Research ArticleArticle

Cyanobacterial Phytochrome2 Regulates the Heterotrophic Metabolism and Has a Function in the Heat and High-Light Stress Response

Manti Schwarzkopf, Yong Cheol Yoo, Ralph Hückelhoven, Young Mok Park, Reinhard Korbinian Proels

Published April 2014. DOI: https://doi.org/10.1104/pp.113.233270

Abstract

Cyanobacteria combine the photosynthetic and respiratory electron transport in one membrane system, the thylakoid membrane. This feature requires an elaborate regulation mechanism to maintain a certain redox status of the electron transport chain, hence allowing proper photosynthetic and respiratory energy metabolism. In this context, metabolic adaptations, as seen in the light-to-dark and dark-to-light transitions, are particularly challenging. However, the molecular basis of the underlying regulatory mechanisms is not well-understood. Here, we describe a function of cyanobacterial phytochrome2 (Cph2), a phytochrome of the cyanobacterial model system Synechocystis sp. PCC 6803, in regulation of the primary energy metabolism. When cells are shifted from photoautotrophic planktonic growth to light-activated heterotrophic growth and biofilm initiation, knockout of Cph2 results in impaired growth, a decrease in the activity of Glc-6-P dehydrogenase, a decrease of the transcript abundance/activity of cytochrome-c-oxidase, and slower phycocyanin degradation. Measurements of the plastoquinone reduction confirm an impaired heterotrophic metabolism in the cph2 knockout. When cells that were adapted to heterotrophic metabolism are shifted back to light conditions, the knockout of Cph2 results in an altered photosystem II chlorophyll fluorescence induction curve, which is indicative of an impaired redox balance of the electron transport chain. Moreover, Cph2 plays a role in the heat and high-light stress response, particularly under photomixotrophic conditions. Our results show a function of Cph2 in the adaptation of the primary energy metabolism to changing trophic conditions. The physiological role of Cph2 in biofilm formation is discussed.

Cyanobacteria are prokaryotes, which perform oxygenic photosynthesis. Among them, the unicellular cyanobacterium Synechocystis sp. PCC 6803 is a well-characterized model system capable of photoautotrophic, photomixotrophic, and heterotrophic metabolism. In cyanobacteria, the intensity and quality of light activate various signal transduction pathways regulating physiological adaptations (Mullineaux, 2001; Karniol et al., 2005; Rockwell et al., 2006). During its lifecycle, Synechocystis sp. needs to sense and adjust to changing light conditions caused by diurnal, seasonal, and directional fluctuations. Several photoreceptors of the phytochrome superfamily have been identified and characterized in Synechocystis sp., in particular, cyanobacterial phytochrome1 (Cph1) and Cph2, exemplifying two cyanobacterial phytochrome subfamilies (Yeh et al., 1997; Park et al., 2000; Ng et al., 2003; Karniol et al., 2005). Cph2 holds three cGMP-specific phosphodiesterases, adenylyl cyclases and FhlA (GAF) domains, with the N-terminal GAF domains mediating red/far-red photosensing (Park et al., 2000; Wu and Lagarias, 2000) and the C-terminal GAF domain mediating blue and UV-A light photosensing (Wilde et al., 2002; Moon et al., 2011). Other than the photosensing GAF domains, Cph2 carries two GGDEF domains and one EAL domain, which mediate the synthesis or the breakdown of c-di-GMP, respectively. Savakis et al. (2012) showed that the C-terminal GGDEF domain and the EAL domain of Cph2 are functional and that Cph2 controls cell motility by light-dependent regulation of the c-di-GMP content. c-di-GMP is an ubiquitous prokaryotic second messenger particularly related to motility and biofilm formation (Simm et al., 2004; Jenal and Malone, 2006; Römling and Amikam, 2006; Cotter and Stibitz, 2007). Bacteria realize different benefits from growth in biofilms (e.g. in relation to nutrient sequestration), and for some species, biofilms might represent the default mode of bacterial growth (Jefferson, 2004). Synechocystis sp. was isolated from biofilms in wastewater treatment plants (Di Pippo et al., 2012). Moreover, Synechocystis sp. biofilms were reported to be found on marine snow particles in the German Waddensea (Gram et al., 2002). Those marine/lake snow particles consist of organic/inorganic particles and associations of a diverse community of microorganisms and play an essential role in the vertical transport of organic matter in aquatic environments (Fowler and Knauer, 1986). Bacterial concentrations on snow particles, which are sites of elevated heterotrophic activity, are orders of magnitude higher than ambient concentrations (Ploug and Grossart, 1999; Ploug et al., 1999; Grossart and Tang, 2010).

Synechocystis sp. is capable of light-activated heterotrophic growth (LAHG; that is, the cells require several minutes of light every 24 h to maintain growth in the dark in Glc-containing media). Electrons from heterotrophic sources may enter the electron transport chain (ETC) by NAD(P)H dehydrogenase or succinate dehydrogenase and originate from the oxidative pentose phosphate pathway, with Glc-6-P dehydrogenase (G6PDH) as a rate-determining enzyme (Yang et al., 2002a, 2002b), or the glycolysis/tricarboxylic acid cycle. Under heterotrophic conditions, the pentose phosphate pathway accounts for a major part of Glc catabolism and the NADPH production (Yang et al., 2002b). The cytochrome-c-oxidase (cyt-c-ox) is a terminal oxidase found in both thylakoid and cytoplasmic membranes. Under heterotrophic conditions, the plastoquinone (PQ) pool is mainly oxidized by cyt-c-ox (Vermaas, 2001; Peschek et al., 2004). Synechocystis sp. combines the photosynthetic and respiratory ETCs in one membrane system, the thylakoid membrane. Electrons from either PSII or heterotrophic sources proceed by PQ, thus representing the first point of confluence (Vermaas, 2001). This feature requires an elaborate regulation mechanism to maintain a certain redox balance of the ETC, hence making proper photosynthetic and respiratory energy metabolism possible. Moreover, stress-induced redox imbalances within the ETC may result in oxidative damage.

Physiological studies on Cph2 were focusing on motility phenotypes under constant trophic conditions (Wilde et al., 2002; Fiedler et al., 2005; Moon et al., 2011; Savakis et al., 2012). Here, we address the function of Cph2 in the adaptation from photoautotrophic planktonic growth to heterotrophic conditions and biofilm initiation. Thereby, Cph2 regulates two key metabolic enzymes, G6PDH and cyt-c-ox. Moreover, we analyze the role of Cph2 in the course of heat and high-light stress and show that related phenotypes manifest particularly under photomixotrophic conditions.

RESULTS

cph2 Knockout Results in Lower G6PDH Activity and Reduced Growth under Light-Activated Heterotrophic Conditions

An initial screening of Synechocystis sp. photoreceptor mutants revealed that cph2 knockout (KO) lost the ability to grow on agar plates supplemented with 10 mm Glc under LAHG conditions (Supplemental Fig. S1). Subsequently, we generated four independent complementation lines in the cph2 KO background by overexpressing the Cph2 coding sequence under the control of the petJ promoter (Zhang et al., 1992). Cells were grown in BlueGreen 11 (BG11) medium containing 0.3 µm copper, resulting in a rather weak expression of Cph2 to avoid unspecific effects by strong overexpression (Supplemental Fig. S2). Because cph2 KO was unable to grow under LAHG on agar plates, we established an experimental system in liquid cultures. Therefore, photoautotrophic cells in midexponential phase were supplied with 10 mm Glc and incubated under LAHG without agitation. Under those conditions, cells sedimented, which resulted in high cell densities at the bottom of the flask. With this experimental system, we switched cell cultures from photoautotrophic planktonic growth to LAHG at high cell densities, conditions that resemble characteristics of biofilms (see introduction). After 4 d under LAHG, the cph2 KO line showed a reduced G6PDH activity compared with the wild type. All four complementation lines (Cph2 overexpressor (OE) 1/2/7/8) were characterized by a higher G6PDH activity compared with cph2 KO. Thereby, Cph2 OE 2/7/8 fully complemented the KO phenotype (Fig. 1A). All additional analysis was performed with one complementation line, Cph2 OE 8, which is now referred to as Cph2 OE. No significant differences in G6PDH activity could be detected between the strains under photoautotrophic or photomixotrophic conditions (Supplemental Fig. S3).

Figure 1.
Figure 1.

cph2 KO results in lower G6PDH activity, retarded growth, and impaired biofilm formation under LAHG. A, Photoautotrophic cells were supplied with 10 mm Glc and put in LAHG conditions for 4 d without agitation. Crude protein extracts were gained, and specific G6PDH activity was determined for the wild type (WT), cph2 KO, and four independent Cph2 OE lines. Data show the mean ± sem (n ≥ 3). Asterisks on top of columns indicate significant differences to WT; asterisks inside columns indicate significant differences to cph2 KO (Student’s t test: P < 0.05). B, Cells in the midexponential growth phase were set to an OD750 of 0.3, supplied with 10 mm Glc, and incubated in 2-mL reaction tubes under LAHG conditions without agitation. At indicated time points, cells were harvested, and the OD750 was determined. Data show the mean ± sem (n = 3). Asterisks indicate significant differences to WT (Student’s t test: P < 0.05). C, To check for the ability to form biofilms, 1 mL cells (OD750 of 0.5) was applied in 24-well microtiter plates in the presence of 10 mm Glc and incubated for 4 d under LAHG without agitation. Then, the supernatant was removed, the biofilm attached to the bottom of the wells was washed off the plate, and the OD750 was determined. Data show the mean ± sem (n = 4–5). Asterisks indicate significant differences to WT (Student’s t test: P < 0.05). D, Growth of corresponding strains on BG11 agar plates supplemented with 10 mm Glc under constant light or LAHG conditions. Pictures were taken 4 (Glc/light) or 7 d (Glc/LAHG) after transfer. [See online article for color version of this figure.]

To analyze the growth pattern under LAHG, photoautotrophic cells were adjusted to an optical density at 750 nm (OD750) of 0.3, supplied with 10 mm Glc, distributed in 2-mL reaction tubes, and incubated under LAHG conditions without agitation. As presented in Figure 1B, the cph2 KO was growing slower compared with the wild type, reaching significant differences after 4 d under LAHG conditions. The Cph2 OE line complemented the phenotype. Hence, the reduced G6PDH activity in cph2 KO correlated with reduced cell growth under LAHG. No growth differences between the wild type and cph2 KO were observed when cells were switched from light to LAHG and when cells that were entrained for 3 d under LAHG were switched to light conditions under agitation (that is, without sedimentation of the cells; Supplemental Fig. S4, A and B).

As shown in Figure 1C, wild-type and cph2 OE lines performed better in biofilm formation on solid surfaces compared with cph2 KO. On agar plates, the growth differences after 7 d under LAHG conditions were clearly visible, with the cph2 KO being unable to maintain growth (Fig. 1D). We achieved complementation of this phenotype in only 50% of all experiments. In front of the strict requirement of Cph2 for growth under these conditions, the 50% success rate in complementation could result from differences in the expression levels of Cph2 during preculture of the Cph2 OE lines. No growth differences between the strains were observed in presence of Glc and permanent illumination (Fig. 1D).

Cph2 Regulates Subunit I of the cyt-c-ox Complex Expression and cyt-c-ox Activity under LAHG Conditions

The terminal oxidase is a major component of the respiratory ETC (Vermaas, 2001; Peschek et al., 2004). We conducted cyt-c-ox assays based on the well-known Kovac test as described by Jurtshuk and Liu (1983). A reduced cyt-c-ox activity became obvious in the cph2 KO line after 1 d and developed even clearer after 4 d of incubation under LAHG conditions without agitation (Fig. 2, A and B). Cell lines that were grown under photoautotrophic and photomixotrophic planktonic conditions did not show significant differences in cyt-c-ox activity (Supplemental Fig. S5). To further confirm the phenotype, oxygen consumption was measured in photomixotrophic cells after dark incubation. The physiological conditions in course of measurement do not exactly match LAHG/biofilm formation, which is difficult to realize, because after 4 d of LAHG/biofilm initiation, overall metabolic activity is substantially reduced. However, the fact that oxygen consumption was measured under dark heterotrophic conditions in a cuvette, which prevents aeration of the cells, might resemble metabolic conditions in biofilms. The rate of oxygen consumption under those conditions reached only 69.5 ± 5.6% (sem; n = 3) for the cph2 KO compared with the wild type.

Figure 2.
Figure 2.

Cph2 regulates cyt-c-ox activity under LAHG. cyt-c-ox Activity was determined in a whole-cell spectroscopic assay using TMPD (Kovac reagent) as substrate. Cells were incubated under LAHG conditions without agitation for 1 (A) or 4 d (B). Then, cells were washed three times in BG11 medium and adjusted to an OD750 of 0.2; 200 µL cells were provided in 96-well multititer plates, and oxidation of TMPD was followed at 610 nm. Relative activities with WT set to 100% ± sem are given (n = 4). Asterisks indicate significant differences to WT (Student’s t test: P < 0.05). Double asterisks indicate significant differences to WT (Student’s t test: P < 0.01). C, Gene expression studies of Zwf (G6PDH) and CtaDI. Cells were cultivated in the absence (photoautotrophic) or presence of 10 mm Glc (photomixotrophic) under permanent illumination or kept for 4 d in LAHG conditions without agitation. Total RNA was isolated; after reverse transcription, 500 ng cDNA was used as a template in PCR (32 cycles). PCR products were analyzed on a 1.5% (w/v) agarose gel and stained with ethidium bromide. The RNA subunit of ribonuclease P subunit B (RnpB) served as normalizer. The picture is representative for three independent experiments.

Gene expression studies were performed on key enzymes of the heterotrophic metabolism G6PDH (Zwf) and the subunit I of the cyt-c-ox complex (CtaD1). Zwf and CtaD1 expression was determined by semiquantitative reverse transcription (RT)-PCR on cells grown under photoautotrophic and photomixotrophic conditions and after 4 d under LAHG conditions without agitation. As shown in Figure 2C, cells that were grown in photautotrophic or photomixotrophic conditions did not show differences in Zwf or CtaDI expression between corresponding lines. Under LAHG/biofilm conditions, the cph2 KO showed a strongly reduced expression of CtaD1, which agrees with the observed reduced cyt-c-ox activity. However, cph2 KO did not strongly affect expression of Zwf. Gene expression of other key metabolic enzymes, P700 apoprotein subunit Ia (PsaA; PSI), photosystem II D1 protein (PsbA3; PSII), glucokinase (Glk), phosphofructokinase (PfkA), and NADH-dehydrogenase subunit 2 (NdhB), was analyzed in photomixotrophic and LAHG/biofilm conditions but did not result in different expression levels between wild-type, cph2 KO, and Cph2 OE lines (Supplemental Fig. S6).

Synechocystis sp. shares the photosynthetic and respiratory ETCs in one membrane, the thylakoid membrane. Therefore, dysfunction of the respiratory ETC, as mediated by a strongly down-regulated cyt-c-ox, might influence the photosynthetic ETC. To test it, cells grown under LAHG conditions without agitation for 1 d were subject to PSII chlorophyll fluorescence measurements. Fluorescence induction curves (Fig. 3A) show a sharp increase of relative variable fluorescence intensities right after onset of actinic light. In the course of actinic illumination, the fluorescence intensities decreased over time in the wild type and Cph2 OE. In the cph2 KO, however, fluorescence intensities stayed constantly at high levels and even increased over time. It could be explained by a lower capacity of the electron output in the cph2 KO caused by a lower cyt-c-ox activity, resulting in an overreduced ETC and hence, high PSII chlorophyll fluorescence intensities. To substantiate this hypothesis, we applied cyanide (CN), a potent inhibitor of terminal oxidases, 40 s after onset of actinic light to wild-type cells and observed a similar increase of relative variable fluorescence intensities as in the cph2 KO. Figure 3B gives the percentages of decrease (wild type and Cph2 OE) versus increase (cph2 KO and the wild type + CN) of the relative variable chlorophyll fluorescence intensities in the course of actinic illumination.

Figure 3.
Figure 3.

cph2 KO results in an impaired modulation of relative variable chlorophyll fluorescence intensities. A, Cells were incubated for 1 d under LAHG conditions without agitation, adjusted to 1.5 µg chlorophyll mL−1, and dark adapted for 1 min. Then, variable fluorescence intensities of PSII were determined. At 1 min, a saturating pulse was applied; 30 s thereafter, actinic light at an intensity of 270 µmol m−2 s−1 was applied for 4.5 min. Where indicated, CN at a final concentration of 0.01 mm was added. The relative variable fluorescence intensities were plotted over time. Gray arrows indicate the data points at 2.2 and 6 min as used for evaluations shown in B. B, Relative increase or decrease of relative variable fluorescence intensities between data points at 2.2 and 6 min. Data show the mean ± sem (n = 3).

cph2KO Results in Lower PQ Reduction and a Reduced PSI Reduction Kinetic

To analyze whether the input pathway, upstream of the PQ pool, is affected by the cph2 KO, we analyzed the PQ reduction under different growth conditions. The method has been described previously (Cooley et al., 2000; Cooley and Vermaas, 2001; Lee et al., 2007) and takes advantage of an increased variable chlorophyll fluorescence intensity, which is indicative of a reduced primary electron-accepting PQ of PSII, mediated by reverse electron transfer from the reduced PQ pool to PSII after inhibition of the electron output pathways by CN and 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB)/ascorbate under nonactinic, weak measuring light. One day after cells were shifted to LAHG without agitation, the PQ reduction was determined (Fig. 4A). The wild type and Cph2 OE reached much higher levels of variable fluorescence intensities, indicative of a more reduced PQ compared with cph2 KO. This result indicates a reduced electron input into the PQ pool in the cph2 KO line. Under photoautotrophic or photomixotrophic conditions, no significant differences in the PQ reduction were observed (Supplemental Fig. S7, A and B).

Figure 4.
Figure 4.

cph2 KO is impaired in PQ/PSI reduction in LAHG. A, Cells were incubated for 1 d under LAHG conditions without agitation; then, PQ reduction was determined. Cells at 1.5 µg chlorophyll mL−1 were dark adapted for 1 min, inhibitors were added (1 mm KCN, 50 µm DBMIB, and 5 mm sodium ascorbate), and the increase in the fluorescence amplitude induced by weak measuring light was recorded. The relative variable fluorescence intensities were plotted over time. Data show the mean ± sem (n = 3). B, Measurement of P700+ reduction kinetics. Photoautotrophic cells were supplied with 10 mm Glc and incubated in the dark for 24 h in 2-mL reaction tubes without agitation. Reduction kinetics of P700+ were recorded in vivo with a dual PAM-100 measuring system. Prior measurement cells at 3 µg chlorophyll mL−1 were dark incubated for 1 min in the presence or absence of 10 µm DCMU. Then, blue actinic illumination was provided to achieve complete oxidation of P700, and P700+ reduction kinetics were measured in the dark. Rate constants (k) were determined by fitting the decays with single exponential functions. The mean ± sem (n = 3) of the half-life of P700+ reduction is shown. Asterisk indicates significant differences to WT (Student’s t test: P < 0.05).

We further determined the reduction kinetics of PSI of cells that were incubated for 1 d under LAHG without agitation (Fig. 4B). Therefore, blue light was applied to oxidize PSI, and the half-life of PSI reduction in the dark was determined. In the absence of the PSII inhibitor 3-(3,4-dichlorophenyl)-1,1dimethylurea (DCMU), a slight increase of the reduction rate, which is indicative of a slower electron input to PSI, could be observed in the cph2 KO. In presence of DCMU, this increase was significantly stronger. When PSII is blocked during blue light application, linear photosynthetic electron transport cannot contribute to NADPH generation; hence, electrons from heterotrophic sources will contribute more to PSI reduction in the dark.

Degradation of Phycocyanin Proceeds Slower in the cph2KO Mutant after the Shift to LAHG

Shifting Synechocystis sp. cells to heterotrophic conditions results in a decrease of the phycocyanin content, representing the major phycobili protein of Synechocystis sp. (Yang et al., 2002a). Here, we show that the KO of Cph2 results in higher phycocyanin contents compared with wild type and Cph2 OE under LAHG/biofilm initiation because of a slower decrease of the phycocyanin level after the shift to LAHG. Cells that were incubated under LAHG without agitation for 2 d and then shifted to permanent light conditions for an additional 2 d showed equal phycocyanin contents (Fig. 5). Thus, the observed phenotype was reverted under continuous illumination. No differences in the phycocyanin content between the wild type and cph2 KO were observed when cells were switched from light to LAHG and when cells that were entrained for 3 d under LAHG were shifted to light condition under agitation (that is, without sedimentation of the cells; Supplemental Fig. S4C). When cells were adapted to LAHG/biofilm formation for 6 d and then transferred to constant light for another 2 d, the cph2 KO resumed growth (the OD750 increased from 0.59 ± 0.02 [sem; n = 3] to 0.89 ± 0.23), whereas the wild type and Cph2 OE did not (from 0.61 ± 0.03 to 0.56 ± 0.04 and from 0.68 ± 0.01 to 0.63 ± 0.04, respectively). This result might be caused by a slower adaptation of cph2 KO to dark heterotrophic conditions. Thus, cph2 KO stayed in a more photomixotrophic state with a higher phycobilisome content and therefore, could resume growth after onset of light.

Figure 5.
Figure 5.

cph2 KO is impaired in phycocyanin degradation in LAHG. The phycocyanin content was determined spectroscopically in photoautotrophic cells (0 d) and after 1, 2, and 4 d of incubation in LAHG without agitation. In another experiment, cells were incubated for 2 d in LAHG without agitation and then shifted to constant light (30 μmol m−2 s−1) for an additional 2 d. Data show the mean ± sem (n = 3). Asterisk indicates significant differences to WT (Student’s t test: P < 0.05). Double asterisk indicates significant differences to WT (Student’s t test: P < 0.01).

Cph2 Has a Role in the Heat and High-Light Stress Response

Microarray data on Synechocystis sp. revealed that far-red light preferentially up-regulated genes known to be induced by stress, such as the heat shock protein A and high-light inducible genes. The absence of Cph2 preferably changed this far-red response (Hübschmann et al., 2005). Therefore, we wondered whether loss of Cph2 function could have an effect under heat and high-light stress conditions when PSII is challenged. To test it, photoautotrophic and photomixotrophic cells were exposed to a temperature shift of 15°C above the normal growth conditions, and growth patterns were followed (Fig. 6A). Interestingly, only in the presence of Glc, cph2 KO was unable to maintain growth in prolonged heat stress. Heat treatment resulted in a considerable reduction in phycocyanin content in the presence of Glc. Again, as seen under LAHG, phycocyanin levels stayed higher in the cph2 KO (Fig. 6B).

Figure 6.
Figure 6.

cph2 KO is impaired in the heat stress response under photomixotrophic conditions. A, Cells in late exponential growth phase were diluted to an OD750 of 0.4 and where indicated, supplied with 10 mm Glc; 10mL cells were incubated at 45°C under shaking (140 rpm) and permanent illumination (30 μmol m−2 s−1). At the indicated time points, the OD750 was determined. Data show the mean ± sem (n = 3). B, The phycocyanin content of cells after 4 h of heat shock (as described in A) was determined. Data show the mean ± sem (n = 3). Asterisk indicates significant differences (Student’s t test: P < 0.05); triple asterisk indicates significant differences (Student’s t test: P < 0.001. C, Schematic illustration of the intersecting photosynthetic and respiratory electron transport (arrows) in the thylakoid membrane of Synechocystis sp. Inhibitors are shown, and dashed arrows indicate the location of their action. Cyt b6f, cytochrome b6f complex; PBS, phycobilisome; PC, plastocyanine. Figure 2 in Vermaas, 2001 with modifications.

To check for a role of Cph2 under high-light conditions, we incubated cell lines in the presence or absence of Glc and measured photosynthetic oxygen evolution under increasing light intensities of 15, 30, and 300 μmol m−2 s−1, which revealed a reduced photosynthetic oxygen evolution for cph2 KO under high-light (300 μmol m−2 s−1) illumination, particularly in presence of Glc (Supplemental Fig. S8).

DISCUSSION

Synechocystis sp. is a cyanobacterial model system for oxygenic photosynthesis, the primary carbon-fixing reaction in bacteria, algae, and plants. Here, we analyzed the function of the phytochrome Cph2 in the adaptation process from photoautotrophic planktonic growth to heterotrophic metabolism and biofilm formation. The KO of Cph2 resulted in reduced growth after the switch from photoautotrophic planktonic to LAHG/biofilm conditions (Fig. 1B); moreover, biofilm formation was significantly reduced in the cph2 KO mutant (Fig. 1C). This retarded growth was correlated with a reduced G6PDH activity (Fig. 1A) and cyt-c-ox activity (Fig. 2, A and B). On the transcriptional level, only CtaDI expression was clearly down-regulated in the cph2 KO (Fig. 2C). It has been reported that G6PDH activity is regulated on the posttranslational level (Cossar et al., 1984; Gleason, 1996; Sundaram et al., 1998). Therefore, it seems likely that the observed lower G6PDH activity in the cph2 KO manifests at the posttranslational level, with no clear difference in the gene expression pattern. A defect in the heterotrophic metabolism was further substantiated for the cph2 KO by measurement of PQ reduction (Fig. 4A). Moreover, the increased half-life of PSI reduction, particularly in presence of DCMU, indicated a slower electron input to PSI in the cph2 KO line (Fig. 4B). In summary, Cph2 has a function in regulating the heterotrophic metabolism in the adaptation to LAHG/biofilm formation. In the course of this process, all tested genotypes degraded phycocyanin, representing the major phycobili protein of Synechocystis sp. However, for the cph2 KO strain, the reduction proceeded slower (Fig. 5). Phycobilisomes do not only serve as photosynthetic pigments, but also, they serve as amino acid storage compounds in cyanobacteria (Allen and Smith, 1969). Therefore, reduced phycocyanin degradation in cph2 KO might lead to an impaired amino acid catabolism in prolonged darkness, which might contribute to the observed growth defects.

Cph2-mediated regulation of cyt-c-ox does not only serve to support energy metabolism under LAHG/biofilm conditions. We show that the KO of Cph2 resulted in a different pattern of the chlorophyll fluorescence induction curve when cells were entrained for LAHG/biofilm formation and switched back to actinic illumination. In the course of actinic light application, cph2 KO was characterized by a continual high level of chlorophyll fluorescence, whereas in the wild type and Cph2 OE, chlorophyll fluorescence decreased under the same conditions. Interestingly, when CN, an inhibitor of cyt-c-ox, was applied to wild-type cells, we observed similar chlorophyll fluorescence induction curves as seen in the cph2 KO (Fig. 3). An impaired cyt-c-ox activity results in a reduced electron output capacity and consequently, an overreduction of the ETC. An overreduced PQ pool, in turn, challenges PSII functionality and gives rise to an increase in chlorophyll fluorescence. Hence, cyt-c-ox could serve as an electron valve to avoid overreduction after a sudden change in light intensity (dark to 270-µmol m−2 s−1 actinic light). This finding is in line with data from the work by Lea-Smith et al. (2013), which showed an essential function of thylakoid terminal oxidases for the survival of Synechocystis sp. in rapidly changing light intensities. Thus, Cph2 has a role in keeping up cyt-c-ox expression in the course of biofilm initiation to support heterotrophic metabolism in the dark as well as avoiding overreduction of the ETC after the dark-to-light transition.

Cph2 inhibits phototaxis to blue light. Interestingly, the blue light-induced photomovement of cph2 KO is inhibited by DCMU (Wilde et al., 2002; Fiedler et al., 2005). Consequently, Fiedler et al. (2005) speculated that the photosynthetic ETC is involved in blue light-induced photomovement. Our data suggest that the impaired heterotrophic metabolism in cph2 KO could prevent movement to blue light when PSII is blocked because of a lower energy status of the cells. Regulation of cell motility is a crucial factor in biofilm formation (Römling and Amikam, 2006; Cotter and Stibitz, 2007); therefore, the observed motility phenotype of cph2 KO might be related to biofilm formation. In this process, Cph2-mediated transcriptional regulation of cyt-c-ox might play a critical role. The cyt-c-ox is differentially expressed in biofilm cells, which a comparison of DNA microarray data on several bacterial species reveals (Lazazzera, 2005). Moreover, cyt-c-ox plays an essential role in biofilm maturation of Pseudomonas aeruginosa (Southey-Pilling et al., 2005) and is transcriptionally induced in mature biofilms of Escherichia coli (Beloin et al., 2004). Cph2 holds red/far-red and blue/UV-A photosensor domains (see introduction). Hence, this phytochrome is perfectly equipped to sense gradients of changing light qualities (e.g. within biofilms on marine/lake snow particles and/or in the course of the vertical movement of these particles) and translate this information into zones of different metabolic activities. Di Pippo et al. (2012) showed that temperature and light had a strong effect on the species composition of biofilms consisting of Synechocystis sp. and the green alga Chlorococcus sp. Because Cph2 has a clear phenotype in the heat and high-light stress response (this study), Cph2 could play a role in the competition of different organisms in biofilms, particularly in the course of changing environmental conditions.

Other than an essential function in heterotrophic conditions, Cph2 has a role in the abiotic stress response, particularly in photomixotrophic conditions. Heat challenge resulted in impaired growth of cph2 KO (Fig. 6A) and as seen under LAHG/biofilm conditions, a higher phycocyanin content in cph2 KO compared with the wild type/Cph2 OE (Fig. 6B). Previously, a proteome study on Synechocystis sp. revealed that the phycobilisome complexes are changing in response to heat stress, especially that a rod–core linker polypeptide is decreased under heat stress (Slabas et al., 2006). When heat-challenge was applied in the presence of Glc (photomixotrophic conditions), the cell growth was clearly enhanced compared with photoautotrophic cultures in the wild type/Cph2 OE and initially also, the cph2 KO (Fig. 6A). It indicates a substantial contribution of the heterotrophic/respiratory metabolism under these conditions. In presence of Glc, we observed a significant reduction of the phycocyanin content in the course of heat challenge (not so pronounced in cph2 KO; Fig. 6B). This finding implies that the heat challenge resulted in a reduction of the capacity to capture photosynthetic active photons and a shift to heterotrophic/respiratory metabolism in the presence of Glc. Misregulation of the phycobilisome content in the course of the heat response might result in redox imbalances within the combined respiratory and photosynthetic ETC. This might apply to cph2 KO, which is characterized by a higher phycocyanin content compared with the wild type. Heat-induced redox imbalances within the ETC, particularly when combined with photons in excess of use capacity, may result in the generation of reactive oxygen species (Glatz et al., 1999; Asadulghani et al., 2003) and consequent membrane damage. Moreover, the redox state of components of the ETC, preferably the PQ pool, acts as a regulator of gene expression in Synechocystis sp. (Alfonso et al., 1999; Li and Sherman, 2000; Ma et al., 2008; Singh et al., 2009). In the absence of Glc (photoautotrophic conditions), cells do not reduce the phycocyanin content in the course of heat challenge (Fig. 6B), probably because they depend inevitably on photosynthesis for energy metabolism. In the absence of Glc, the net electron input into the ETC originates mainly from PSII (other than a possible contribution from respiratory metabolism supplied from glycogen stores that might not be sufficient to support energy metabolism for a prolonged time under stress conditions). This finding makes an overreduction of the ETC less likely in photoautotrophic compared with photomixotrophic conditions, particularly because of the thermal instability of the PSII complex. In photomixotrophic conditions, the presence of Glc allows for substantial and prolonged electron input into the combined photosynthetic and respiratory ETC from heterotrophic sources when PSII gets challenged under heat stress. Hence, modulation of light-absorbing phycobilisomes could be crucial to maintain a certain redox status of the ETC under photomixotrophic conditions and simultaneous heat stress. As exemplified for the heat response, similar considerations apply for the observed high-light phenotype of cph2 KO, which particularly manifests in photomixotrophic conditions as well.

Synechocystis sp. responds to an increase in growth temperature with a rise in chlorophyll fluorescence, which is considered as an intrinsic probe of the thermal stability of the PSII complex and the thermal inactivation of photosynthetic oxygen evolution (Balogi et al., 2005). Because the increase in chlorophyll fluorescence precedes a substantial loss in photosynthetic oxygen evolution (Balogi et al., 2005), chlorophyll fluorescence could serve as an intrinsic stress signal to mount corresponding responses. Interestingly, the room temperature chlorophyll-α fluorescence emission has a broad maximum around 685 nm in Synechocystis sp. (Joshua et al., 2005), which is similar to the far-red absorption maximum of the N-terminal GAF domains of Cph2 at 695 nm (Anders et al., 2011). Therefore, we pose the speculative question of whether Cph2 could sense chlorophyll fluorescence under stress conditions. Increased chlorophyll fluorescence could lead to an adjustment of the phycobilisome content (hence, the capacity to capture photosynthetic active photons). Certainly, substantial in-depth analysis is required to analyze Cph2 function in the heat stress response and address the hypothesis of Cph2 sensing chlorophyll fluorescence.

CONCLUSION

In cyanobacteria, the photosynthetic and respiratory ETCs are combined in the thylakoid membrane, a feature that requires elaborate regulatory mechanisms. Thereby, metabolic adaptations, as seen in light-to-dark and dark-to-light transitions, are particularly challenging. The results in this study describe a function of Cph2 in the regulation of key metabolic enzymes to support the heterotrophic metabolism in the course of biofilm formation. Moreover, cph2 KO results in an impaired modulation of the phycocyanin content, the major component of the cyanobacterial light-harvesting complex, under heterotrophic/biofilm conditions and heat stress. A role of Cph2 in the heat and high-light stress response manifests particularly under photomixotrophic conditions when photosynthetic and respiratory metabolism operate in parallel. The physiological function of Cph2 might be seen in the regulation of the primary metabolism in the course of biofilm formation/stress responses, with blue and red/far-red light acting as extrinsic and possibly, intrinsic (chlorophyll fluorescence) signals.

MATERIALS AND METHODS

Cyanobacterial Strains and Cloning Strategies

The cph2 KO line was generated by inserting a spectinomycine resistance cassette into the coding region of Cph2 (sll0821), thereby disrupting the functionality of the corresponding gene (Moon et al., 2011). For functional complementation, the cph2 KO strain was transformed with the full-length coding sequence of Cph2 under the control of the constitutive petJ promoter. The Cph2 coding sequence was obtained by PCR on genomic DNA using the primers 5′-ACATATGAACCCTAATCGATCC and 5′–TAGATCTTGTGGCGACAACTACAC, thereby introducing an NdeI and BglII restriction site, respectively. The PCR product was cloned in pGEM-T (Promega GmbH), sequenced to confirm correct amplification, and subcloned in pSK9 using NdeI and BglII restriction sites.

Stable Transformation of Synechocystis sp.

Stable transformation of Synechocystis sp. was performed essentially as described by Grigorieva and Shestakov (1982). Ten milliliters midexponential cells were centrifuged (5 min at 28°C at 3,000 rpm); the pellet was resuspended in 5 mL BG11 medium and distributed to five sterile reaction tubes. DNA (3–5 μg plasmid DNA) was added, and the cells were incubated in darkness at 28°C overnight; 200 μL cell cultures were plated on BG11 agar plates lacking antibiotics. After 2 d of incubation under constant light at a light intensity of 20 μmol m−2 s−1, the agar plates were supplied with antibiotics at a final concentration of 15 μg mL−1. Plates were incubated under continuous illumination at a light intensity of 20 μmol m−2 s−1. Colonies appeared after 2–3 weeks. To achieve complete segregation, single colonies were picked and repeatedly streaked in weekly intervals on BG11 plates containing the appropriate antibiotics. To check for positive genomic integration of the overexpression construct, PCR on genomic DNA was performed. Positive transformants were maintained on BG11 agar plates containing 8 μg mL−1 chloramphenicole and 10 μg mL−1 spectinomycine.

Growth Conditions

Synechocystis sp. cells were propagated on solid BG11 medium (Stanier et al., 1971) supplemented with 1.5% (w/v) agar, 0.15% (w/v) sodium thiosulfate (Na2S2O3*5 H2O), and where appropriate, filter-sterilized antibiotics (for cph2 KO lines, 10 μg mL−1 spectinomycine; for Cph2 OE lines, 10 μg mL−1 spectinomycine and 8 μg mL−1 chloramphenicole). Batch cultures were grown in liquid BG11 medium (supplemented with 10 mm TES-KOH [pH 8.0]) on a rotary shaker at 140 rpm at 30°C and continuous illumination (30 μmol m−2 s−1). For photomixotrophic growth, Glc was added to the medium at a final concentration of 10 mm. For LAHG, cells were incubated in the dark with 15 min of light (30 μmol m−2 s−1) per day.

Biofilm Formation

One milliliter late exponential cells were adjusted to an OD750 of 0.5 and applied in 24-well microtiter plates in the presence of 10 mm Glc. After 4 d under LAHG, the biofilm attached to the bottom of the well was carefully washed one time. Then, the attached cells were washed off the plate, and the cell density was determined (OD750).

Crude Protein Isolation and Enzyme Activity Assays

For crude protein isolation, the method by Knowles and Plaxton (2003) was followed with some modifications. Cell cultures were harvested by centrifugation (10 min at 4°C at 3,500 rpm), and the pellet was frozen in liquid nitrogen and stored at −80°C until further processing. Cell pellets were supplied with 0.8 mL breakage buffer (50 mm HEPES KOH [pH 7.5], 15% [v/v] glycerol, 1 mm EDTA [pH 8.0], 3 mm MgCl2, 1 mm dithiothreitol, and 1 mm phenylmethylsulfonylfluoride) and allowed to thaw on ice. After the addition of 0.3 g glass beads (∅ 0.25–0.50 mm; Roth), the samples went through three cycles of freezing in liquid nitrogen, thawing in an ultrasonic bath, and brief mixing. Then, debris was removed by centrifugation (10 min at 4°C at 12,000g), and the supernatant was kept on ice. Crude protein concentrations were determined using the Bradford method (BioRad Laboratories) with bovine serum albumin as the standard.

For G6PDH enzyme activity measurements, 100 μg crude protein was supplied with the reaction mix (50 mm HEPES KOH [pH 8.0], 10 mm MgCl2*6 H2O, 0.4 mm NADP, and 5 mm glucose-6-phosphate) in a final volume of 1 mL, and the A340 was followed. The specific activity was calculated as units per milligram crude protein, with a molar extinction coefficient for NADPH of ε = 6.22 mm−1 cm−1.

cyt-c-ox Activity was determined in a whole-cell spectroscopic assay using N,N,N',N'-Tetramethyl-1,4-Phenylendiamin (TMPD) essentially as described by Jurtshuk and Liu (1983). Cells were washed three times with BG11 medium and adjusted to an OD750 of 0.2; 200 µL cells were provided in 96-well multititer plates, TMPD was added at a final concentration of 0.5 mm, and the absorption at 610 nm was followed. The specific activity was measured as units per OD750, with a molar extinction coefficient for oxydized TMPD of ε = 12.0 mm−1 cm−1.

Measurement of P700 Reduction Kinetics

Reduction kinetics of oxidized P700 (P700+) were recorded in vivo with a dual PAM-100 measuring system (Heinz Walz GmbH) equipped with a standard emitter-detector unit DUAL-E and detector unit Dual-DB. Two-milliliter cell cultures at 3 µg chlorophyll mL−1 were placed in an emitter-detector cuvette assembly unit. Cells were dark adapted for 1 min under constant stirring in the presence or absence of 10 µm DCMU. Then, blue actinic illumination at 460 nm was provided by a light-emitting diode lamp with a maximum of 700 μmol m−2 s−1 for 60 s. Then, P700+ reduction in the dark was determined. Resulting curves were analyzed as described previously (Bernát et al., 2009; Tsunoyama et al., 2009). Rate constants (k) were determined by fitting the decays with single exponential functions.

Measurement of PQ Reduction

PQ reduction was measured using a pulse amplitude modulation fluorometer (DUAL-PAM; Walz) essentially as described by Lee et al. (2007). Cells at 1.5 µg chlorophyll mL−1 were dark adapted for 1 min, inhibitors were added (1 mm KCN, 50 µm DBMIB, and 5 mm sodium ascorbate), and the increase in the fluorescence amplitude induced by weak measuring light was followed starting 10 s thereafter. The measuring light was applied in pulses of 5 s with 5-s intervals for the first 1 min and then pulses of 10 s with 10-s intervals for another 8 min. Relative variable fluorescence intensities were plotted over time.

Measurement of PSII Chlorophyll Fluorescence

Chlorophyll fluorescence of PSII was measured using a pulse amplitude modulation fluorometer (DUAL-PAM, Walz). Cells at 1.5 µg chlorophyll mL−1 were dark adapted for 1 min under constant stirring, and then, a saturating pulse was applied; 30 s thereafter, cells were illuminated with actinic light (270 µmol m−2 s−1) for 4.5 min. Then, the dark recovery of fluorescence was measured for 2.5 min. The relative variable fluorescence intensities were plotted over time.

Determination of Phycocyanin Levels

Phycocyanin levels were determined essentially as described by Sato et al. (2008) by an approximation from whole-cell absorbance (A) using the following equation (modified from Arnon et al., 1974): Phycocyanin (mg mL−1) = 0.138445(A625 − A750) − 0.035483(A678 − A750).

Complementary DNA Synthesis and Semiquantitative RT-PCR

Total RNA from 10 to 15 mL corresponding cell cultures was isolated essentially as described by McGinn et al. (2003). To analyze gene expression, semiquantitative two-step RT-PCRs were performed. Complementary DNA (cDNA) was generated from 1 µg total RNA using the QuantiTect Reverse Transcription Kit (QIAGEN) according to the manufacturer’s instructions; 500 ng first-strand cDNA was subsequently used as a template for PCR amplification with gene-specific primers. The RNA subunit of ribonuclease P subunit B served as control for constitutive gene expression. Genes analyzed were G6PDH (Zwf; slr1843), cyt-c-ox (CtaDI; slr1137), Glk (sll0593), PfkA (sll1196), NdhB (sll0223), PSI (PsaA; slr1834), PSII (PsbA3; sll1867), and Cph2 (sll0821). Optimal PCR cycle numbers varied between 32 and 34 cycles (32 cycles for RnpB, Zwf, and CtaDI, 33 cycles for Cph2, and 34 cycles for PsaA, PsbA3, Glk, PfkA, and NdhB). Primer sequences in 5′ to 3′orientation are TGTCACAGGGAATCTGAGGA and AAGGGCGGTATTTTTCTGTG for RnpB, GCAAAATCTGATGGTGTTCC and AATAACCGGCTCGTTCTTCT for Zwf, CTGGGGGCGATTAATTTTGT and GATGCTAACACTGGGGTGGA for CtaDI, GAAACCAAAACCGTCGATCT and ATAGGCCCCGAGAAAAAGTT for Glk, ATTCCTGAAATTCCCTACCG and TTGGATTTGCTTGACCTGAT for PfkA, GGGTGGTGAAAATGATGGTG and CAGCGAGGTAGCAACCAAAG for NdhB, GCACCTGCCAAGTATCTGGT and GTACCCCAAACATCGGATTG for PsaA, CTGAGCTTGAGGCCAAATCCTT and CTGTTCCCACAATGAAGCGCT for PsbA3, and TGCGGCTGTATCGAGAAGGT and CATTCATGGGCAATGAGCAA for Cph2.

Photosynthetic Oxygen Evolution

Oxygen evolution by photosynthesis was measured at 25°C with a liquid phase O2 electrode unit (DW3), a white light source (LS2), and an electrode control unit (Oxygraph system; Hansatech); 50 mL liquid cultures were grown to an OD750 of 0.4–0.5 in the presence or absence of 10 mm Glc, 12 mL cells were taken for measurement. Oxygen consumption in the dark was measured over a period of 8 min, and then, increasing intensities of actinic light from 15 to 30 to a final 300 μmol m−2 s−1 were applied for another 4 min each. Oxygen evolution was normalized as micromoles oxygen evolution per milligram chlorophyll and minute.

Supplemental Data

The following materials are available in the online version of this article.

Acknowledgments

We thank Annegret Wilde for providing the vector pSK9, Angelika Muhr for excellent technical support, and Youn-Il Park for technical training and thoughtful discussion.

Footnotes

  • www.plantphysiol.org/cgi/doi/10.1104/pp.113.233270

  • The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Reinhard K. Proels (proels{at}wzw.tum.de).

  • Y.M.P., R.K.P., and R.H. designed the experiments; M.S. and R.K.P. generated mutant strains (overexpressor), performed experiments, and analyzed the data; Y.C.Y. performed experiments. R.K.P. wrote the article and Y.M.P. complemented the writing.

  • ↵1 This work was supported by the Korea Basic Science Institute (grant no. G32124 to Y.M.P.) and a grant from the National Research Foundation of Korea funded by the Korean Government (MEST; 2013 University–Institute Cooperation Program to Y.M.P.).

  • ↵[C] Some figures in this article are displayed in color online but in black and white in the print edition.

  • ↵[W] The online version of this article contains Web-only data.

Glossary

cDNA
complementary DNA
CN
cyanide
cyt-c-ox
cytochrome-c-oxidase
DBMIB
2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone
DCMU
3-(3,4-dichlorophenyl)-1,1dimethylurea
ETC
electron transport chain
G6PDH
Glc-6-P dehydrogenase
LAHG
light-activated heterotrophic growth
PQ
plastoquinone
RT
reverse transcription
TMPD
N,N,N',N'-Tetramethyl-1,4-Phenylendiamin
KO
knockout
  • Received November 28, 2013.
  • Accepted February 27, 2014.
  • Published February 27, 2014.

REFERENCES

  1. ↵
    1. Alfonso M,
    2. Perewoska I,
    3. Constant S,
    4. Kirilovsky D
    (1999) Redox control of psbA expression in cyanobacteria Synechocystis strains. J Photochem Photobiol B 48: 104–113
    OpenUrlCrossRef
  2. ↵
    1. Allen MM,
    2. Smith AJ
    (1969) Nitrogen chlorosis in blue-green algae. Arch Mikrobiol 69: 114–120
    OpenUrlCrossRefPubMed
  3. ↵
    1. Anders K,
    2. von Stetten D,
    3. Mailliet J,
    4. Kiontke S,
    5. Sineshchekov VA,
    6. Hildebrandt P,
    7. Hughes J,
    8. Essen LO
    (2011) Spectroscopic and photochemical characterization of the red-light sensitive photosensory module of Cph2 from Synechocystis PCC 6803. Photochem Photobiol 87: 160–173
    OpenUrlCrossRefPubMed
  4. ↵
    1. Arnon DI,
    2. McSwain BD,
    3. Tsujimoto HY,
    4. Wada K
    (1974) Photochemical activity and components of membrane preparations from blue-green algae. I. Coexistence of two photosystems in relation to chlorophyll a and removal of phycocyanin. Biochim Biophys Acta 357: 231–245
    OpenUrlPubMed
  5. ↵
    1. Asadulghani,
    2. Suzuki Y,
    3. Nakamoto H
    (2003) Light plays a key role in the modulation of heat shock response in the cyanobacterium Synechocystis sp PCC 6803. Biochem Biophys Res Commun 306: 872–879
    OpenUrlCrossRefPubMed
  6. ↵
    1. Balogi Z,
    2. Török Z,
    3. Balogh G,
    4. Jósvay K,
    5. Shigapova N,
    6. Vierling E,
    7. Vígh L,
    8. Horváth I
    (2005) “Heat shock lipid” in cyanobacteria during heat/light-acclimation. Arch Biochem Biophys 436: 346–354
    OpenUrlCrossRefPubMed
  7. ↵
    1. Beloin C,
    2. Valle J,
    3. Latour-Lambert P,
    4. Faure P,
    5. Kzreminski M,
    6. Balestrino D,
    7. Haagensen JAJ,
    8. Molin S,
    9. Prensier G,
    10. Arbeille B,
    11. Ghigo JM
    (2004) Global impact of mature biofilm lifestyle on Escherichia coli K-12 gene expression. Mol Microbiol 51: 659–674
    OpenUrlCrossRefPubMed
  8. ↵
    1. Bernát G,
    2. Waschewski N,
    3. Rögner M
    (2009) Towards efficient hydrogen production: the impact of antenna size and external factors on electron transport dynamics in Synechocystis PCC 6803. Photosynth Res 99: 205–216
    OpenUrlCrossRefPubMed
  9. ↵
    1. Cooley JW,
    2. Howitt CA,
    3. Vermaas WFJ
    (2000) Succinate:quinol oxidoreductases in the cyanobacterium synechocystis sp. strain PCC 6803: presence and function in metabolism and electron transport. J Bacteriol 182: 714–722
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. Cooley JW,
    2. Vermaas WFJ
    (2001) Succinate dehydrogenase and other respiratory pathways in thylakoid membranes of Synechocystis sp. strain PCC 6803: capacity comparisons and physiological function. J Bacteriol 183: 4251–4258
    OpenUrlAbstract/FREE Full Text
  11. ↵
    1. Cossar JD,
    2. Rowell P,
    3. Stewart WDP
    (1984) Thioredoxin as a modulator of glucose-6-phosphate dehydrogenase in a N2-fixing cyanobacterium. J Gen Microbiol 130: 991–998
    OpenUrlAbstract/FREE Full Text
  12. ↵
    1. Cotter PA,
    2. Stibitz S
    (2007) c-di-GMP-mediated regulation of virulence and biofilm formation. Curr Opin Microbiol 10: 17–23
    OpenUrlCrossRefPubMed
  13. ↵
    1. Di Pippo F,
    2. Ellwood NTW,
    3. Guzzon A,
    4. Siliato L,
    5. Micheletti E,
    6. De Philippis R,
    7. Albertano PB
    (2012) Effect of light and temperature on biomass, photosynthesis and capsular polysaccharides in cultured phototrophic biofilms. J Appl Phycol 24: 211–220
    OpenUrlCrossRef
  14. ↵
    1. Fiedler B,
    2. Börner T,
    3. Wilde A
    (2005) Phototaxis in the cyanobacterium Synechocystis sp. PCC 6803: role of different photoreceptors. Photochem Photobiol 81: 1481–1488
    OpenUrlCrossRefPubMed
  15. ↵
    1. Fowler SW,
    2. Knauer GA
    (1986) Role of large particles in transport of elements and organic compounds through the ocean water column. Prog Oceanog 16: 147–194
    OpenUrlCrossRef
  16. ↵
    1. Glatz A,
    2. Vass I,
    3. Los DA,
    4. Vigh L
    (1999) The Synechocystis model of stress: from molecular chaperones to membranes. Plant Physiol Biochem 37: 1–12
    OpenUrlCrossRef
  17. ↵
    1. Gleason FK
    (1996) Glucose-6-phosphate dehydrogenase from the cyanobacterium, Anabaena sp. PCC 7120: purification and kinetics of redox modulation. Arch Biochem Biophys 334: 277–283
    OpenUrlCrossRefPubMed
  18. ↵
    1. Gram L,
    2. Grossart HP,
    3. Schlingloff A,
    4. Kiørboe T
    (2002) Possible quorum sensing in marine snow bacteria: production of acylated homoserine lactones by Roseobacter strains isolated from marine snow. Appl Environ Microbiol 68: 4111–4116
    OpenUrlAbstract/FREE Full Text
  19. ↵
    1. Grigorieva G,
    2. Shestakov S
    (1982) Transformation in the cyanobacterium Synechocystis sp. 6803. FEMS Microbiol Lett 13: 367–370
    OpenUrlFREE Full Text
  20. ↵
    1. Grossart HP,
    2. Tang KW
    (2010) www.aquaticmicrobial.net. Commun Integr Biol 3: 491–494
    OpenUrlCrossRefPubMed
  21. ↵
    1. Hübschmann T,
    2. Yamamoto H,
    3. Gieler T,
    4. Murata N,
    5. Börner T
    (2005) Red and far-red light alter the transcript profile in the cyanobacterium Synechocystis sp. PCC 6803: impact of cyanobacterial phytochromes. FEBS Lett 579: 1613–1618
    OpenUrlCrossRefPubMed
  22. ↵
    1. Jefferson KK
    (2004) What drives bacteria to produce a biofilm? FEMS Microbiol Lett 236: 163–173
    OpenUrlCrossRefPubMed
  23. ↵
    1. Jenal U,
    2. Malone J
    (2006) Mechanisms of cyclic-di-GMP signaling in bacteria. Annu Rev Genet 40: 385–407
    OpenUrlCrossRefPubMed
  24. ↵
    1. Joshua S,
    2. Bailey S,
    3. Mann NH,
    4. Mullineaux CW
    (2005) Involvement of phycobilisome diffusion in energy quenching in cyanobacteria. Plant Physiol 138: 1577–1585
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Jurtshuk P Jr,
    2. Liu JK
    (1983) Cytochrome oxidase analyses of Bacillus strains: existence of oxidase-positive species. Int J Syst Bacteriol 33: 887–891
    OpenUrlAbstract/FREE Full Text
  26. ↵
    1. Karniol B,
    2. Wagner JR,
    3. Walker JM,
    4. Vierstra RD
    (2005) Phylogenetic analysis of the phytochrome superfamily reveals distinct microbial subfamilies of photoreceptors. Biochem J 392: 103–116
    OpenUrlCrossRefPubMed
  27. ↵
    1. Knowles VL,
    2. Plaxton WC
    (2003) From genome to enzyme: analysis of key glycolytic and oxidative pentose-phosphate pathway enzymes in the cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol 44: 758–763
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. Lazazzera BA
    (2005) Lessons from DNA microarray analysis: the gene expression profile of biofilms. Curr Opin Microbiol 8: 222–227
    OpenUrlCrossRefPubMed
  29. ↵
    1. Lea-Smith DJ,
    2. Ross N,
    3. Zori M,
    4. Bendall DS,
    5. Dennis JS,
    6. Scott SA,
    7. Smith AG,
    8. Howe CJ
    (2013) Thylakoid terminal oxidases are essential for the cyanobacterium Synechocystis sp. PCC 6803 to survive rapidly changing light intensities. Plant Physiol 162: 484–495
    OpenUrlAbstract/FREE Full Text
  30. ↵
    1. Lee SH,
    2. Ryu JY,
    3. Kim SY,
    4. Jeon JH,
    5. Song JY,
    6. Cho HT,
    7. Choi SB,
    8. Choi D,
    9. de Marsac NT,
    10. Park YI
    (2007) Transcriptional regulation of the respiratory genes in the cyanobacterium Synechocystis sp. PCC 6803 during the early response to glucose feeding. Plant Physiol 145: 1018–1030
    OpenUrlAbstract/FREE Full Text
  31. ↵
    1. Li H,
    2. Sherman LA
    (2000) A redox-responsive regulator of photosynthesis gene expression in the cyanobacterium Synechocystis sp. Strain PCC 6803. J Bacteriol 182: 4268–4277
    OpenUrlAbstract/FREE Full Text
  32. ↵
    1. Ma W,
    2. Deng Y,
    3. Mi H
    (2008) Redox of plastoquinone pool regulates the expression and activity of NADPH dehydrogenase supercomplex in Synechocystis sp. strain PCC 6803. Curr Microbiol 56: 189–193
    OpenUrlCrossRefPubMed
  33. ↵
    1. McGinn PJ,
    2. Price GD,
    3. Maleszka R,
    4. Badger MR
    (2003) Inorganic carbon limitation and light control the expression of transcripts related to the CO2-concentrating mechanism in the cyanobacterium Synechocystis sp. strain PCC6803. Plant Physiol 132: 218–229
    OpenUrlAbstract/FREE Full Text
  34. ↵
    1. Moon YJ,
    2. Kim SY,
    3. Jung KH,
    4. Choi JS,
    5. Park YM,
    6. Chung YH
    (2011) Cyanobacterial phytochrome Cph2 is a negative regulator in phototaxis toward UV-A. FEBS Lett 585: 335–340
    OpenUrlCrossRefPubMed
  35. ↵
    1. Mullineaux CW
    (2001) How do cyanobacteria sense and respond to light? Mol Microbiol 41: 965–971
    OpenUrlCrossRefPubMed
  36. ↵
    1. Ng WO,
    2. Grossman AR,
    3. Bhaya D
    (2003) Multiple light inputs control phototaxis in Synechocystis sp. strain PCC6803. J Bacteriol 185: 1599–1607
    OpenUrlAbstract/FREE Full Text
  37. ↵
    1. Park CM,
    2. Kim JI,
    3. Yang SS,
    4. Kang JG,
    5. Kang JH,
    6. Shim JY,
    7. Chung YH,
    8. Park YM,
    9. Song PS
    (2000) A second photochromic bacteriophytochrome from Synechocystis sp. PCC 6803: spectral analysis and down-regulation by light. Biochemistry 39: 10840–10847
    OpenUrlCrossRefPubMed
  38. ↵
    1. Peschek GA,
    2. Obinger C,
    3. Paumann M
    (2004) The respiratory chain of blue-green algae (cyanobacteria). Physiol Plant 120: 358–369
    OpenUrlCrossRefPubMed
  39. ↵
    1. Ploug H,
    2. Grossart HP
    (1999) Bacterial production and respiration in suspended aggregates—a matter of the incubation method. Aquat Microb Ecol 20: 21–29
    OpenUrlCrossRef
  40. ↵
    1. Ploug H,
    2. Grossart HP,
    3. Azam F,
    4. Jorgensen BB
    (1999) Photosynthesis, respiration, and carbon turnover in sinking marine snow from surface waters of Southern California Bight: implications for the carbon cycle in the ocean. Mar Ecol Prog Ser 179: 1–11
    OpenUrlCrossRef
  41. ↵
    1. Rockwell NC,
    2. Su YS,
    3. Lagarias JC
    (2006) Phytochrome structure and signaling mechanisms. Annu Rev Plant Biol 57: 837–858
    OpenUrlCrossRefPubMed
  42. ↵
    1. Römling U,
    2. Amikam D
    (2006) Cyclic di-GMP as a second messenger. Curr Opin Microbiol 9: 218–228
    OpenUrlCrossRefPubMed
  43. ↵
    1. Sato H,
    2. Fujimori T,
    3. Sonoike K
    (2008) sll1961 is a novel regulator of phycobilisome degradation during nitrogen starvation in the cyanobacterium Synechocystis sp. PCC 6803. FEBS Lett 582: 1093–1096
    OpenUrlCrossRefPubMed
  44. ↵
    1. Savakis P,
    2. De Causmaecker S,
    3. Angerer V,
    4. Ruppert U,
    5. Anders K,
    6. Essen LO,
    7. Wilde A
    (2012) Light-induced alteration of c-di-GMP level controls motility of Synechocystis sp. PCC 6803. Mol Microbiol 85: 239–251
    OpenUrlCrossRefPubMed
  45. ↵
    1. Simm R,
    2. Morr M,
    3. Kader A,
    4. Nimtz M,
    5. Römling U
    (2004) GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol Microbiol 53: 1123–1134
    OpenUrlCrossRefPubMed
  46. ↵
    1. Singh AK,
    2. Bhattacharyya-Pakrasi M,
    3. Elvitigala T,
    4. Ghosh B,
    5. Aurora R,
    6. Pakrasi HB
    (2009) A systems-level analysis of the effects of light quality on the metabolism of a cyanobacterium. Plant Physiol 151: 1596–1608
    OpenUrlAbstract/FREE Full Text
  47. ↵
    1. Slabas AR,
    2. Suzuki I,
    3. Murata N,
    4. Simon WJ,
    5. Hall JJ
    (2006) Proteomic analysis of the heat shock response in Synechocystis PCC6803 and a thermally tolerant knockout strain lacking the histidine kinase 34 gene. Proteomics 6: 845–864
    OpenUrlCrossRefPubMed
  48. ↵
    1. Southey-Pillig CJ,
    2. Davies DG,
    3. Sauer K
    (2005) Characterization of temporal protein production in Pseudomonas aeruginosa biofilms. J Bacteriol 187: 8114–8126
    OpenUrlAbstract/FREE Full Text
  49. ↵
    1. Stanier RY,
    2. Kunisawa R,
    3. Mandel M,
    4. Cohen-Bazire G
    (1971) Purification and properties of unicellular blue-green algae (order Chroococcales). Bacteriol Rev 35: 171–205
    OpenUrlFREE Full Text
  50. ↵
    1. Sundaram S,
    2. Karakaya H,
    3. Scanlan DJ,
    4. Mann NH
    (1998) Multiple oligomeric forms of glucose-6-phosphate dehydrogenase in cyanobacteria and the role of OpcA in the assembly process. Microbiology 144: 1549–1556
    OpenUrlAbstract/FREE Full Text
  51. ↵
    1. Tsunoyama Y,
    2. Bernát G,
    3. Dyczmons NG,
    4. Schneider D,
    5. Rögner M
    (2009) Multiple Rieske proteins enable short- and long-term light adaptation of Synechocystis sp. PCC 6803. J Biol Chem 284: 27875–27883
    OpenUrlAbstract/FREE Full Text
  52. ↵
    1. Vermaas WFJ
    (2001) Photosynthesis and respiration in cyanobacteria. In Encyclopedia of Life Sciences. Nature Publishing Group, London, pp 245–251 http://www.onlinelibrary.wiley.com/doi/10.1038/npg.els.0001670/full
  53. ↵
    1. Wilde A,
    2. Fiedler B,
    3. Börner T
    (2002) The cyanobacterial phytochrome Cph2 inhibits phototaxis towards blue light. Mol Microbiol 44: 981–988
    OpenUrlCrossRefPubMed
  54. ↵
    1. Wu SH,
    2. Lagarias JC
    (2000) Defining the bilin lyase domain: lessons from the extended phytochrome superfamily. Biochemistry 39: 13487–13495
    OpenUrlCrossRefPubMed
  55. ↵
    1. Yang C,
    2. Hua Q,
    3. Shimizu K
    (2002a) Integration of the information from gene expression and metabolic fluxes for the analysis of the regulatory mechanisms in Synechocystis. Appl Microbiol Biotechnol 58: 813–822
    OpenUrlCrossRefPubMed
  56. ↵
    1. Yang C,
    2. Hua Q,
    3. Shimizu K
    (2002b) Metabolic flux analysis in Synechocystis using isotope distribution from 13C-labeled glucose. Metab Eng 4: 202–216
    OpenUrlCrossRefPubMed
  57. ↵
    1. Yeh KC,
    2. Wu SH,
    3. Murphy JT,
    4. Lagarias JC
    (1997) A cyanobacterial phytochrome two-component light sensory system. Science 277: 1505–1508
    OpenUrlAbstract/FREE Full Text
  58. ↵
    1. Zhang L,
    2. McSpadden B,
    3. Pakrasi HB,
    4. Whitmarsh J
    (1992) Copper-mediated regulation of cytochrome c553 and plastocyanin in the cyanobacterium Synechocystis 6803. J Biol Chem 267: 19054–19059
    OpenUrlAbstract/FREE Full Text
View Abstract
Back to top

Table of Contents

Print
Download PDF
Article Alerts
Email Article
Citation Tools
Cyanobacterial Phytochrome2 Regulates the Heterotrophic Metabolism and Has a Function in the Heat and High-Light Stress Response
Manti Schwarzkopf, Yong Cheol Yoo, Ralph Hückelhoven, Young Mok Park, Reinhard Korbinian Proels
Plant Physiology Apr 2014, 164 (4) 2157-2166; DOI: 10.1104/pp.113.233270
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

In this issue

View this article with LENS