Peroxidase 18946_at 2.3 ± 0.15 2.4 ± 0.30 0.0 ± 1.05 1.1 ± 0.05 CYP94C1 AC005824/F15K20.21 P450 monooxygenase 19288_at 10.1 ± 3.32 4.0 ± 0.97 2.0 ± 0.20 1.7 ± 0.25 CYP86A2 AF013293/A_IG005I10.21 P450 monooxygenase 17966_at 2.0 ± 0.09 2.2 ± 0.15 1.3 ± 0.00 1.3 ± 0.00 BRU2/SAUR-25 AL035528/F18A5.180 Auxin-inducible SAUR gene family 13395_at 5.3 ± 0.63 2.6 ± 0.38 1.6 ± 0.05 1.6 ± 0.50 BRU3/SAUR-9 AL022373/T19K4.240 Auxin-inducible SAUR gene family 12947_at 9.0 ± 0.21 9.2 ± 0.65 4.9 ± 0.35 4.9 ± 0.20 BRU4/SAUR16 AL035656/T9A14.140 Auxin-inducible SAUR gene family 13322_at 5.8 ± 0.68 6.5 ± 1.00 2.2 ± 0.05 2.5 ± 0.30 BRU5/SAUR-10 AC006201/T27K22.12 Auxin-inducible SAUR gene family 13781_at 3.0 ± 0.66 3.0 ± 0.06 1.6 ± 0.15 1.7 ± 0.20 BRU6/GH3-22-a AL035601/F6G17.40 Auxin-inducible GH3 gene family 13565_at 2.3 ± 0.17 2.2 ± 0.15 1.3 ± 0.05 1.8 ± 0.35 BRU7/GH3-10 AC005275/F4C21.36 Auxin-inducible GH3 gene family 13812_at 2.2 ± 0.21 2.3 ± 0.15 1.7 ± 0.20 1.8 ± 0.40 BRU8 AC004512/T8F5.9 Putative xyloglucan endotransglycosylase (TCH4 homolog) 17960_at 7.7 ± 0.48 8.0 ± 0.43 2.1 ± 0.35 2.0 ± 0.30 BRU9 AC007067/T10O24.17 Putative endoxyloglucan transferase (EXGT-A3 homolog) 19490_at 22.0 ± 9.17 10.9 ± 2.54 5.2 ± 0.10 3.7 ± 0.00 AtExp8 AC002336/T2P4.4 Putative expansin (expansin2-homolog) 19660_at 3.3 ± 0.57 3.7 ± 0.57 1.3 ± 0.05 1.3 ± 0.05 BRU11 AL035539/F22I13.170 Putative expansin (pollen allergen protein homolog) 19976_at 6.2 ± 0.42 7.2 ± 0.92 2.0 ± 0.00 2.1 ± 0.10 BRU12 AC005169/F6F22.19 Putative extensin with Leu-rich repeat (LRX1 homolog) 18525_at 3.3 ± 0.09 2.4 ± 0.45 1.3 ± 0.20 −0.1 ± 1.10 BRU13 AC005698/T3P18.1 Putative extensin with Leu-rich repeat (LRX1 homolog) 18998_at 2.2 ± 0.15 2.3 ± 0.29 2.0 ± 0.40 2.0 ± 0.50 BRU14 AL049608/T9E8.80 Putative extensin with Leu-rich repeat (LRX1 homolog) 20537_at 2.8 ± 0.15 3.1 ± 0.15 1.6 ± 0.00 1.8 ± 0.00 BRU15 AC003027/F21M11.20 Putative arabinogalactan protein (fasciclin-domain) 16438_at 0.6 ± 0.80 2.2 ± 0.10 1.6 ± 0.10 1.7 ± 0.10 BRU16 AL035601/F6GT17.100 Putative arabinogalactan protein 14947_at 1.5 ± 0.28 2.5 ± 0.18 1.8 ± 0.00 1.8 ± 0.00 BRU17 AF060874 Putative arabinogalactan protein (AtAGP4 homolog) 15107_s_at 1.7 ± 0.37 2.4 ± 0.24 1.5 ± 0.00 1.5 ± 0.00 BRU18 AF069298/T14P8.14 Putative pectinesterase 14612_at 4.0 ± 0.18 4.2 ± 0.26 3.3 ± 0.40 3.6 ± 0.55 BRU19 AL022580/T5K18.200 Putative pectinacetylesterase 19905_at 3.0 ± 0.28 3.6 ± 0.73 2.5 ± 0.45 3.3 ± 0.95 BRU20 AC004077/T31E10.15 Endo-1,4-β-xylanase homolog 15271_at 2.7 ± 0.17 2.9 ± 0.12 1.5 ± 0.05 1.6 ± 0.10 BRU21 AL030978/M4122.170 Ca2+-binding protein homolog 15431_at 3.1 ± 0.25 3.6 ± 0.49 2.3 ± 0.10 2.2 ± 0.00 BRU22 AL022198/F6I18.90 Putative calmodulin-binding protein 19857_at 2.7 ± 0.20 2.7 ± 0.17 1.7 ± 0.10 2.0 ± 0.20 BRU23 AC005970/T6P5.14 Putative protein kinase 14030_at 2.2 ± 0.10 2.4 ± 0.33 1.5 ± 0.15 1.7 ± 0.15 BRU24 AC002339/T11A7.8 Putative receptor kinase (CLV1 homolog) 14112_at 3.4 ± 0.90 2.4 ± 0.32 1.7 ± 0.25 1.8 ± 0.10 BRU25 AC004238/F19I3.16 Leu-rich repeat domain 12251_at 4.5 ± 0.67 4.7 ± 0.72 3.5 ± 0.85 2.6 ± 0.25 BRU26 AC002354/F6P23.7 NAM/NAC gene homolog 13806_at 2.9 ± 0.44 3.0 ± 0.70 1.8 ± 0.30 1.6 ± 0.05 BRU27 AC006533/F20M17.23 Ethylene-Regulated protein ER33 homolog 15403_s_at 3.7 ± 0.25 3.8 ± 0.29 1.9 ± 0.15 2.1 ± 0.20 BRU28 AF128396/T3H13.3 Phosphate-induced gene phl-1 homolog 14077_at 3.2 ± 0.35 5.8 ± 0.29 3.6 ± 0.30 3.5 ± 0.30 BRU29 AL021711/F13C5.140 Pro-rich protein (APG) homolog (GDSL-motif) 16434_at 2.8 ± 0.15 3.0 ± 0.03 2.4 ± 0.40 2.4 ± 0.35 BRU30 AL035353/F16A16.110 Pro-rich protein (APG) homolog (GDSL-motif) 17196_at 3.9 ± 0.38 4.7 ± 0.48 1.9 ± 0.20 2.3 ± 0.25 BRU31 AC005917/F3P11.22 Pollen-specific protein (SF21) homolog 15892_at 2.4 ± 0.18 2.7 ± 0.32 1.8 ± 0.15 1.8 ± 0.25 BRU32 AC005679/F9K20.9 Carrot (Daucus carota) EP1 homolog 17440_i_at 2.7 ± 0.32 3.2 ± 0.55 1.6 ± 0.20 1.6 ± 0.25 BRU33 AC007060/T5I8.14 Phosphatidylinositol/phosphatidylcholine transfer protein homolog 12046_at 3.6 ± 0.34 3.8 ± 0.25 1.9 ± 0.10 1.9 ± 0.15 BRU34 AP007269/A_IG002N01.14 Unknown 12953_at 3.1 ± 0.35 3.3 ± 0.49 1.6 ± 0.05 1.8 ± 0.05 BRU35 AC005169/F6F22.17 Unknown 13916_at 2.2 ± 0.12 3.6 ± 0.20 3.6 ± 0.20 3.8 ± 0.45 BRU36 AC005106/T25N20.6 Unknown 14913_at 3.7 ± 0.34 3.4 ± 0.47 0.1 ± 1.05 0.0 ± 1.10 BRU37 AL049481/T5L19.20 Unknown 14951_at 2.6 ± 0.26 2.8 ± 0.32 2.0 ± 0.10 2.2 ± 0.20 BRU38 AC002535/T30B22.26 Unknown 19880_at 2.6 ± 0.15 2.9 ± 0.25 1.6 ± 0.20 1.6 ± 0.10 BRU39 AC007138/T7B11.21 Unknown 19992_at 3.0 ± 0.21 3.4 ± 0.32 1.6 ± 0.10 1.6 ± 0.05 BRU40 AL022224/F1C12.90 Unknown 12027_at 2.8 ± 0.32 2.5 ± 0.54 1.2 ± 0.05 0.0 ± 1.05 BRU41 AC000348/T7N9.22 Unknown 14443_at 2.1 ± 0.17 2.1 ± 0.12 1.8 ± 0.20 2.0 ± 0.25 BRU42 AC006921/F2H17.17 Unknown 18885_at 2.0 ± 0.12 2.1 ± 0.12 2.0 ± 0.00 2.2 ± 0.10 BRU43 AC004521/F411.31 Unknown 12584_at 2.1 ± 0.15 2.8 ± 0.57 1.4 ± 0.10 1.5 ± 0.45 When genes have names on publications or on database, we adopted their names. Otherwise, we designated genes from BRU2 to BRU43. Ampified and No-Amp., Before and after signal amplification with antibody, respectively.
-
↵F2-a Gene names for SAUR and GH3 genes are from Hagen and Guilfoyle (2002).
-
Gene Name Accession No. Function or Comment Affymetrix No. det2 WT Amplified No-Amp. Amplified No-Amp. FC ± se FC ± se FC ±se FC ± se CYP79B2 AF069495 Cytochrome P450 20479_i_at −0.4 ± 0.70 −0.4 ± 0.68 −1.6 ± 0.35 −2.2 ± 0.05 CYP81D8 AL035601/F6G17.20 Cytochrome P450 14032_at −2.0 ± 0.50 −0.7 ± 1.07 −3.7 ± 0.20 −1.9 ± 0.15 4HPPD AF047834 4-Hydroxyphenylpyruvate dioxygenase 15669_s_at −2.4 ± 0.30 −2.3 ± 0.30 −6.9 ± 1.60 −3.0 ± 0.30 CHI M86358 Chalcone isomerase 20413_at −1.4 ± 0.15 −1.3 ± 0.12 −2.2 ± 0.05 −2.3 ± 0.45 BRI1 AF017056 BRI1 20209_at −1.8 ± 0.06 −1.9 ± 0.13 −2.0 ± 0.05 −2.0 ± 0.20 Eli3-1 X67816 Cinnamyl-alcohol dehydrogenase 13242_at −1.9 ± 0.25 −1.9 ± 0.15 −1.7 ± 0.00 −2.1 ± 0.05 BRD13 AL021713/T9A21.60 Putative protein 13514_s_at −1.9 ± 0.74 −1.8 ± 0.03 −4.0 ± 0.50 −2.0 ± 0.35 BRD14 AC006085/F11M15.3 Putative Ser/Thr protein kinase 16878_at −3.3 ± 0.56 −1.8 ± 0.74 −4.0 ± 0.10 −1.8 ± 0.00 BRD15 AC012562/F17O14.23 Osmotic stress-inducible kinase like-protein 13246_at −1.8 ± 0.39 −0.6 ± 0.83 −3.8 ± 1.10 −1.9 ± 0.70 BRD16 AL049480/F14M19.60 Putative pathogenesis-related protein 18755_at −2.1 ± 0.38 −2.0 ± 0.68 −2.6 ± 0.50 −2.0 ± 0.25 BRD17 AL033545/F7K2.50 Extensin-like protein 12115_at −2.2 ± 0.19 −1.8 ± 0.10 −2.4 ± 0.25 −2.3 ± 0.05 BRD18 AC005662/F13H10.7 Putative embryo-abundant protein 14083_at −2.0 ± 0.15 −1.8 ± 0.27 −2.4 ± 0.15 −2.2 ± 0.15 BRD19 Y12776 Late embryogenesis-abundant protein like-protein 18594_at −1.5 ± 0.09 −1.6 ± 0.09 −2.1 ± 0.05 −2.0 ± 0.00 BRD20 AL021811/F10M6.70 Putative protein 14574_at −2.8 ± 0.38 −2.4 ± 0.52 −1.8 ± 0.15 −2.2 ± 0.15 BRD21 AC007661/T8P21.9 Putative protein 15487_at −1.6 ± 0.12 −1.6 ± 0.29 −1.8 ± 0.55 −2.1 ± 0.05 When genes have names on publications or on database, we adopted their names. Otherwise, we designed genes from BRD13 to BRD21. Amplified and No-Amp., before and after signal amplification with antibody, respectively.
Chl a Chl b Chl a/b mg g−1 fresh wt. BL 0.26 ± 0.04 0.08 ± 0.01 3.22 ± 0.04 Cont 0.50 ± 0.03 0.16 ± 0.01 3.19 ± 0.06 Data are means ± se. Chl, Chlorophyll.
Gene Name Forward Primer Sequence Reverse Primer Sequence TaqMan Probe Sequence CPD CCCAAACCACTTCAAAGATGCT GGGCCTGTCGTTACCGAGTT TCTGCCATCTCCAAGGGTTGAAAGTGC DWF4 GTGATCTCAGCCGTACATTTGGA CACGTCGAAAAACTACCACTTCCT CAGCAAAACAACGGAGCGTCATCG ROT3 ATTGGCGCGTTCCTCAGAT CAAGACGCCAAAGTGAGAACAA CTCACCTCAAAGACCGGATCACTCGAGA BR6ox TGGCCAATCTTTGGCGAA TCCCGTATCGGAGTCTTTGGT ACCGAGTTTCTCAAACAAGGCCCCAAC CYP90D CTCATTACCCTTGCCGTCAAA CAGCTTCATGTTTTCTTCCGTTAG CCTCTCTGATTCTCCTGCTGCCCTCAAT BAS1 TTGGCTTCATACCGTTTGGC TTACAGCGAGTGTCAATTTGGC CGGAGTTCGTACATGCATTGGTCAGAATC Lhcb1.3 GGAGCTCAAGAACGGAAGATTG GGTTCTCTATCGGTCCCTTACCA TGGATTCTTCGTTCAAGCCATCGTCA rbcS1A GCTCTCTTCCGCTACTATGGTTG AAGGCAGCGGAGGACTTAAGT TCAGGCCACTATGGTCGCTCCTTTCA TCH4 CAAGAACATGGAGTCTCTAGGCACT GTGAAAGGAGCTTTAGACCAATCG ACTCGAGTCTTTGGAACGCTGATGATTGG PIF3 TCAGGCTCACCAAAGCTAAGC CACACCAGCTCCACAACTTCA AATCTGCTCAAGACAGGAACCCTTCTCCAC GH3 homolog (BRU6) CGTATATCCAACGGCGATTGT CCAGCAGATGTTCCTGAGCTT TCTTCTCACCCCATCACCGAGTTTCTCA SAUR-AC1 GAGGATTCATGGCGGTCTATG GTTAAGCCGCCCATTGGAT TGGTGCCGGTTTCATACTTAAACCAGCCT IAA3 AGCCTAAACCTTTGGCTTCTGA GGTGATTGGATGCTCATTGGT CTTGCACGTACATATGAACATCTCCCATGG XTR7 TCGACGAGTTTGACCTCACTTG GTCCAGCGACAAAGACAGCATA ACCACAGAGGCAAAATCTTCAACGGAGG AtExp8 CAACCATCACCGTCACAGCTA TGAAGAGGAGGATTGCACCAA AAACTTTTGCCCACCTAACCCTGGCCT KCS1 GCTCAAATACGTGAAGCTTGGA CAGCACGGTTCCGGTTAAA CAACTCTTGCAACGTGACCACCATTCTCT 18S ribosomal RNA CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT TGCTGGCACCAGACTTGCCCTC
