Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds

Identification and Physiological Characterization of New AAO3 Alleles

During the course of a screening for mutants able to germinate and develop green cotyledons under inhibitory concentrations of NaCl, we identified four complementation groups, which were named sre1 to sre4, in a germination assay (Gonzalez-Guzman et al., 2002). The sre2 mutant was able to bypass the developmental arrest induced by high-osmoticum, that is, 200 mm NaCl or 400 mm mannitol (Fig. 1A ). Two allelic mutants (in a Col genetic background), sre2-1 and sre2-2, were identified for this locus (Table I). Genetic analysis indicated that the mutant phenotype was caused by a single recessive mutation (Table I). ABA promotes the inhibition of both seed germination and early seedling development under low-water-potential conditions. Therefore, screenings for mutants able to bypass the ABA-mediated blockage of germination and development under osmotic stress usually result in the identification of ABA-deficient mutants (Leon-Kloosterziel et al., 1996; Quesada et al., 2000; Gonzalez-Guzman et al., 2002). Indeed, complementation analyses of both sre2-1 and sre2-2 showed that they were allelic to aao3-1 (Table I), which is the only mutant allele described currently for the AAO3 gene. Therefore, we renamed sre2-1 and sre2-2 mutants as aao3-2 and aao3-3, respectively. The aao3-1 allele was identified in a mutant showing a mild wilty phenotype under greenhouse conditions. Transpiration assays of aao3-2 and aao3-3 mutants also indicated enhanced water loss as compared to wild type (Fig. 1B).

• Download figure
• Open in new tab
• Download powerpoint

Figure 1.

Phenotype of sre2-1 and sre2-2 mutants. A, Seed germination in the presence of NaCl and mannitol. Wild-type Col ecotype (left), sre2-1 (middle), and sre2-2 (right) seeds were germinated on either MS medium (MS) or medium supplemented with either 200 mm NaCl or 400 mm mannitol. The picture was taken at 4, 5, and 6 d after sowing. B, Enhanced transpiration rate of sre2-1 (aao3-2) and sre2-2 (aao3-3) plants compared to wild type. Percentage of initial fresh weight was measured in detached rosette leaves of either Col (black circles), sre2-1 (white circles) or sre2-2 (white triangles) plants.

As both aao3-2 and aao3-3 were isolated in a screening based on seed germination under high-osmoticum, we presumed that they could have reduced ABA levels in seeds. To experimentally support this hypothesis, we measured ABA levels both in dry seeds and seeds imbibed and incubated for 24 h in 200 mm NaCl (Table II). ABA levels in dry seeds of aao3-2 and aao3-3 were approximately 35% of wild type. Interestingly, upon seed imbibition and incubation in 200 mm NaCl, ABA levels were still approximately 3-fold lower in aao3-2 and aao3-3 than in wild type. In addition to the phenotypes observed in seeds of aao3-2 and aao3-3 mutants, we also noticed a wilty phenotype under low humidity conditions (Fig. 1B). Therefore, we also measured ABA levels in rosette leaves of both aao3-2 and aao3-3 under unstressed or water-stress conditions (Table II). Rosette leaves of aao3-2 and aao3-3 mutants contained less ABA than wild type, and ABA levels upon water stress were notably lower in the mutants compared to wild type.

Molecular Characterization of the aao3-2 and aao3-3 Alleles

The aao3-2 and aao3-3 mutants were isolated from a seed population mutagenized with T-DNA. Therefore, we analyzed whether the mutant phenotypes were linked to a T-DNA insertion. Homozygous aao3-2 plants were crossed to Col wild-type plants. From the segregating F₂ generation, homozygous aao3-2 individuals were selected and scored for the presence of the T-DNA by Southern blot analysis. The analysis of 88 F₂ chromosomes revealed cosegregation of the salt-resistant phenotype and the presence of the T-DNA (data not shown). Plant T-DNA flanking sequences were isolated by plasmid rescue, and sequence analysis revealed that the T-DNA was inserted at nucleotide 282 of AAO3 (Fig. 2A ). The T-DNA insertion in the aao3-2 allele abolished the expression of the AAO3 gene, as detected by northern blot analysis (Fig. 2B).

• Download figure
• Open in new tab
• Download powerpoint

Figure 2.

Molecular characterization of the aao3-2 and aao3-3 alleles. Northern blot analysis of AAO3 mRNA. A, Structure of the AAO3 gene and mutations in the aao3-2 and aao3-3 alleles. The position of the T-DNA insertion in aao3-2 is indicated. The three-nucleotide deletion and missense mutations present in aao3-3, as well as the predicted amino acid substitutions, are shown. A TaiI restriction site is underlined in the wild-type nucleotide sequence. Amino acid numbering refers to the initial Met residue. Nucleotide numbering refers to the ATG start codon. B, Northern blot analysis of AAO3 gene expression in Col wild type, aao3-2 and aao3-3 mutants. Each track of the blot contained approximately 10 μg total RNA extracted from rosette leaves. RNA analysis was performed as described previously (Gonzalez-Guzman et al., 2002). RNA loading of the gel was quantified by hybridization with a tubulin probe (TUB). C, Northern blot analysis of AAO3 gene expression in siliques (left) and seeds (right). For siliques, increasing amounts (5, 10, and 20 μg) of total RNA from Col wild type and 20 μg total RNA from aao3-2 mutant were loaded in the blot. For seeds, approximately 20 μg of total RNA were loaded. Total RNA was extracted from seeds that were imbibed for 60 h and then mock-treated (−) or incubated with 400 mm mannitol for 24 h (+). RNA loading of the gel was visualized by ethidium bromide staining.

A similar analysis to the one described above failed to show cosegregation between the salt-resistant phenotype of aao3-3 mutant and a T-DNA insertion. Sequence analysis of the AAO3 gene in aao3-3 revealed a complex mutation that affects a gene stretch from nucleotides 3,066 to 3,080, including deletion of three nucleotides and resulting in several missense mutations (Fig. 2A). This mutation leads to loss of a TaiI restriction site, and, consequently, a CAPS marker was developed based on this DNA polymorphism. Analysis of F₂ chromosomes of homozygous aao3-3 individuals revealed cosegregation of the three-nucleotide deletion observed in the AAO3 gene with the ABA-deficient phenotype (data not shown). Contrary to the aao3-2 mutation, the aao3-3 mutation does not appreciably affect the level of AAO3 mRNA (Fig. 2B).

The AAO3 Gene Plays an Important Role in ABA Biosynthesis Both in Leaves and Seeds

The role of AAO3 in ABA biosynthesis had been restricted to leaves on the basis that seed dormancy of aao3-1 mutant was unaffected and its ABA levels in mature dry seeds were only reduced by 40% compared to the wild type (Seo et al., 2000a). Additionally, gene expression studies failed to detect the AAO3 transcript both in siliques and dry seeds from a Col ecotype (Seo et al., 2000b). As both aao3-2 and aao3-3 were isolated in a seed germination screening, we reasoned that AAO3 gene product must contribute to ABA biosynthesis in seeds. Indeed, ABA levels in dry seeds or seeds imbibed and treated with 200 mm NaCl of both aao3-2 and aao3-3 were approximately one-third of wild type (Table II). We have reexamined the expression level of AAO3 in siliques using increasing amounts of total RNA. Between 10 and 20 μg of total RNA from siliques was required to detect AAO3 by northern blot analysis (Fig. 2C). Using only 5 μg, we could not detect the transcript (in agreement with Seo et al., 2000b). Likewise, in dry seeds we were not able to detect AAO3 mRNA (data not shown); however, upon imbibition and osmotic stress treatment, we could detect it (Fig. 2C).

To further investigate the role of AAO3 in seeds, we compared the phenotype of all three aao3 alleles in seed germination assays. The aao3-1 mutant, as well as aao3-2 and aao3-3 mutants, showed an osmotolerant phenotype in seed germination (Table III). However, whereas aao3-2 and aao3-3 mutants were able to germinate under 10 μm paclobutrazol, aao3-1 was not (Table III). Additionally, aao3-2 and aao3-3 mutants showed a reduced dormancy, whereas aao3-1 showed a dormancy similar to wild type (Table III). These data reveal notable phenotypic differences among aao3-1 and the new aao3 alleles and suggest that, at least in a Col genetic background, the AAO3 gene product plays a role in seed ABA biosynthesis.

The demonstration that, for the aao3-2 and aao3-3 independent mutant alleles, a heritable change in phenotype is associated with a mutation in AAO3 suggests that this gene is responsible for the phenotype being studied. Therefore, introduction of a wild-type AAO3 allele in aao3-2 and aao3-3 should complement the phenotype observed in the mutants. The AAO3 gene driven by its own promoter region (Pro_AAO3-AAO3 construct; Seo et al., 2000a) was introduced into aao3-2 and aao3-3 mutants by Agrobacterium tumefaciens-mediated transformation. Transformants were selected for kanamycin resistance, and a T3 population homozygous for the transgene was obtained. Experiments of seed germination and early seedling growth under high-osmoticum, as well as measures of leaf transpiration, indicated that the phenotype of aao3-2 and aao3-3 mutants was complemented upon introduction of a wild-type AAO3 transgene (Fig. 3 ). These results confirm that in a Col genetic background, the AAO3 gene plays an important role in ABA biosynthesis both in leaves and seeds.

• Download figure
• Open in new tab
• Download powerpoint

Figure 3.

Complementation of aao3-2 and aao3-3 mutants by AAO3 gene. A, Seed germination and early seedling growth in the presence of NaCl or mannitol. Wild-type (Col), aao3-2, aao3-3, and T3 homozygous progeny of the mutants transformed with the binary vector pPZP211 containing a Pro_AAO3-AAO3 insert. Seeds were germinated on MS medium (MS) or medium supplemented with either 200 mm NaCl or 400 mm mannitol. The picture was taken at 10 d after sowing. B, Percentage of seeds that germinated and developed green cotyledons under osmotic stress for wild-type, aao3-2, aao3-3, and representative transformed lines (T3 progeny) of aao3-2 and aao3-3. Seeds were sowed on MS agar plates supplemented either with 200 mm NaCl (white bars) or 400 mm mannitol (black bars). Approximately 200 seeds were sowed and scored 5 (NaCl) or 8 (mannitol) d later. Germination in MS medium was between 95% and 100%. C, The enhanced transpiration rate of both aao3-2 and aao3-3 plants is complemented by a wild-type AAO3 transgene. Loss of fresh weight was measured in detached rosette leaves of wild type, aao3-2, aao3-3, and T1 transformed lines of aao3-2 and aao3-3. Four leaves per individual were excised, and fresh weight was determined at ambient conditions (25°C and approximately 40% relative humidity) after 60 min. The percentage of fresh weight lost is indicated.

Plant Material

Arabidopsis plants (ecotype Columbia) were routinely grown under greenhouse conditions in pots containing a 1:3 perlite-soil mixture. For in vitro culture, seeds were surface-sterilized by treatment with 70% ethanol for 20 min, followed by commercial bleach (2.5%) containing 0.05% Triton X-100 for 10 min, and, finally, four washes with sterile distilled water. Stratification of the seeds was conducted during 3 d at 4°C. Afterward, seeds were sowed on Murashige and Skoog (MS) plates (Murashige and Skoog, 1962) containing solid medium composed of MS basal salts and 1% Suc, solidified with 1% agar and pH adjusted to 5.7 with KOH before autoclaving. Different concentrations of NaCl and mannitol were made by adding appropriate amounts of reagents to the basal medium. Plates were sealed and incubated in a controlled environment growth chamber at 22°C under a 16-h light, 8-h dark photoperiod at 80 to 100 μE m⁻² s⁻¹.

Screening Conditions

T-DNA lines were constructed in the D. Weigel laboratory (Salk Institute, La Jolla, CA) using the pSKI15 vector. Approximately 17,000 lines, stock numbers N21995 and N21991, were provided by the Arabidopsis Biological Resource Center (Ohio State University, Columbus). The distributed T-DNA pools are T4 seeds. Approximately 2 × 10⁵ seeds were screened at high seed density (50 petri plates of 14-cm diameter containing approximately 4,000 seeds per plate) on MS medium (plus 1% Suc) containing 200 mm NaCl. Seeds were considered to be salt-resistant only after they produced fully green expanded cotyledons. Selected salt-resistant candidates (T4) were grown in soil to obtain the T5 progeny for further studies. The T5 progeny of the candidates was retested at low seed density (up to 200 seeds per 9-cm-diameter petri plate) under 150 to 200 mm NaCl.

Genetic Analysis of sre2 Mutants

Backcrosses of sre2 mutants to the wild type, intercrosses among sre2 mutants as well as those of sre2 with aba mutants were performed by transferring pollen to the stigmas of emasculated flowers. F₁ and F₂ seeds were scored for germination in 150 to 200 mm NaCl. In order to map the sre2-2 (aao3-3) locus, homozygous sre2-2 plants (in a Col background) were crossed to wild-type plants of the Ler background. From the segregating F₂ generation, homozygous sre2-2 individuals were selected, and DNA was individually extracted. Mapping of the sre2-2 locus was carried out by testing linkage with simple sequence length polymorphism (SSLP) markers (Bell and Ecker, 1994; Lukowitz et al., 2000). The analysis of 44 F₂ chromosomes revealed linkage of the sre2-2 locus and the nga1126 marker (which is only 150 kb away from AAO3).

A CAPS molecular marker (Konieczny and Ausubel, 1993) was developed based on the three-nucleotide deletion present in the AAO3 gene of sre2-2. This mutation destroys a TaiI restriction site, and therefore TaiI digestion of a 1-kb AAO3 DNA fragment amplified using the primers F2672 and R3661 (see below) reveals polymorphic bands in sre2-2 compared to wild type. Thus, TaiI digestion of AAO3 DNA amplified from wild type leads to four DNA fragments (154, 186, 228, and 395 bp). Instead, TaiI digestion of AAO3 DNA amplified from F₂ sre2-2 individuals leads to three DNA fragments (228, 340, and 395 bp).

Germination Assays

Seeds were plated on solid medium composed of MS basal salts, 1% Suc, and 150 to 200 mm NaCl or 400 mm mannitol. After the indicated days of incubation, the percentage of seeds that had germinated and developed fully green expanded cotyledons was determined. To measure paclobutrazol sensitivity, seeds were plated on medium containing 10 μm paclobutrazol, and germination was determined after 7 d.

ABA Extraction and Determination

Dry seeds, seeds imbibed for 60 h and incubated for 24 h in 200 mm NaCl, as well as rosette leaves of unstressed or drought-stressed plants (unwatered for a week) were ground to a fine powder with mortar and pestle under liquid nitrogen. Duplicate samples (50 mg dry weight each) were extracted with 5 mL 80% acetone containing 100 mg/L 2,6-ditert-butyl-methyl phenol (BHT) and 500 mg/L citric acid, for 16 h at 4°C in the dark. The extracts were further homogenized in a polytron homogenizer at maximum speed for 1 min and centrifuged at 3,000g for 5 min. A 1-mL aliquot of the extract was evaporated in a vacuum centrifuge. The sample was resuspended in 100 μL Tris saline buffer (TBS, 50 mm Tris, 1 mm MgCl2, 150 mm NaCl, pH 7.8) and analyzed directly or diluted with TBS in order to fit the ABA content of the extracts within the linear range of the ABA standard curve of the assay. Quantitative analysis of ABA was performed by the indirect ELISA method, using the Phytodetek ABA kit (Agdia, Elkhart, IN).

Molecular Characterization of aao3-2 and aao3-3 Alleles

Plasmid rescue was used to isolate plant DNA flanking sequences of the T-DNA insertion in aao3-2. To this end, 5 μg genomic DNA from a aao3-2 homozygous plant was digested with BamHI (left border rescue). The reaction mixture was extracted once with an equal volume of phenol:chloroform:isoamylalcohol (25:24:1, v/v), once with chloroform:isoamylalcohol (24:1, v/v), and then ethanol precipitated. The DNA was ligated in a 100-μL reaction, and the ligation mixture was precipitated with ethanol. Ligated DNA was introduced by electroporation into the Escherichia coli XL-1-Blue MRF′ strain (Stratagene, La Jolla, CA). The transformed colonies contained two classes of plasmid. The most common class contained a plasmid whose restriction pattern corresponded to a direct repeat of T-DNA. The second class was represented by the plasmid PR9B. Sequence analysis of the PR9B plasmid revealed that the T-DNA insertion in the aao3-2 mutant is located at nucleotide 282 of AAO3.

In order to identify the mutation occurring in aao3-3, oligonucleotides (see below) were designed according to the AAO3 gene sequence (At2g27150), and overlapping fragments encompassing the entire gene were PCR-amplified from aao3-3. The amplified products were sequenced on both strands. To avoid errors caused by PCR, three independent PCR samples were mixed and batch sequenced. The following oligonucleotides were used:

• F5: 5′AAATCTAACCTTATAATTGG

• R1010: 5′ATGTTATGAAGCTCAGCCAC

• F900: 5′CAAAGACCATCTTGTAACAT

• R1880: 5′ATCAAGACTACATATTCTAT

• F1800: 5′CACCTTGCACTCGGAATATA

• R2790: 5′GAAGTACTGTGACCCTAGCC

• F2672: 5′GCTGAGCGAAAGATAATCTCC

• R3661: 5′GGTACTCGAGAAATCCCTCTC

• F3550: 5′GATCCTGATGAATATACACTGCC

• R4544: 5′CAGTAGTGTACTCTTCCATCATG

• F4360: 5′TCCGATATTATTTATGACTGTGG

• R5139: 5′TGTAACTTAGCAGCAACGAGAG

Upon request, all novel materials described in this publication will be made available in a timely manner for noncommercial research purposes, subject to the requisite permission from any third-party owners of all or parts of the material. Obtaining any permissions will be the responsibility of the requestor.