Table I. Known miRNAs present in spikes of the wheat TGMS line

nt, Nucleotides.

miRNA FamilyNameaSequence (5′–3′)bLengthTPMcTypical Homology in miRBasePrimary miRNA (EST No.)
nt
miR156tae-miR156aUGACAGAAGAGAGUGAGCAC202,263.87ath-miR156a
tae-miR156bCGACAGAAGAGAGUGAGCAC201.6ath-miR156g
tae-miR156cUGACAGAAGAGAGCGAGCAC201.44zma-miR156k
tae-miR156dUGACAGAGGAGAGUGAGCAC200.93vvi-MIR156e
tae-miR156eUGACAGAAGAGAGAGAGCAC200.84ahy-miR156a
Ta_zma-miR156l*GCUCACUGCUCUAUCUGUCACC2212.67zma-miR156l*
miR157tae-miR157UUGACAGAAGAUAGAGAGCAC211.36ath-miR157a
miR159tae-miR159aUUUGGAUUGAAGGGAGCUCUG217.24tae-miR159a
miR160tae-miR160UGCCUGGCUCCCUGUAUGCCA216.86tae-miR160
tae-miR160bUGCCUGGCUCCCUGAAUGCCA210.54osa-miR160f
Ta_zma-miR160b*GCGUGCAAGGAGCCAAGCAUG213.85zma-miR160b*
Ta_zma-miR160a*GCGUGCAAGGGGCCAAGCAUG211.35zma-miR160a*
miR164tae-miR164UGGAGAAGCAGGGCACGUGCA2199.87tae-miR164
tae-miR164bUGGAGAAGCAGGGCACGUGCU212.96osa-miR164dAEOM01043585.1
miR165tae-miR165UCGGACCAGGCUUCAUCCCCC2110.64ath-miR165a
miR166tae-miR166aUCGGACCAGGCUUCAUUCCCC218,342.82ath-miR166a
tae-miR166bUCGGACCAGGCUUCAAUCCCU211,673.45osa-miR166k
tae-miR166cUCGGACCAGGCUUCAUUCCUU21982.4ptc-miR166n
tae-miR166dUCGGACCAGGCUUCAUUCCCU21828.67osa-miR166m
tae-miR166eUCGGACCAGGCUUCAUUCCUC2132.48osa-miR166i
tae-miR166fUCGGACCAGGCUUCAUUCCU2011.86sbi-miR166k
tae-miR166gUCGGACCAGGCUUCAUUCCCUU223.8crt-miR166b
tae-miR166hUCGAACCAGGCUUCAUUCCCC212.56osa-miR166e
tae -miR16iUCGGACCAGGCUUCAUUCCCCC220.66ctr-miR166
tae-miR166jUCGGACCAGGCUUCAUUCCUA210.73mtr-miR166b
tae-miR166kUCGGACCAGGCUCCAUUCCUU210.37ptc-miR166p
Ta_zma-miR166g*GGAAUGUUGUCUGGUUGGAGA2110.3zma-miR166g*
Ta_zma-miR166a*GGAAUGUUGUCUGGCUCGGGG217.79zma-miR166a*
Ta_zma-miR166b*GGAAUGUUGUCUGGUUCAAGG214.22zma-miR166b*
miR167tae-miR167UGAAGCUGCCAGCAUGAUCUA212,155.13tae-miR167
tae-miR167cUGAAGCUGCCAGCAUGAUCUGA224,429.17ccl-miR167aAEOM01105062.1
tae-miR167dUGAAGCUGCCAGCAUGAUCUU2137.06ahy-miR167-5p
tae-miR167eUGAAGCUGCCAGCAUGAUCUG2114.15osa-miR167d
tae-miR167fUGAAGCUGCCAGCAUGAUCUC212.07vvi-miR167c
tae-miR167gUGAAGCUGCCAGCAUGAUCUGG221.59ath-miR167d
miR168tae-miR168aUCGCUUGGUGCAGAUCGGGAC2116,321.81osa-miR168a
tae-miR168bUCGCUUGGGCAGAUCGGGAC200.64sof-miR168b
miR169tae-miR169aUAGCCAAGGAUGACUUGCCGG2124.07osa-miR169e
tae-miR169bUAGCCAAGGAUGAAUUGCCAG2110ata-miR169
tae-miR169cCAGCCAAGGAUGACUUGCCGG219.21ath-miR169b
tae-miR169dCAGCCAAGGAUGACUUGCCGA217.03ath-miR169a
tae-miR169eUAGCCAAGGAUGAUUUGCCU-201.04sbi-miR169oBJ225371.1
miR171tae-miR171aUGAUUGAGCCGUGCCAAUAUC2167.24tae-miR171a
tae-miR171bUUGAGCCGUGCCAAUAUCACG210.74tae-miR171b
tae-miR171cUGAUUGAGCCGCGCCAAUAUC2114.38ath-miR171a
miR172tae-miR172aAGAAUCUUGAUGAUGCUGCAU21356.03ath-miR172a
tae-miR172bGGAAUCUUGAUGAUGCUGCAU2122.38ath-miR172eAEOM01013727.1
tae-miR172dAGAAUCUUGAUGAUGCUGCA201.35zma-miR172a
miR319tae-miR319UUGGACUGAAGGGUGCUCCCU217.01bdi-miR319b
miR390tae-miR390AAGCUCAGGAGGGAUAGCGCC21231ath-miR390aAEOM01223153.1
tae-miR390*CGCUAUCUAUCCUGAGCUCCA211.67zma-miR390a*AEOM01223153.1
miR393tae-miR393UUCCAAAGGGAUCGCAUUGAU21125.25osa-miR393
miR394tae-miR394UUGGCAUUCUGUCCACCUCC203.31ath-miR394a
miR395tae-miR395bUGAAGUGUUUGGGGGAACUC203.64tae-miR395b
miR396tae-miR396aUCCACAGGCUUUCUUGAACUG21221.13osa-miR396dCJ776495.1
tae-miR396bUUCCACAGCUUUCUUGAACUU2110.56ath-miR396b
tae-miR396cUUCCACAGCUUUCUUGAACUG215.74ath-miR396a
Ta_zma-miR396f*GGUCAAGAAAGCUGUGGGAAG21141.45zma-miR396f*
Ta_zma-miR396b*GUUCAAUAAAGCUGUGGGAAA218.02zma-miR396b*
Ta_osa-miR396e-3pAUGGUUCAAGAAAGCCCAUGGAAA240.84osa-miR396e-3p
miR399tae-miR399UGCCAAAGGAGAAUUGCCC191.42tae-miR399
tae-miR399bUGCCAAAGGAGAGUUGCCCUG216.17ath-miR399bCJ667854.1
Ta_zma-miR399h*GUGCAGUUCUCCUCUGGCAUG215.7zma-miR399h*
miR408tae-miR408b-UGCACUGCCUCUUCCCUGGC200.68ath-miR408
miR444Ta_osa-miR444c.1UGUUGUCUCAAGCUUGCUGCC2110.38osa-miR444b.1
Ta_osa-miR444d.1UGCAGUUGCUGCCUCAAGCUU218.84osa-miR444a.2
Ta_osa-miR444c.2UGCAGUUGUUGUCUCAAGCUU212.96osa-miR444b.2
miR528tae-miR528UGGAAGGGGCAUGCAGAGGAG21643.26osa-miR528
miR827tae-miR827UUAGAUGACCAUCAGCAAACA2124.07osa-miR827a
miR894tae-miR894GUUUCACGUCGGGUUCACCA20173.55ppt-miR894
miR1135tae-miR1135CUGCGACAAGUAAUUCCGAACGGA240.49tae-miR1135
miR1318tae-miR1318UCAGGAGAGAUGACACCGACG214.31osa-miR1318
miR1432tae-miR1432aAUCAGGAGAGAUGACACCGAC211.27osa-miR1432
tae-miR1432bCUCAGGAGAGAUGACACCGAC212.03sbi-miR1432
miR1436tae-miR1436ACAUUAUGGGACGGAGGGAGU210.82osa-miR1436
miR2118tae-miR2118UUCCUGAUGUCUCCCAUUCCUA220.58zma-miR2118e
miR2275tae-miR2275UUUGGUUUCCUCCAAUAUCUCA220.74osa-miR2275a
Ta_zma-miR2275b-3pUUCAGUUUCCUCUAAUAUCUCA220.64zma-miR2275b-3p
  • a “Ta” at the start of the name indicates homologous miRNA*.  bUnderlined nucleotides represent nonconserved nucleotides among wheat and other plant species. A dash indicates the deletion of a nonconserved nucleotide.  cThe relative number of reads was obtained by normalizing read counts of each miRNA in each smRNA cDNA library to TPM (Supplemental Table S2). Reads only encompass defined mature miRNAs. The maximum TPM of each miRNA in the seven smRNA cDNA libraries is shown.