Article Figures & Data
Figures
- Figure 1.
The effect of P withdrawal on shoot fresh weight (A) and shoot P concentration expressed on a dry weight basis (B). Arabidopsis plants were grown hydroponically in a complete nutrient solution (•) or a solution lacking P (○). Plants were 28 d old at the beginning of the experiment. Data are expressed as mean ± SE (n = 3 experiments).
- Figure 2.
Venn diagrams showing the numbers of genes differentially expressed in shoots of Arabidopsis plants in response to 4, 28, and 100 h of P starvation (A); 28 + 4 h of P starvation (late P-responsive genes), 28 h of K starvation, and 28 h N starvation (B); 4 h of P starvation (early P-responsive genes), 28 h of K starvation, and 28 h of N starvation (C). Differentially expressed genes were defined as those with a -fold difference in expression in two biological replicates of 2.5 between shoots of plants grown in solutions lacking specific elements and control plants grown in complete nutrient solutions and harvested at the same growth stage. The identities of genes that were differentially expressed in response to P, K, or N starvation are given in Tables I and II.
- Figure 3.
The MIPS functional categories of genes whose expression had changed early (4 h; Table I) or late (28 or 100 h; Table II) after the withdrawal of P from 28-d-old hydroponically grown Arabidopsis. The AGI number for each gene was used to identify its functional category from the MIPS database (http://mips.gsf.de/proj/thal/db/tables/tables_func_frame.html). When no functional category was given by MIPS, the first predicted category identified in PENDANT was used.
- Figure 4.
The activity of GUS in the leaves of two independent transgenic Arabidopsis lines bearing constructs containing the GUS marker gene under the control of the promoter sequence for the P-sensitive gene, SQD1. Plants were grown hydroponically and fully expanded leaves were harvested 20 h before and 4, 28, 100, and 220 h after withdrawing P. Excised leaves were vacuum infiltrated with staining solution containing 520 mg L–1 5-bromo-4-chloro-3-indolyl β-d-glucopyranoside and incubated overnight at 37°C. To assist the visualization of the blue product, chlorophyll was removed from leaves by stepwise replacement of the staining solution with ethanol and mounted in a solution containing 50% (v/v) glycerol. The transgenic lines were GUS13/4 (top) and GUS22/1 (bottom).
Tables
- Table I.
Genes whose expression was altered 4 h after the withdrawal of P from the nutrient solution
Elements (P, K, or N) were withdrawn from the nutrient solutions supplied to 28-d-old Arabidopsis plants growing hydroponically. Gene expression profiles were determined in shoots 4 h after the withdrawal of P and 28 h after the withdrawal of K or N. Gene expression was calculated as the ratio of transcript abundance in shoots of plants starved of P, K, or N divided by transcript abundance in shoots of plants supplied with full nutrient solution.
Gene Expression Relative to Nutrient Replete Plants GeneChip IDa Expression Levelb P Starved for 4 h K Starved for 28 h N Starved for 28 h Specificityc Other Stimulid Arabidopsis Genome Initiative (AGI) IDe Functional Categoryf 1 2 1 2 1 2 12097_g_at M 0.23 0.03 1.57 1.17 15.26 1.43 -P At2g20870 Expressed protein Unclassified 14633_at M 0.34 0.14 0.70 3.17 1.03 2.30 -P At5g54190 NADPH:protochlorophyllide oxidoreductase A Control of cellular organisation 15178_s_at L 0.23 0.18 0.52 0.75 0.71 1.01 -P t, hs, c, a, b At4g14130 Xyloglucan endotransglycosylase (XTR7) Metabolism 20518_at L 0.39 0.30 1.18 2.11 0.89 3.20 -P At1g10060 LEA76 homolog type 1 Metabolism 12115_at M 5.84 4.50 3.15 0.63 0.90 0.49 +P ms, c, cc At4g22470 Extensin-like protein Unclassified 12332_s_at H 18.10 4.27 0.88 0.20 5.30 0.37 +P At3g12500 Basic chitinase Cell rescue, defense, and virulence 12642_at M 2.54 2.90 1.64 0.71 2.96 0.72 +P At2g15390 Xyloglucan fucosyltransferase, putative Unclassified 12764_f_at H 2.80 4.20 0.32 1.04 2.38 0.84 +P cc At2g02930 Putative glutathione S-transferase Metabolism 13154_s_at H 4.48 11.29 2.07 0.13 2.35 0.09 +P cc At2g43590 Putative endochitinase Cell rescue, defense, and virulence 13244_s_at H 4.91 4.17 3.25 0.47 2.47 0.46 +P w At4g37990 Cinnamyl-alcohol dehydrogenase ELI3-2 Metabolism 13273_at H 3.17 6.96 2.99 1.11 2.42 0.90 +P hs, ms, cc At4g36990 Heat shock transcription factor HSF4 Transcription 13467_at H 2.94 2.74 1.08 0.53 1.08 0.76 +P At3g47420 Putative protein Transport facilitation 13842_at M 4.04 3.71 0.79 0.73 0.75 0.76 +P At1g24140 Putative metalloproteinase Protein fate 14016_s_at M 6.19 3.38 0.70 0.67 2.58 1.99 +P g, c At1g30700 FAD-linked oxidoreductase family Metabolism 14032_at M 2.59 3.47 1.78 0.43 3.59 0.58 +P lo, o, s, c At4g37370 Cytochrome P450-like protein Metabolism 14041_at L 3.45 2.59 0.95 0.79 2.14 0.90 +P At1g09480 Putative cinnamyl alcohol dehydrogenase Metabolism 14635_s_at M 3.16 7.84 0.83 1.23 2.22 0.72 +P c, d At2g14610 Pathogenesis-related PR-1-like protein Cell rescue, defense, and virulence 14636_s_at H 6.48 3.96 2.97 3.05 1.96 1.39 +PK w, c, d At1g75040 Thaumatin-like protein Cellular communication 14638_at H 2.99 2.57 2.13 0.42 2.76 0.35 +P Al, Oz, cc At3g49120 Putative peroxidase Cell rescue, defense, and virulence 14964_at H 2.91 6.73 1.03 0.45 0.61 0.20 +P At1g65500 Expressed protein Unclassified 15137_s_at H 2.86 5.70 0.57 0.30 0.89 0.37 +P cc At2g44790 Phytocyanin Unclassified 15162_at H 9.69 8.20 0.78 0.39 1.85 0.35 +P w, ms At3g04720 Hevein-like protein precursor (PR-4) Unclassified 15216_at H 2.99 2.89 1.44 1.47 1.38 0.98 +P cc At1g09560 Germin-like protein Metabolism 15415_at L 4.55 3.29 1.77 0.38 1.68 0.17 +P At1g22900 Disease resistance response protein-related Cell rescue, defense, and virulence 15665_at M 2.62 5.66 0.20 0.25 2.35 0.50 +P g, c, o At5g04340 Putative c2h2 zinc finger transcription factor Transcription 15672_s_at H 3.83 4.23 2.33 0.77 0.79 0.47 +P g, cc At2g22470 Arabinogalactan-protein (AGP2) Unclassified 15866_s_at H 2.99 3.36 1.76 0.95 2.50 0.85 +P At2g38860 Expressed protein Unclassified 15985_at M 4.03 3.53 0.43 0.61 0.65 0.37 +P Sulf At5g64100 Putative peroxidase Cell rescue, defense, and virulence 16014_at H 2.89 3.28 0.87 0.43 0.60 0.40 +P g, cc At1g75750 Expressed protein Unclassified 16053_i_at H 4.10 4.63 2.23 0.51 3.29 0.34 +P g, lo, w At1g02920 Glutathione S-transferase Metabolism 16150_at H 5.56 9.53 5.84 0.32 11.13 0.19 +P Al, c At4g12480 pEARLI 1 Unclassified 16198_at M 2.59 3.93 0.63 0.46 1.55 0.36 +P At2g28710 Putative C2H2-type zinc finger protein Transcription 16888_at M 4.64 4.12 2.24 0.31 2.07 0.30 +P At2g37770 Aldo/keto reductase family Metabolism 16914_s_at H 19.47 4.44 0.57 0.28 4.14 0.49 +P lo At4g11650 Osmotin precursor Cell rescue, defense, and virulence 17014_s_at H 3.92 59.55 3.87 0.66 0.57 0.22 +P P, d At2g02990 Ribonuclease, RNS1 Metabolism 17413_s_at H 14.85 43.39 0.12 0.48 5.73 0.18 +P lo At5g64120 Putative peroxidase Cell rescue, defense, and virulence 17485_s_at H 44.30 4.66 1.09 0.17 6.02 0.20 +P ms, cc At4g16260 Glycosyl hydrolase family 17 Metabolism 17533_s_at M 4.62 3.69 5.08 0.19 4.26 0.15 +P t, hs, c, a, b At4g25810 Xyloglucan endotransglycosylase (XTR-6) Metabolism 17840_at H 2.94 5.31 0.86 0.67 2.41 0.28 +P cc At2g43570 Endochitinase isolog Cell rescue, defense, and virulence 17894_at H 2.53 5.96 2.28 0.58 1.84 0.40 +P w At2g18690 Expressed protein Unclassified 17899_at H 4.69 11.87 1.68 0.21 1.35 0.23 +P o At4g15610 Expressed protein Unclassified 17907_s_at M 5.13 3.55 0.68 0.34 0.32 0.36 +P lo At2g37750 Expressed protein Unclassified 17930_s_at H 9.13 2.77 0.92 0.41 4.49 0.46 +P ms, lo At4g37520 Peroxidase, prxr2 Cell rescue, defense, and virulence 17963_at H 2.52 25.79 1.06 0.49 0.79 0.27 +P c At4g12470 pEARLI 1-like protein Unclassified 18217_g_at H 3.16 6.07 1.30 0.65 2.50 0.68 +P s, c At1g27730 Salt-tolerance zinc finger protein Transcription 18228_at H 5.83 13.73 3.40 0.65 4.14 0.59 +P ms At3g15356 Lectin-like protein Unclassified 18591_at M 2.83 3.32 2.16 0.73 2.22 0.38 +P o At5g08790 Expressed protein Unclassified 18888_at M 3.56 2.55 0.33 0.51 1.12 0.85 +P At1g15380 Expressed protein Unclassified 18966_at M 2.56 4.93 0.72 0.57 1.25 0.61 +P cc At2g29420 Glutathione transferase, putative Metabolism 19171_at H 4.46 7.62 2.89 0.34 2.48 0.31 +P ms, cc At2g43510 Putative trypsin inhibitor Unclassified 19178_at H 3.32 15.50 1.00 0.46 1.07 0.35 +P hl, c, o At5g20230 Blue copper-binding protein Unclassified 19284_at M 6.02 4.08 1.63 0.77 2.24 0.56 +P ms At2g38240 Putative anthocyanidin synthase Metabolism 19640_at H 2.54 11.96 3.39 0.54 3.39 0.29 +P ms At2g29460 Putative glutathione S-transferase Metabolism 19840_s_at M 3.54 6.47 3.72 0.67 1.93 0.29 +P cc At1g30720 FAD-linked oxidoreductase family Metabolism 19892_at H 2.84 5.76 2.19 0.64 1.40 0.36 +P cc At2g38870 Putative protease inhibitor Protein fate 19991_at H 2.51 7.87 0.50 0.58 1.77 0.47 +P g At2g35980 Similar to harpin-induced protein hin1 from tobacco Cell rescue, defense, and virulence 20194_at H 2.94 3.95 6.40 0.53 2.85 0.57 +P lo, cc At2g17500 Expressed protein Unclassified 20238_at H 3.09 4.09 2.49 1.10 1.95 0.37 +P At3g13790 Glycosyl hydrolase family 32 Metabolism 20269_at M 4.33 4.13 1.19 0.56 2.34 0.52 +P ms At2g45220 Pectinesterase family Metabolism 20287_at M 3.74 6.65 2.12 0.66 1.34 0.53 +P w At3g54420 Glycosyl hydrolase family 19 (class IV chitinase) Cell rescue, defense, and virulence 20420_at M 4.63 3.12 1.52 0.14 1.13 0.11 +P g,c At4g19810 Glycosyl hydrolase family 18/putative chitinase Cell rescue, defense, and virulence 20491_at H 8.86 4.00 2.85 0.27 2.22 0.28 +P w At2g29350 Putative tropinone reductase Unclassified 20499_at M 2.96 4.81 2.09 2.60 1.94 2.12 +P At2g33480 Putative NAM (no apical meristem)-like protein Development 20685_at M 2.55 4.72 2.00 0.85 1.18 0.36 +P o At4g13180 Short-chain alcohol dehydrogenase like protein Metabolism -
↵a Affymetrix probe set number. b Qualitative estimates of absolute gene expression, classified as low (L, Affymetrix signal values < 150), medium (M) and high (H, Affymetrix signal values > 800). c Treatments for which genes were differentially expressed 2.5-fold in two biological replicates. (+), Genes whose expression has increased; (-), Genes whose expression has decreased. d Genes whose expression responds to auxin (a); aluminum (Al); brassinosteroids (b); cold (c); cell-cycle regulated (cc); drought (d); gravity (g); high light (hl); heat shock (hs); low oxygen (lo); mechanical stimulus (ms); oxidative stress (o); ozone (Oz); phosphate stress (P); salinity (s); sulfur deficiency (sulf); touch (t); and wounding and/or pathogen attack (w); see text for references. e AGI numbers and brief descriptions of the transcript identified by BLAST searching and from the descriptions provided by Ghassemian et al. (2002). f Functional categories for genes were identified using the AGI number to search the MIPS database (http://mips.gsf.de/proj/thal/db/; 28/11/02), where no category had been experimentally determined the category with the highest probability score was used.
-
- Table II.
Genes whose expression was altered 28 and 100 h after the withdrawal of P from the nutrient solution
Elements (P, K, or N) were withdrawn from the nutrient solutions supplied to 28-d-old Arabidopsis plants growing hydroponically. Gene expression profiles were determined in shoots 28 and 100 h after the withdrawal of P and 28 h after the withdrawal of K or N. Gene expression was calculated as the ratio of transcript abundance in shoots of plants starved of P, K, or N divided by transcript abundance in shoots of plants supplied with full nutrient solution.
Gene Expression Relative to Nutrient Replete Plants GeneChip IDa Time Point Expression Levelb P Starved for 28 h P Starved for 100 h K Starved for 28 h N Starved for 28 h Specificityc Other Stimulid AGI IDe Functional Categoryf 1 2 1 2 1 2 1 2 17012_at 28 M 2.53 2.55 0.85 1.12 2.92 1.00 0.95 0.52 +P w, d At1g72260 Thionin Cell rescue, defense, and virulence 19186_s_at 28 H 3.36 2.91 10.08 2.27 8.81 1.20 1.53 0.47 +P c, w, d, ab, s At3g50970 Dehydrin Xero2 Cell rescue, defense, and virulence 20641_at 28 H 2.77 3.67 3.31 1.07 2.50 0.47 1.00 0.35 +P d At1g52690 LEA76 homolog type1 Unclassified 14025_s_at 28/100 M 2.54 3.84 3.05 2.84 2.39 2.49 3.56 2.36 +P At2g04160 Subtilisin-like Ser protease AIR3 Protein fate 12608_i_at 100 M 0.94 0.60 0.19 0.32 0.92 1.50 0.43 1.05 -P a, b At4g38850 Small auxin up RNA (SAUR-AC1) Unclassified 13322_at 100 H 0.61 0.68 0.28 0.40 0.42 0.60 0.25 0.54 -P b At4g38860 Putative auxin-regulated protein Unclassified 13660_i_at 100 L 0.76 0.98 0.27 0.37 1.39 1.66 0.23 0.90 -P a, w At1g15580 IAA5 Transcription 13972_at 100 M 0.72 0.66 0.36 0.35 0.43 0.71 0.30 0.69 -P At4g17810 SUPERMAN-like protein Transcription 14048_at 100 M 0.87 0.77 0.28 0.24 0.47 0.81 0.50 1.53 -P c At2g18890 Putative protein kinase Cellular communication 14946_at 100 H 0.45 0.52 0.36 0.39 0.37 0.22 0.47 0.44 -PK At4g21620 Putative protein Unclassified 15084_at 100 M 0.75 0.93 0.35 0.25 0.67 0.81 0.31 0.91 -P c At4g35320 Putative protein Unclassified 15671_s_at 100 M 0.82 1.19 0.40 0.31 0.61 1.11 0.51 1.45 -P w At1g75840 Rac-like GTP binding protein (ARAC5) Cellular communication 15817_at 100 M 0.53 0.63 0.40 0.34 0.42 0.76 0.33 0.69 -P At4g37240 Putative protein Unclassified 16312_at 100 M 0.51 0.53 0.39 0.15 0.47 1.10 0.18 1.05 -P At4g12970 Putative protein Unclassified 18755_at 100 L 1.05 0.79 0.33 0.40 0.68 1.38 1.02 1.90 -P At4g25780 Putative pathogenesis-related protein Cell rescue, defense, and virulence 20575_at 100 L 0.33 0.92 0.35 0.26 0.32 0.76 0.37 1.52 -P At4g32890 Putative protein Transcription 12341_s_at 100 M 1.00 1.53 2.61 4.42 1.76 0.71 3.08 0.76 +P ms At4g20110 Vacuolar sorting receptor-like protein Protein fate 12500_s_at 100 M 2.86 1.56 5.06 4.87 5.62 1.00 5.48 0.65 +P d At1g51760 Indole acetic acid-Ala hydrolase (IAR3) Unclassified 12597_at 100 M 0.83 0.61 5.36 2.63 0.58 1.46 2.17 1.28 +P At2g22780 Putative glyoxysomal malate dehydrogenase precursor Energy 12880_at 100 H 2.18 1.33 2.80 5.33 2.02 1.05 2.96 0.63 +P w, d, g At3g28930 AIG2-like protein Unclassified 13004_at 100 M 1.39 2.16 6.39 3.20 4.12 9.54 2.90 4.71 +PKN c, s At2g17840 Putative senescence-associated protein 12 Unclassified 13230_at 100 H 2.00 0.76 2.89 3.11 0.03 0.95 3.81 1.14 +P At4g16190 Cys proteinase Energy 13666_s_at 100 M 2.10 1.03 2.85 2.88 5.28 1.04 4.35 1.02 +P At2g04400 Putative Indole-3-glycerol phosphate synthase Metabolism 13695_at 100 M 1.37 0.94 3.72 2.76 0.83 1.34 1.70 1.87 +P w At3g20600 Non-race-specific disease resistance protein (NDR1) Cell rescue, defense, and virulence 13934_g_at 100 M 2.58 1.81 2.53 3.43 3.03 2.38 6.32 1.71 +P At4g17230 Scarecrow-like 13 (SCL 13) Transcription 14016_s_at 100 M 2.33 1.37 2.80 2.54 0.70 0.67 2.58 1.99 +P g, c At1g30700 FAD-linked oxidoreductase family Metabolism 14032_at 100 M 1.83 1.37 6.30 5.18 1.78 0.43 3.59 0.58 +P o, c, lo, s At4g37370 Cytochrome P450-like protein Metabolism 14116_at 100 H 2.52 1.17 6.06 2.55 1.88 1.00 4.72 0.92 +P cc At5g26340 Hexose transporter-like protein Transport facilitation 14614_at 100 M 1.83 1.49 3.62 3.41 1.40 1.22 2.14 0.80 +P cc At2g30140 Putative glucosyltransferase Metabolism 14672_at 100 H 2.38 1.30 5.56 2.80 0.98 1.50 3.88 1.44 +P cc, d, g At3g54640 Tryptophan synthase α-chain Metabolism 14978_at 100 M 2.66 2.07 2.69 6.34 1.00 0.94 3.56 1.27 +P At2g43820 Putative glucosyltransferase Metabolism 15124_at 100 H 2.61 1.24 2.60 8.41 1.96 0.79 2.75 0.36 +P g, c At3g30775 Osmotic stress-induced Pro dehydrogenase Metabolism 15156_at 100 H 1.68 1.10 3.14 5.18 1.01 2.05 3.69 1.84 +P At5g50850 Pyruvate dehydrogenase E1 component β-subunit Metabolism 15195_s_at 100 H 2.82 1.29 3.87 2.86 4.52 0.82 3.09 0.64 +P cc At2g30490 Cinnamate-4-hydroxylase Metabolism 15616_s_at 100 H 1.06 2.24 2.85 7.28 2.69 4.35 5.65 2.11 +PK At1g21250 Ser-Thr kinase Cellular communication 15629_s_at 100 H 2.52 1.93 5.08 3.85 4.70 1.07 4.88 0.66 +P At1g17740 Phosphoglycerate dehydrogenase Energy 15656_at 100 M 1.00 0.76 2.72 3.61 1.41 0.68 1.93 1.15 +P At5g54080 Homogentisate 1,2-dioxygenase Unclassified 15866_s_at 100 H 1.20 1.03 2.79 2.47 1.76 0.95 2.50 0.85 +P At2g38860 Expressed protein Unclassified 15976_at 100 M 0.68 1.10 3.09 5.52 1.44 2.21 2.15 1.05 +P cc, sulf At1g21750 Putative protein disulfide isomerase precursor Protein fate 16053_i_at 100 H 1.84 0.94 4.71 3.70 2.23 0.51 3.29 0.34 +P g, lo, w At1g02920 Glutathione S-transferase Metabolism 16077_s_at 100 M 1.22 1.33 3.36 3.04 1.39 2.73 3.87 1.64 +P hm At5g44070 Phytochelatin synthase Unclassified 16440_at 100 M 1.33 1.08 2.53 4.46 2.20 1.02 2.14 0.47 +P lo, c, o At2g40000 Putative nemalode-resistance protein Cell rescue, defense, and virulence 16493_at 100 H 2.35 1.89 2.59 3.71 8.84 0.63 2.53 0.71 +P s, c At1g54010 Myrosinase-associated protein Metabolism 16609_at 100 M 1.74 0.72 4.12 2.64 1.32 0.76 5.50 1.09 +P w, e, cc At5g47220 Ethylene-responsive element-binding factor 2 (EREB2) Transcription 17104_s_at 100 H 1.86 1.36 2.72 2.98 4.47 0.62 3.62 0.38 +P At4g35630 Phospho-Ser aminotransferase Metabolism 17105_at 100 M 2.94 1.07 2.95 3.44 3.28 1.10 7.11 1.32 +P w, lo At5g47910 Respiratory burst oxidase protein Cell rescue, defense, and virulence 17207_at 100 M 1.83 0.82 2.70 3.82 1.43 0.67 4.05 0.72 +P At4g36670 Sugar transporter like protein Metabolism 17413_s_at 100 H 6.29 0.36 8.64 5.51 0.12 0.48 5.73 0.18 +P lo At5g64120 Putative peroxidase Cell rescue, defense, and virulence 17484_at 100 M 0.52 2.95 3.37 3.17 1.30 0.70 0.54 0.45 +P At1g17020 SRG1-like protein Metabolism 17775_at 100 M 1.42 0.84 4.14 2.70 0.77 0.48 3.08 0.47 +P w, ms At1g61800 Glc-6-phosphate/phosphate-translocator precursor Transport facilitation 17877_g_at 100 H 1.54 1.73 2.77 2.66 2.36 0.71 1.92 0.49 +P lo At4g15760 Monooxygenase Metabolism 17917_s_at 100 H 1.07 1.53 4.56 3.68 1.73 2.54 2.49 1.94 +P At2g41090 Putative calcium binding protein CaBP-22 Cellular communication 17930_s_at 100 H 3.07 1.68 7.35 3.27 0.92 0.41 4.49 0.46 +P ms, lo At4g37520 Peroxidase, prxr2 Cell rescue, defense, and virulence 18228_at 100 H 2.29 0.96 5.23 3.21 3.40 0.65 4.14 0.59 +P ms At3g15356 Lectin-like protein Unclassified 18946_at 100 M 3.05 0.48 3.46 2.88 5.39 0.31 4.19 0.29 +P ms At5g39580 Peroxidase ATP24a Cell rescue, defense, and virulence 19373_at 100 M 0.77 1.67 2.71 3.46 0.80 1.09 2.55 2.16 +P At2g29670 Expressed protein Unclassified 19614_at 100 H 2.78 2.05 3.28 3.77 3.62 0.15 0.68 0.23 +P At1g09500 Putative cinnamyl alcohol dehydrogenase Metabolism 19640_at 100 H 2.97 1.60 4.31 3.81 3.39 0.54 3.39 0.29 +P ms At2g29460 Putative glutathione S-transferase Metabolism 19704_i_at 100 H 4.82 1.23 3.98 4.42 1.77 1.09 4.94 1.49 +P ms At5g24160 Squalene monooxygenase 1,2 (squalene epoxidase 1,2) Metabolism 19843_at 100 M 2.84 0.92 3.11 3.19 2.16 1.16 3.69 2.14 +P At1g61890 Expressed protein Transport facilitation 19844_at 100 M 1.13 0.69 2.57 3.60 1.79 0.72 2.52 0.63 +P w At4g38540 Monooxygenase 2 (MO2) Metabolism 19991_at 100 H 1.00 0.95 6.61 2.66 0.50 0.58 1.77 0.47 +P g At2g35980 Similar to harpin-induced protein hin1 from tobacco Cell rescue, defense, and virulence 20344_at 100 M 0.93 1.72 2.88 2.79 1.20 2.02 1.02 1.74 +P At2g15090 Putative fatty acid elongase Metabolism 20442_i_at 100 H 0.97 0.75 2.63 2.87 1.49 0.32 1.52 0.74 +P At1g16410 Putative cytochrome P450 protein Metabolism -
↵a Affymetrix probe set number. b Qualitative estimates of absolute gene expression, classified as low (L, Affymetrix signal values < 150), medium (M), and high (H, Affymetrix signal values > 800). c Treatments for which genes were differentially expressed 2.5-fold in two biological replicates. (+), Genes whose expression has increased; (-), Genes whose expression has decreased. d Genes whose expression responds to auxin (a); abscisic acid (ab); brassinosteroids (b); cold (c); cell-cycle regulated (cc); drought (d); ethylene (e); gravity (g); high light (hl); heat shock (hs); low oxygen (lo); mechanical stimuli (ms); salinity (s); sulfur deficiency (sulf); and wounding and/or pathogen attack (w); see text for references. e AGI numbers and brief descriptions of the transcript identified by BLAST searching and from the descriptions provided by Ghassemian et al. (2002). f Functional categories for genes were identified using the AGI number to search the MIPS database (http://mips.gsf.de/proj/thal/db/; 28/11/02), where no category had been experimentally determined the category with the highest probability score was used.
-
- Table III.
Genes selected for quantitative PCR to confirm Affymetrix GeneChip results
Genes were selected to have contrasting magnitudes (low, L; medium, M; or high, H) and change in gene expression when assayed using Affymetrix GeneChips in response to the withdrawal of P from hydroponcally grown 28-d-old Arabidopsis for 4, 28, and 100 h. The primers used for quantitative PCR are indicated. -, not determined.
Expression Level GeneChip Analysis GeneChip ID AGI ID Forward Primer Reverse Primer Mean-Fold Change on GeneChip Fold Change for Quantitative PCR P Starved for 4 h P Starved for 28 h P Starved for 100 h P Starved for 4 h P Starved for 28 h P Starved for 100 h L Down at 4 h 20518_at At1g10060 AATAGAGGGGATGAAAGC ATGAACAGAAGGAGAATGC 0.34 1.23 0.44 1.00 0.78 0.20 H Up at 4 h 17963_at AT4g12470 CCTCTCTTGCTCTTTTCTTTG GGGACTGGCTTTGGTTTAG 14.15 1.43 0.96 0.14 1.78 0.01 H Up at 4 + 28 h 17014_s_at At2g02990 CTTGCCTTCTGTCTTCTCTG GGATAACAACACTTCTTCTGTG 31.73 4.77 1.88 3.33 11.41 8.45 M Down at 100 h 14048_at At2g18890 GGATAACAAGAGGAGGAAGAGATG CAACAACCAAGAAGAGACAAGAC 0.58 0.82 0.26 0.97 1.50 0.42 M Up at 100 h 12597_at At2g22780 GCTTCCCTTCTTCGCATC GCCTTCTCTAATCCCATCCTC 1.57 0.72 4.00 1.52 1.79 1.54 H Up at 100 h 14116_at At5g26340 GCCGTTCCGTTGTTCTTG CTTGGCGGTCCCATAGTTG 2.35 1.85 4.31 0.32 4.45 0.77 H Up at 100 h 15629_s_at At1g17740 GAAGGGGAGGTTGAAAGTGG CACCGTATTAGCCGTTGGAG 3.74 2.22 4.47 0.29 4.79 3.23 H Up at 100 h 17104_s_at At4g35630 ACACGCCTCCTTGCTTTG GCTTTCCTCTGGTTCTTCTTCTC 2.01 1.61 2.85 0.60 5.45 3.08 M Up at 100 h 17775_at At1g61800 AAGAAAGGGATGAAAGGGAAG CACGGCAATAGAAAATGGAG 2.74 1.13 3.42 1.11 19.76 5.14 - - Not present 18s rRNA CATAAACGATGCCGACCAG AGCCTTGCGACCATACTCC 1.13 1.25 1.15 - - Not Present IPS1 AGGGGATGGCCTAAATACAAAATG GGGAGATAAACAAAACTCGCAGTC 0.89 14.68 1143.05 - - Not Present SQD1 CACCACCCGAAACATCTACC ACCGCAATAACCATCTCCAC 0.68 2.1 4.5 - Table IV.
The occurrence of novel cis-regulatory elements in the promoters of genes whose expression changed early or late in response to P withdrawal in the experiments reported here (Tables I and II) and cis-regulatory elements previously identified as common to genes whose expression responded to P starvation
The occurrence of these cis regulatory elements in the promoters of all genes on the Affymetrix GeneChip are given for comparison. —, not determined.
No. of Genes with Element Upstream of Start Codon Element Name Element Sequence Early P-Responsive Genes Late P-Responsive Genes Affymetrix GeneChip Reference No. % No. % No. % Novel elements PHO-like C(G/T/A)(C/T/A)GTGG 18 32.1 — — 588 7.1 — TATA box-like TATAAATA 20 35.7 — — 753 9.1 — P-responsive elements PHR1-binding site GNATATNC 10 16.7 9 17.6 1498 18.2 Rubio et al. (2001) PHO element CACGT(G/C) 17 28.3 16 31.4 1574 19.1 Mukatira et al. (2001) ATGCCAT 1 1.7 2 3.9 349 4.2 Mukatira et al. (2001) Helix-loop-helix CA(T/G)(A/C)TG 32 53.3 23 45.1 4431 53.7 Mukatira et al. (2001) NIT 2 TATC(A/T)(A/T) 42 70.0 36 70.6 6296 76.3 Mukatira et al. (2001)
